Starting /dee2/code/volunteer_pipeline.sh SRR7169905 current disk space = 3049078616064 free memory = 1511450544 SRR7169905 SRAfilesize b62671f0ab34fecc479c5cf7437a8067 SRR7169905.sra SRR7169905.sra file validated SRR7169905 is paired end SRR7169905 is conventional basespace SRR7169905 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169905_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.011 25.0 18.0 32.0 18.0 33.0 2 22.10925 18.0 18.0 27.0 18.0 33.0 3 27.2385 27.0 25.0 30.0 18.0 31.0 4 30.27775 31.0 29.0 33.0 27.0 33.0 5 31.903 33.0 32.0 33.0 31.0 33.0 6 36.1435 37.0 36.0 38.0 33.0 38.0 7 36.89525 38.0 37.0 38.0 35.0 38.0 8 37.38325 38.0 38.0 38.0 36.0 38.0 9 37.4865 38.0 38.0 38.0 37.0 38.0 10-14 37.5315 38.0 38.0 38.0 37.2 38.0 15-19 37.51365 38.0 38.0 38.0 37.8 38.0 20-24 37.5322 38.0 38.0 38.0 38.0 38.0 25-29 37.514500000000005 38.0 38.0 38.0 37.8 38.0 30-34 37.441700000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.4168 38.0 38.0 38.0 37.2 38.0 40-44 37.3745 38.0 38.0 38.0 37.0 38.0 45-49 37.396699999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.306 38.0 38.0 38.0 37.0 38.0 55-59 37.2138 38.0 38.0 38.0 36.6 38.0 60-64 37.1714 38.0 38.0 38.0 36.0 38.0 65-69 37.12695 38.0 38.0 38.0 36.0 38.0 70-74 36.988 38.0 38.0 38.0 36.0 38.0 75-79 36.9387 38.0 38.0 38.0 35.8 38.0 80-84 36.81545 38.0 38.0 38.0 35.2 38.0 85-89 36.80475 38.0 38.0 38.0 35.0 38.0 90-94 36.6548 38.0 38.0 38.0 34.4 38.0 95-99 36.5129 38.0 38.0 38.0 34.0 38.0 100-104 36.3568 38.0 38.0 38.0 34.0 38.0 105-109 36.0851 38.0 37.2 38.0 32.8 38.0 110-114 35.94680000000001 38.0 37.0 38.0 33.0 38.0 115-119 35.84825 38.0 37.0 38.0 31.8 38.0 120-124 35.49715 38.0 36.2 38.0 30.6 38.0 125-129 35.13865 38.0 36.0 38.0 28.4 38.0 130-134 34.93405 38.0 35.8 38.0 28.0 38.0 135-139 34.74185 38.0 35.4 38.0 27.2 38.0 140-144 34.175 38.0 35.0 38.0 23.0 38.0 145-149 33.8422 38.0 35.0 38.0 21.4 38.0 150-151 30.2295 36.5 28.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 3.0 15 0.0 16 0.0 17 2.0 18 2.0 19 6.0 20 3.0 21 3.0 22 6.0 23 9.0 24 12.0 25 11.0 26 12.0 27 21.0 28 22.0 29 45.0 30 43.0 31 54.0 32 83.0 33 116.0 34 196.0 35 299.0 36 874.0 37 2174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.58841463414634 10.54369918699187 8.739837398373984 36.1280487804878 2 24.4 12.15 34.825 28.625 3 20.549999999999997 20.025000000000002 23.974999999999998 35.449999999999996 4 23.0 28.175 23.724999999999998 25.1 5 23.075000000000003 31.974999999999998 24.625 20.325 6 19.875 35.725 25.374999999999996 19.025 7 14.524999999999999 26.075 42.075 17.325 8 17.599999999999998 25.75 31.275 25.374999999999996 9 17.0 25.75 33.45 23.799999999999997 10-14 19.400000000000002 30.31 27.375 22.915 15-19 19.495 28.535 28.15 23.82 20-24 19.34 29.720000000000002 27.57 23.369999999999997 25-29 19.88 29.785 27.060000000000002 23.275000000000002 30-34 19.435 29.080000000000002 27.735 23.75 35-39 20.105 29.09 27.075 23.73 40-44 19.975 29.035 28.084999999999997 22.905 45-49 20.05 29.23 26.5 24.22 50-54 19.71 29.310000000000002 27.529999999999998 23.45 55-59 19.91 28.92 27.08 24.09 60-64 19.645000000000003 29.17 26.495 24.69 65-69 19.96 29.175 27.534999999999997 23.330000000000002 70-74 20.1 29.235 27.284999999999997 23.380000000000003 75-79 20.57 28.655 27.474999999999998 23.3 80-84 20.1 29.425 27.18 23.294999999999998 85-89 20.53 28.95 27.24 23.28 90-94 20.595 28.854999999999997 27.125 23.425 95-99 19.905 