Starting /dee2/code/volunteer_pipeline.sh SRR7169906 current disk space = 3049898545152 free memory = 891015956 SRR7169906 SRAfilesize 9865e451730fa19c3173149604db10ec SRR7169906.sra SRR7169906.sra file validated SRR7169906 is paired end SRR7169906 is conventional basespace SRR7169906 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169906_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.95225 18.0 18.0 18.0 18.0 32.0 2 26.55025 27.0 25.0 27.0 25.0 30.0 3 28.04475 29.0 27.0 31.0 25.0 33.0 4 31.1155 31.0 30.0 33.0 29.0 33.0 5 32.09575 33.0 32.0 33.0 31.0 33.0 6 36.437 37.0 36.0 38.0 34.0 38.0 7 37.28375 38.0 38.0 38.0 36.0 38.0 8 37.35875 38.0 38.0 38.0 36.0 38.0 9 37.4565 38.0 38.0 38.0 37.0 38.0 10-14 37.4046 38.0 38.0 38.0 36.8 38.0 15-19 37.159299999999995 38.0 38.0 38.0 35.8 38.0 20-24 37.6592 38.0 38.0 38.0 37.8 38.0 25-29 37.700450000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.47115 38.0 38.0 38.0 37.4 38.0 35-39 37.51485 38.0 38.0 38.0 37.4 38.0 40-44 37.336 38.0 38.0 38.0 37.0 38.0 45-49 37.282650000000004 38.0 38.0 38.0 36.8 38.0 50-54 37.09705 38.0 38.0 38.0 35.8 38.0 55-59 36.8595 38.0 37.8 38.0 35.2 38.0 60-64 37.083549999999995 38.0 38.0 38.0 35.8 38.0 65-69 37.20005 38.0 38.0 38.0 36.2 38.0 70-74 36.8592 38.0 38.0 38.0 35.4 38.0 75-79 36.96424999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.9572 38.0 38.0 38.0 35.2 38.0 85-89 36.80525 38.0 38.0 38.0 35.0 38.0 90-94 36.70375 38.0 38.0 38.0 35.0 38.0 95-99 36.43735 38.0 37.2 38.0 34.0 38.0 100-104 36.2745 38.0 37.0 38.0 33.8 38.0 105-109 35.48135 38.0 36.0 38.0 29.8 38.0 110-114 35.8723 38.0 36.8 38.0 32.4 38.0 115-119 35.7475 38.0 36.4 38.0 31.4 38.0 120-124 35.6528 38.0 36.0 38.0 31.0 38.0 125-129 35.28805 38.0 35.6 38.0 29.4 38.0 130-134 34.78315 38.0 35.0 38.0 27.6 38.0 135-139 34.52955 38.0 34.6 38.0 26.4 38.0 140-144 33.5321 37.6 33.2 38.0 21.0 38.0 145-149 32.712599999999995 37.6 32.6 38.0 17.0 38.0 150-151 28.641875 35.0 26.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 5.0 20 5.0 21 3.0 22 4.0 23 6.0 24 4.0 25 8.0 26 11.0 27 8.0 28 14.0 29 18.0 30 42.0 31 58.0 32 71.0 33 155.0 34 256.0 35 508.0 36 1364.0 37 1453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.525 36.95 7.875 33.650000000000006 2 23.575 14.174999999999999 32.800000000000004 29.45 3 20.674999999999997 16.975 27.175 35.175 4 23.175 25.674999999999997 23.724999999999998 27.425 5 23.799999999999997 29.325000000000003 24.224999999999998 22.650000000000002 6 19.625 34.599999999999994 24.2 21.575 7 15.525 26.35 40.425 17.7 8 18.35 28.15 30.049999999999997 23.45 9 17.5 25.900000000000002 33.675 22.925 10-14 19.235 30.5 27.435 22.830000000000002 15-19 19.814999999999998 29.01 27.495000000000005 23.68 20-24 19.97 29.26 27.800000000000004 22.97 25-29 20.36 29.4 27.445000000000004 22.795 30-34 19.785 29.654999999999998 27.485 23.075000000000003 35-39 20.49 29.12 26.395000000000003 23.995 40-44 20.36 29.154999999999998 27.26 23.225 45-49 20.26 28.88 26.810000000000002 24.05 50-54 20.025000000000002 28.7 27.425 23.849999999999998 55-59 20.015 29.395 26.945000000000004 23.645 60-64 20.605 29.07 26.740000000000002 23.585 65-69 20.169999999999998 29.2 27.084999999999997 23.544999999999998 70-74 20.52 28.96 27.310000000000002 23.21 75-79 20.53 28.83 27.21 23.43 80-84 20.45 28.645 27.52 23.385 85-89 20.8 28.155 27.87 23.175 90-94 20.150000000000002 28.535 27.169999999999998 24.145 95-99 20.085 28.46 27.42 24.035 100-104 20.755000000000003 29.28 26.455000000000002 23.51 105-109 20.974999999999998 29.145 26.505000000000003 23.375 110-114 20.8 28.595 27.125 23.48 115-119 20.565 29.459999999999997 26.355 23.62 120-124 20.615 28.655 27.060000000000002 23.669999999999998 125-129 20.665 28.53 27.66 23.145 130-134 21.115000000000002 28.215 27.145000000000003 23.525 135-139 21.044999999999998 28.865000000000002 26.945000000000004 23.145 140-144 20.685000000000002 28.21 27.400000000000002 23.705000000000002 145-149 20.385 28.285 27.22 24.11 150-151 20.674999999999997 28.8875 27.450000000000003 22.