28.96 27.43 23.705000000000002 100-104 20.155 29.095 27.575 23.175 105-109 20.41 28.985 27.055 23.549999999999997 110-114 20.585 28.365000000000002 27.325 23.724999999999998 115-119 20.01 28.910000000000004 27.37 23.71 120-124 19.994999999999997 28.37 27.555000000000003 24.08 125-129 20.9 28.249999999999996 27.07 23.78 130-134 20.66 28.835 27.045 23.46 135-139 20.25 28.17 27.425 24.154999999999998 140-144 20.865000000000002 28.24 27.105 23.79 145-149 20.830000000000002 28.32 27.584999999999997 23.265 150-151 20.2875 28.1625 27.125 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 2.0 24 3.0 25 2.5 26 6.0 27 8.5 28 11.0 29 22.0 30 26.5 31 30.0 32 41.5 33 47.5 34 63.0 35 75.5 36 94.0 37 121.0 38 136.0 39 161.5 40 186.0 41 206.5 42 223.0 43 242.0 44 271.0 45 270.0 46 249.0 47 249.5 48 239.5 49 204.0 50 169.5 51 146.5 52 117.0 53 87.0 54 74.0 55 55.5 56 36.5 57 32.0 58 27.5 59 15.5 60 10.0 61 7.5 62 4.0 63 4.0 64 4.5 65 4.5 66 3.0 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.9125 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.125 0.0 0.0 0.0 0.0 124-125 2.3375000000000004 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 2.9375 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.5999999999999996 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTTTA 10 0.006832588 144.9875 2 >>END_MODULE SRR7169905 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169905_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60775 33.0 33.0 34.0 32.0 34.0 2 32.66775 33.0 33.0 34.0 32.0 34.0 3 32.75025 34.0 33.0 34.0 32.0 34.0 4 32.622 34.0 33.0 34.0 32.0 34.0 5 32.6205 34.0 33.0 34.0 32.0 34.0 6 36.82975 38.0 38.0 38.0 36.0 38.0 7 36.9115 38.0 38.0 38.0 36.0 38.0 8 36.942 38.0 38.0 38.0 37.0 38.0 9 36.80725 38.0 38.0 38.0 36.0 38.0 10-14 36.8487 38.0 38.0 38.0 36.4 38.0 15-19 36.77095 38.0 38.0 38.0 36.0 38.0 20-24 36.83335 38.0 38.0 38.0 36.4 38.0 25-29 36.754099999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.68015 38.0 38.0 38.0 36.0 38.0 35-39 36.64755 38.0 38.0 38.0 35.8 38.0 40-44 36.58220000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.60525 38.0 38.0 38.0 36.0 38.0 50-54 36.59325 38.0 38.0 38.0 35.8 38.0 55-59 36.47905 38.0 38.0 38.0 35.0 38.0 60-64 36.446999999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.310950000000005 38.0 38.0 38.0 34.2 38.0 70-74 36.1886 38.0 38.0 38.0 34.0 38.0 75-79 36.05045 38.0 38.0 38.0 33.6 38.0 80-84 36.0644 38.0 38.0 38.0 33.6 38.0 85-89 36.018150000000006 38.0 38.0 38.0 33.6 38.0 90-94 35.92525 38.0 38.0 38.0 33.2 38.0 95-99 35.864549999999994 38.0 38.0 38.0 33.0 38.0 100-104 35.719100000000005 38.0 38.0 38.0 32.6 38.0 105-109 35.571600000000004 38.0 37.2 38.0 31.0 38.0 110-114 35.4611 38.0 37.0 38.0 31.0 38.0 115-119 35.234249999999996 38.0 37.0 38.0 29.8 38.0 120-124 35.011649999999996 38.0 36.6 38.0 28.4 38.0 125-129 34.6715 38.0 36.0 38.0 27.0 38.0 130-134 34.34875 38.0 35.4 38.0 24.8 38.0 135-139 33.951350000000005 38.0 35.0 38.0 21.2 38.0 140-144 33.5304 38.0 35.0 38.0 18.6 38.0 145-149 32.7786 38.0 34.6 38.0 11.6 38.0 150-151 28.613999999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 7.0 4 4.0 5 0.0 6 2.0 7 2.0 8 3.0 9 0.0 10 3.0 11 3.0 12 3.0 13 4.0 14 3.0 15 2.0 16 0.0 17 5.0 18 3.0 19 16.0 20 11.0 21 14.0 22 10.0 23 19.0 24 19.0 25 19.0 26 20.0 27 30.0 28 29.0 29 33.0 30 50.0 31 66.0 32 76.0 33 99.0 34 147.0 35 213.0 36 536.0 37 2520.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.29464732366183 21.03551775887944 13.48174087043522 26.18809404702351 2 26.27480532529515 25.62170308967596 31.650339110776187 16.4531524742527 3 20.201005025125628 28.316582914572862 31.582914572864322 19.899497487437188 4 22.48743718592965 34.74874371859297 23.44221105527638 19.321608040201006 5 23.316582914572866 36.582914572864325 22.738693467336685 17.36180904522613 6 19.91961818638533 37.50313991459432 23.888470233609645 18.6887716654107 7 19.9698568198945 20.74855563928661 39.361969354433555 19.91961818638533 8 21.67797035920623 26.325043958804322 26.877668927405175 25.119316754584275 9 21.376538558151218 24.415975885455914 30.36925395629239 23.838231600100475 10-14 23.32228249949769 28.134418324291744 27.335744424352022 21.20755475185855 15-19 23.039437327304697 27.857322280833962 27.842250690781214 21.26098970108013 20-24 22.420375766100673 28.46377976489501 27.89108811413644 21.22475635486788 25-29 22.78322029640794 27.97287113790505 27.5408188897262 21.70308967596081 30-34 22.55714644561668 27.802059783973874 28.17884953529264 21.461944235116807 35-39 22.83848279326802 28.319517709118315 27.91258477769405 20.929414719919617 40-44 22.95403165033911 28.13865862848531 28.198944988696304 20.708364732479275 45-49 23.095860128617364 27.26587620578778 28.42644694533762 21.211816720257236 50-54 23.045618971061092 28.004421221864952 28.45659163987138 20.493368167202572 55-59 23.908565687013315 27.535795026375283 28.06330067822155 20.49233860838985 60-64 23.017029185713568 27.944943989551412 28.37695283066258 20.66107399407244 65-69 23.358287695322314 27.89529216701 28.025925739838215 20.720494397829473 70-74 23.354436740026127 28.097678625263793 27.83137373128329 20.71651090342679 75-79 23.194814330938144 27.787548364403797 28.63675192201397 20.380885382644088 80-84 22.978744786694136 28.129239736696647 27.87297120747701 21.019044269132202 85-89 23.447236180904525 27.70854271356784 28.396984924623116 20.447236180904525 90-94 23.69227677001156 27.656901663233 28.561378825184665 20.089442741570775 95-99 23.22110552763819 27.63819095477387 28.246231155778894 20.894472361809044 100-104 23.738693467336685 28.080402010050253 27.819095477386934 20.36180904522613 105-109 24.12562814070352 27.35175879396985 27.814070351758797 20.70854271356784 110-114 24.020100502512562 27.41206030150754 28.522613065326635 20.045226130653266 115-119 23.64824120603015 27.673366834170853 27.82914572864322 20.849246231155778 120-124 23.87939698492462 28.160804020100507 27.783919597989946 20.175879396984925 125-129 24.20603015075377 27.904522613065325 27.42211055276382 20.467336683417088 130-134 24.301367108966627 28.151387213510255 27.4929634097306 20.05428226779252 135-139 24.374308975776458 27.520353804402454 27.982711830334704 20.12262538948638 140-144 24.33030105040961 28.134894707744884 27.205106297431776 20.32969794441373 145-149 24.644383010806735 27.650163357627545 27.64513696908771 20.06031666247801 150-151 24.86180904522613 27.500000000000004 27.763819095477388 19.874371859296485 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 9.0 2 5.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.5 25 2.0 26 3.5 27 5.5 28 10.0 29 10.5 30 14.0 31 21.0 32 22.0 33 29.5 34 52.5 35 67.5 36 77.0 37 107.0 38 128.5 39 157.0 40 201.5 41 223.0 42 253.5 43 285.0 44 296.5 45 292.5 46 279.0 47 269.0 48 238.0 49 197.0 50 171.0 51 138.5 52 107.0 53 90.0 54 62.0 55 42.0 56 30.0 57 19.5 58 17.5 59 12.5 60 11.0 61 10.0 62 8.5 63 5.0 64 3.0 65 2.