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 2.0 24 2.0 25 3.0 26 4.5 27 6.0 28 7.0 29 12.0 30 17.5 31 17.0 32 30.0 33 49.0 34 59.5 35 69.0 36 82.5 37 116.0 38 137.5 39 155.0 40 179.5 41 200.0 42 255.0 43 279.0 44 270.5 45 278.0 46 278.0 47 280.0 48 245.0 49 204.0 50 173.5 51 139.5 52 115.5 53 98.0 54 74.5 55 44.0 56 34.0 57 24.5 58 15.5 59 11.0 60 6.5 61 3.5 62 5.0 63 4.0 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.3875 0.0 0.0 0.0 0.0 132-133 2.475 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 2.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169906 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169906_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.27425 34.0 33.0 34.0 33.0 34.0 2 33.3695 34.0 33.0 34.0 33.0 34.0 3 33.3705 34.0 33.0 34.0 33.0 34.0 4 33.319 34.0 33.0 34.0 33.0 34.0 5 33.35075 34.0 33.0 34.0 33.0 34.0 6 37.56475 38.0 38.0 38.0 38.0 38.0 7 37.51975 38.0 38.0 38.0 38.0 38.0 8 37.544 38.0 38.0 38.0 38.0 38.0 9 36.966 38.0 38.0 38.0 36.0 38.0 10-14 37.4357 38.0 38.0 38.0 37.6 38.0 15-19 37.4082 38.0 38.0 38.0 37.8 38.0 20-24 37.3393 38.0 38.0 38.0 37.4 38.0 25-29 37.15025 38.0 38.0 38.0 36.6 38.0 30-34 37.38745 38.0 38.0 38.0 37.4 38.0 35-39 37.23524999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.32665 38.0 38.0 38.0 37.0 38.0 45-49 37.251850000000005 38.0 38.0 38.0 36.8 38.0 50-54 36.7935 38.0 38.0 38.0 35.2 38.0 55-59 37.273900000000005 38.0 38.0 38.0 37.0 38.0 60-64 37.185100000000006 38.0 38.0 38.0 37.0 38.0 65-69 36.849399999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.2457 38.0 37.6 38.0 32.4 38.0 75-79 36.75175 38.0 38.0 38.0 35.0 38.0 80-84 36.04155 38.0 37.2 38.0 31.6 38.0 85-89 36.696999999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.8341 38.0 38.0 38.0 35.6 38.0 95-99 36.816500000000005 38.0 38.0 38.0 35.8 38.0 100-104 36.42255 38.0 38.0 38.0 34.2 38.0 105-109 36.287850000000006 38.0 38.0 38.0 33.8 38.0 110-114 36.4206 38.0 38.0 38.0 34.4 38.0 115-119 36.240449999999996 38.0 37.8 38.0 33.8 38.0 120-124 35.77645 38.0 36.8 38.0 32.2 38.0 125-129 35.8183 38.0 37.0 38.0 32.6 38.0 130-134 35.678399999999996 38.0 36.6 38.0 32.2 38.0 135-139 35.1506 38.0 36.0 38.0 29.8 38.0 140-144 34.727199999999996 38.0 35.2 38.0 28.0 38.0 145-149 34.38605 38.0 34.8 38.0 27.6 38.0 150-151 30.028 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 0.0 14 2.0 15 2.0 16 1.0 17 2.0 18 2.0 19 5.0 20 7.0 21 6.0 22 8.0 23 5.0 24 6.0 25 11.0 26 15.0 27 20.0 28 21.0 29 28.0 30 36.0 31 32.0 32 63.0 33 97.0 34 141.0 35 251.0 36 682.0 37 2548.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.425 23.375 13.175 25.025 2 27.650000000000002 27.05 28.549999999999997 16.75 3 20.8 29.2 30.349999999999998 19.650000000000002 4 22.5 33.300000000000004 24.25 19.950000000000003 5 24.474999999999998 36.425000000000004 21.575 17.525 6 21.85 37.75 22.95 17.45 7 20.525 22.3 38.550000000000004 18.625 8 20.974999999999998 27.224999999999998 27.400000000000002 24.4 9 21.349999999999998 25.674999999999997 29.049999999999997 23.925 10-14 23.405 28.884999999999998 26.419999999999998 21.29 15-19 23.075000000000003 27.755000000000003 27.915 21.255 20-24 22.97 27.76 28.07 21.2 25-29 22.34 27.865000000000002 28.194999999999997 21.6 30-34 22.27 28.16 28.68 20.89 35-39 22.5 27.944999999999997 27.85 21.705 40-44 22.814999999999998 28.26 27.994999999999997 20.93 45-49 22.955000000000002 28.294999999999998 27.845 