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.475 3 0.5 4 0.5 5 0.5 6 0.475 7 0.475 8 0.475 9 0.475 10-14 0.45999999999999996 15-19 0.475 20-24 0.47000000000000003 25-29 0.475 30-34 0.475 35-39 0.475 40-44 0.475 45-49 0.48 50-54 0.48 55-59 0.475 60-64 0.46499999999999997 65-69 0.485 70-74 0.49 75-79 0.49500000000000005 80-84 0.49500000000000005 85-89 0.5 90-94 0.49500000000000005 95-99 0.5 100-104 0.5 105-109 0.5 110-114 0.5 115-119 0.5 120-124 0.5 125-129 0.5 130-134 0.52 135-139 0.51 140-144 0.515 145-149 0.525 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.35202413879808897 0.7000000000000001 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025144581342720643 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3875000000000002 0.0 0.0 0.0 0.0 114-115 1.5750000000000002 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.4 0.0 0.0 0.0 0.0 126-127 2.625 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.6500000000000004 0.0 0.0 0.0 0.0 138-139 3.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCTT 10 0.006830828 145.0 2 AATGATC 10 0.006830828 145.0 6 TTTTTTT 20 0.00593511 29.0 85-89 >>END_MODULE Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739176 spots for SRR7169905.sra Written 739176 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra Read 739172 spots for SRR7169905.sra Written 739172 spots for SRR7169905.sra SRR ids: ['SRR7169905.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dr2gy54s SRR7169905.sra spots: 14783444 blocks: [[1, 739172], [739173, 1478344], [1478345, 2217516], [2217517, 2956688], [2956689, 3695860], [3695861, 4435032], [4435033, 5174204], [5174205, 5913376], [5913377, 6652548], [6652549, 7391720], [7391721, 8130892], [8130893, 8870064], [8870065, 9609236], [9609237, 10348408], [10348409, 11087580], [11087581, 11826752], [11826753, 12565924], [12565925, 13305096], [13305097, 14044268], [14044269, 14783444]] SRR7169905 file size 4987923 SRR7169905 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169905 SRR7169905_1.fastq SRR7169905_2.fastq Input file: SRR7169905_1.fastq Paired file: SRR7169905_2.fastq trimmed: SRR7169905-trimmed-pair1.fastq, SRR7169905-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:48:29 2025 >> started Wed Feb 12 02:48:46 2025 >> done (17.551s) 14783444 read pairs processed; of these: 27697 ( 0.19%) short read pairs filtered out after trimming by size control 56066 ( 0.38%) empty read pairs filtered out after trimming by size control 14699681 (99.43%) read pairs available; of these: 6101726 (41.51%) trimmed read pairs available after processing 8597955 (58.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 8 0.00% 24 4 0.00% 25 4 0.00% 26 5 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 5 0.00% 31 6 0.00% 32 4 0.00% 33 8 0.00% 34 10 0.00% 35 12 0.00% 36 11 0.00% 37 11 0.00% 38 12 0.00% 39 18 0.00% 40 14 0.00% 41 27 0.00% 42 18 0.00% 43 23 0.00% 44 19 0.00% 45 26 0.00% 46 35 0.00% 47 28 0.00% 48 44 0.00% 49 51 0.00% 50 43 0.00% 51 71 0.00% 52 82 0.00% 53 66 0.00% 54 91 0.00% 55 82 0.00% 56 114 0.00% 57 124 0.00% 58 158 0.00% 59 168 0.00% 60 231 0.00% 61 235 0.00% 62 262 0.00% 63 297 0.00% 64 321 0.00% 65 406 0.00% 66 408 0.00% 67 456 0.00% 68 487 0.00% 69 605 0.00% 70 662 0.00% 71 799 0.01% 72 939 0.01% 73 1057 0.01% 74 1168 0.01% 75 1268 0.01% 76 1333 0.01% 77 1587 0.01% 78 1699 0.01% 79 1963 0.01% 80 2107 0.01% 81 2390 0.02% 82 2782 0.02% 83 3140 0.02% 84 4043 0.03% 85 4550 0.03% 86 4924 0.03% 87 5322 0.04% 88 5501 0.04% 89 5767 0.04% 90 6062 0.04% 91 6424 0.04% 92 6938 0.05% 93 7321 0.05% 94 7779 0.05% 95 8108 0.06% 96 8606 0.06% 97 8877 0.06% 98 9103 0.06% 99 9314 0.06% 100 9725 0.07% 101 10214 0.07% 102 10729 0.07% 103 11595 0.08% 104 11989 0.08% 105 12702 0.09% 106 13245 0.09% 107 13692 0.09% 108 13924 0.09% 109 14105 0.10% 110 14416 0.10% 111 14849 0.10% 112 15789 0.11% 113 16448 0.11% 114 17420 0.12% 115 18239 0.12% 116 18860 0.13% 117 19279 0.13% 118 19666 0.13% 119 20086 0.14% 120 20523 0.14% 121 21389 0.15% 122 22259 0.15% 123 23505 0.16% 124 24674 0.17% 125 25640 0.17% 126 27014 0.18% 127 27936 0.19% 128 28646 0.19% 129 29833 0.20% 130 31406 0.21% 131 32676 0.22% 132 34808 0.24% 133 37050 0.25% 134 38566 0.26% 135 41439 0.28% 136 43423 0.30% 137 46389 0.32% 138 50855 0.35% 139 54893 0.37% 140 59659 0.41% 141 65763 0.45% 142 73845 0.50% 143 82954 0.56% 144 97282 0.66% 145 116153 0.79% 146 147282 1.00% 147 199585 1.36% 148 305010 2.07% 149 650763 4.43% 150 3206875 21.82% 151 8597955 58.49% 14699681 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=354.21 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=12 fanout-score=50.41 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=13.6 sequence=TGTTGGTGGTGGTACTGGA SRR7169905 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:49:31 Started mapping on | Feb 12 02:49:31 Finished on | Feb 12 02:50:46 Mapping speed, Million of reads per hour | 705.58 Number of input reads | 14699681 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 13998631 Uniquely mapped reads % | 95.23% Average mapped length | 295.27 Number of splices: Total | 13186295 Number of splices: Annotated (sjdb) | 12968788 Number of splices: GT/AG | 12997826 Number of splices: GC/AG | 151052 Number of splices: AT/AC | 9913 Number of splices: Non-canonical | 27504 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248204 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 30223 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 467223 467223 467223 N_multimapping 248204 248204 248204 N_noFeature 357742 13844434 416399 N_ambiguous 158844 795 62726 UnstrandedReadsAssigned:13482045 PositiveStrandReadsAssigned:153402 NegativeStrandReadsAssigned:13519506 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169905 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169905-trimmed-pair1.fastq SRR7169905-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,699,681 reads, 13,418,825 reads pseudoaligned [quant] estimated average fragment length: 284.605 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7169905.ke.tsv 34699 SRR7169905.se.tsv 87100 total ==> SRR7169905.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.39 321 13.7561 Potri.005G024800.1.v4.1 1035 751.395 46 4.55016 Potri.004G059700.1.v4.1 961 677.432 2 0.219433 Potri.007G009000.2.v4.1 1416 1132.39 0 0 Potri.003G141000.2.v4.1 2943 2659.39 259.1 7.24139 Potri.016G087400.1.v4.1 270 74.3695 1125.97 1125.3 Potri.015G069301.1.v4.1 564 288.727 0 0 Potri.010G195200.1.v4.1 1773 1489.39 6 0.299419 Potri.012G127500.1.v4.1 977 693.408 3478 372.802 ==> SRR7169905.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1539 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 3 SRR7169905 completed mapping pipeline successfully