20.905 50-54 22.64 28.1 28.08 21.18 55-59 23.79 27.74 27.705000000000002 20.765 60-64 23.25 28.244999999999997 27.700000000000003 20.805 65-69 23.18 27.57 28.405 20.845 70-74 22.925 27.589999999999996 28.18 21.305 75-79 23.325000000000003 27.625 28.16 20.89 80-84 23.61 27.54 27.91 20.94 85-89 23.995 28.015 27.615000000000002 20.375 90-94 23.375 27.384999999999998 28.255000000000003 20.985 95-99 23.43 27.76 28.139999999999997 20.669999999999998 100-104 24.145 27.43 27.6 20.825 105-109 23.919999999999998 27.755000000000003 27.85 20.474999999999998 110-114 24.04 28.33 26.790000000000003 20.84 115-119 23.91 27.839999999999996 27.55 20.7 120-124 23.715 27.675 27.839999999999996 20.77 125-129 24.16 27.92 27.339999999999996 20.580000000000002 130-134 24.08 27.765 27.55 20.605 135-139 24.29 27.57 27.82 20.32 140-144 23.57 27.845 27.55 21.035 145-149 23.985 26.905 28.16 20.95 150-151 23.75 27.487499999999997 28.449999999999996 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 2.0 26 2.0 27 3.5 28 5.0 29 7.0 30 9.5 31 11.5 32 20.0 33 30.0 34 40.0 35 58.5 36 71.0 37 94.0 38 140.5 39 180.0 40 198.0 41 233.0 42 264.5 43 279.0 44 316.0 45 291.0 46 261.0 47 274.5 48 247.5 49 207.0 50 173.5 51 147.5 52 118.0 53 87.0 54 65.5 55 47.0 56 33.0 57 27.5 58 21.0 59 11.5 60 8.0 61 4.5 62 2.0 63 0.5 64 0.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.3875 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.5625 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.8250000000000002 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.3625 0.0 0.0 0.0 0.0 132-133 2.45 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7375 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572016 spots for SRR7169906.sra Written 572016 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra Read 572009 spots for SRR7169906.sra Written 572009 spots for SRR7169906.sra SRR ids: ['SRR7169906.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v6j8wora SRR7169906.sra spots: 11440187 blocks: [[1, 572009], [572010, 1144018], [1144019, 1716027], [1716028, 2288036], [2288037, 2860045], [2860046, 3432054], [3432055, 4004063], [4004064, 4576072], [4576073, 5148081], [5148082, 5720090], [5720091, 6292099], [6292100, 6864108], [6864109, 7436117], [7436118, 8008126], [8008127, 8580135], [8580136, 9152144], [9152145, 9724153], [9724154, 10296162], [10296163, 10868171], [10868172, 11440187]] SRR7169906 file size 3855003 SRR7169906 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169906 SRR7169906_1.fastq SRR7169906_2.fastq Input file: SRR7169906_1.fastq Paired file: SRR7169906_2.fastq trimmed: SRR7169906-trimmed-pair1.fastq, SRR7169906-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:06:15 2025 >> started Wed Feb 12 02:06:28 2025 >> done (12.663s) 11440187 read pairs processed; of these: 6732 ( 0.06%) short read pairs filtered out after trimming by size control 6429 ( 0.06%) empty read pairs filtered out after trimming by size control 11427026 (99.88%) read pairs available; of these: 4680730 (40.96%) trimmed read pairs available after processing 6746296 (59.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 2 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 2 0.00% 29 2 0.00% 30 2 0.00% 31 3 0.00% 32 4 0.00% 33 3 0.00% 34 4 0.00% 35 5 0.00% 36 2 0.00% 37 5 0.00% 38 5 0.00% 39 5 0.00% 40 2 0.00% 41 3 0.00% 42 8 0.00% 43 13 0.00% 44 8 0.00% 45 8 0.00% 46 17 0.00% 47 16 0.00% 48 19 0.00% 49 21 0.00% 50 25 0.00% 51 41 0.00% 52 34 0.00% 53 42 0.00% 54 35 0.00% 55 55 0.00% 56 48 0.00% 57 46 0.00% 58 73 0.00% 59 101 0.00% 60 102 0.00% 61 111 0.00% 62 120 0.00% 63 162 0.00% 64 154 0.00% 65 185 0.00% 66 227 0.00% 67 219 0.00% 68 256 0.00% 69 285 0.00% 70 342 0.00% 71 412 0.00% 72 447 0.00% 73 533 0.00% 74 599 0.01% 75 606 0.01% 76 775 0.01% 77 833 0.01% 78 891 0.01% 79 1023 0.01% 80 1016 0.01% 81 1296 0.01% 82 1433 0.01% 83 1635 0.01% 84 2030 0.02% 85 2321 0.02% 86 2534 0.02% 87 2885 0.03% 88 3016 0.03% 89 3186 0.03% 90 3375 0.03% 91 3571 0.03% 92 3832 0.03% 93 4163 0.04% 94 4507 0.04% 95 4677 0.04% 96 4842 0.04% 97 5093 0.04% 98 5353 0.05% 99 5391 0.05% 100 5747 0.05% 101 6029 0.05% 102 6349 0.06% 103 6679 0.06% 104 7080 0.06% 105 7410 0.06% 106 7701 0.07% 107 8123 0.07% 108 8426 0.07% 109 8477 0.07% 110 8765 0.08% 111 9244 0.08% 112 9601 0.08% 113 10101 0.09% 114 10586 0.09% 115 10894 0.10% 116 11411 0.10% 117 11615 0.10% 118 11672 0.10% 119 12102 0.11% 120 12575 0.11% 121 12612 0.11% 122 13164 0.12% 123 13523 0.12% 124 14733 0.13% 125 15190 0.13% 126 15778 0.14% 127 16459 0.14% 128 17201 0.15% 129 17667 0.15% 130 18867 0.17% 131 19936 0.17% 132 20627 0.18% 133 21863 0.19% 134 23330 0.20% 135 25212 0.22% 136 27066 0.24% 137 29045 0.25% 138 31937 0.28% 139 35183 0.31% 140 37902 0.33% 141 42371 0.37% 142 47759 0.42% 143 55580 0.49% 144 67082 0.59% 145 85256 0.75% 146 110231 0.96% 147 152833 1.34% 148 242302 2.12% 149 502315 4.40% 150 2682016 23.47% 151 6746296 59.04% 11427026 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=39 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=237.74 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=18.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.16 sequence-density-rank=8 fanout-score=44.74 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=12.7 sequence=TGTTGGTGGTGGTACTGGA SRR7169906 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:07:13 Started mapping on | Feb 12 02:07:13 Finished on | Feb 12 02:08:23 Mapping speed, Million of reads per hour | 587.68 Number of input reads | 11427026 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10757015 Uniquely mapped reads % | 94.14% Average mapped length | 296.49 Number of splices: Total | 10390218 Number of splices: Annotated (sjdb) | 10232190 Number of splices: GT/AG | 10245925 Number of splices: GC/AG | 117575 Number of splices: AT/AC | 7260 Number of splices: Non-canonical | 19458 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 189541 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 29293 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.90% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 488048 488048 488048 N_multimapping 189541 189541 189541 N_noFeature 194472 10632437 238106 N_ambiguous 127079 609 45704 UnstrandedReadsAssigned:10435464 PositiveStrandReadsAssigned:123969 NegativeStrandReadsAssigned:10473205 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169906 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169906-trimmed-pair1.fastq SRR7169906-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,427,026 reads, 10,393,467 reads pseudoaligned [quant] estimated average fragment length: 296.615 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7169906.ke.tsv 34699 SRR7169906.se.tsv 87100 total ==> SRR7169906.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1722.39 210 11.9815 Potri.005G024800.1.v4.1 1035 739.385 23 3.05688 Potri.004G059700.1.v4.1 961 665.403 2 0.29537 Potri.007G009000.2.v4.1 1416 1120.39 0 0 Potri.003G141000.2.v4.1 2943 2647.39 182.062 6.75808 Potri.016G087400.1.v4.1 270 70.8207 880.529 1221.81 Potri.015G069301.1.v4.1 564 277.448 0 0 Potri.010G195200.1.v4.1 1773 1477.39 14 0.931228 Potri.012G127500.1.v4.1 977 681.391 3807 549.045 ==> SRR7169906.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 760 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 185 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169906 completed mapping pipeline successfully