Starting /dee2/code/volunteer_pipeline.sh SRR7169907 current disk space = 3049299730432 free memory = 1492118236 SRR7169907 SRAfilesize 646f01181a4ccfdc19e858533a502b66 SRR7169907.sra SRR7169907.sra file validated SRR7169907 is paired end SRR7169907 is conventional basespace SRR7169907 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169907_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.25525 18.0 18.0 28.0 18.0 32.0 2 30.59225 31.0 30.0 33.0 27.0 33.0 3 32.25175 33.0 33.0 33.0 31.0 33.0 4 32.57575 33.0 33.0 33.0 31.0 34.0 5 33.18575 33.0 33.0 34.0 33.0 34.0 6 37.1675 38.0 37.0 38.0 36.0 38.0 7 37.5035 38.0 38.0 38.0 37.0 38.0 8 37.59425 38.0 38.0 38.0 37.0 38.0 9 37.66725 38.0 38.0 38.0 38.0 38.0 10-14 37.4572 38.0 38.0 38.0 37.0 38.0 15-19 37.147749999999995 38.0 38.0 38.0 35.8 38.0 20-24 37.600550000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.609300000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.39595 38.0 38.0 38.0 37.4 38.0 35-39 37.5345 38.0 38.0 38.0 37.6 38.0 40-44 37.3414 38.0 38.0 38.0 37.2 38.0 45-49 37.24185 38.0 38.0 38.0 36.6 38.0 50-54 37.0004 38.0 38.0 38.0 36.0 38.0 55-59 36.8131 38.0 37.8 38.0 35.0 38.0 60-64 36.911500000000004 38.0 38.0 38.0 35.6 38.0 65-69 37.106 38.0 38.0 38.0 36.0 38.0 70-74 36.71445 38.0 37.8 38.0 34.8 38.0 75-79 36.826499999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.7924 38.0 38.0 38.0 35.0 38.0 85-89 36.75315 38.0 38.0 38.0 34.8 38.0 90-94 36.52685 38.0 38.0 38.0 34.0 38.0 95-99 36.300149999999995 38.0 37.0 38.0 34.0 38.0 100-104 36.15465 38.0 37.0 38.0 33.2 38.0 105-109 35.30805 38.0 35.8 38.0 29.0 38.0 110-114 35.7477 38.0 36.6 38.0 31.0 38.0 115-119 35.60425 38.0 36.0 38.0 31.0 38.0 120-124 35.5834 38.0 36.0 38.0 31.0 38.0 125-129 35.1004 38.0 35.4 38.0 28.4 38.0 130-134 34.481049999999996 38.0 34.8 38.0 25.8 38.0 135-139 34.269349999999996 38.0 34.6 38.0 25.0 38.0 140-144 33.28345 37.6 33.2 38.0 20.4 38.0 145-149 32.2844 37.4 31.6 38.0 14.0 38.0 150-151 27.822 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 1.0 18 4.0 19 4.0 20 3.0 21 2.0 22 6.0 23 9.0 24 6.0 25 7.0 26 15.0 27 10.0 28 23.0 29 27.0 30 44.0 31 61.0 32 96.0 33 120.0 34 244.0 35 470.0 36 1260.0 37 1581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.375 11.600000000000001 11.899999999999999 35.125 2 21.025 15.174999999999999 35.9 27.900000000000002 3 19.325 21.175 26.875 32.625 4 23.474999999999998 28.825 22.8 24.9 5 22.5 32.4 24.349999999999998 20.75 6 19.575 35.675000000000004 25.1 19.650000000000002 7 14.475 25.7 41.55 18.275 8 18.75 25.624999999999996 31.25 24.375 9 16.725 24.575 35.175 23.525 10-14 20.115 29.835 27.450000000000003 22.6 15-19 19.814999999999998 28.12 28.53 23.535 20-24 19.77 29.03 28.04 23.16 25-29 19.88 29.165000000000003 28.225 22.73 30-34 19.915 29.244999999999997 27.805000000000003 23.035 35-39 20.465 28.95 27.6 22.985 40-44 19.855 28.994999999999997 27.625 23.525 45-49 19.805 28.335 28.384999999999998 23.474999999999998 50-54 20.16 28.810000000000002 27.67 23.36 55-59 20.005 28.675 28.000000000000004 23.32 60-64 20.05 28.26 28.1 23.59 65-69 20.05 28.305000000000003 28.24 23.405 70-74 20.455000000000002 28.244999999999997 28.000000000000004 23.3 75-79 20.005 28.475 28.044999999999998 23.474999999999998 80-84 20.09 29.025000000000002 27.715 23.169999999999998 85-89 20.26 28.975 27.3 23.465 90-94 20.57 28.405 27.665 23.36 95-99 20.13 27.955000000000002 28.175 23.74 100-104 20.57 28.410000000000004 28.139999999999997 22.88 105-109 20.62 28.105000000000004 27.79 23.485 110-114 20.68 28.175 27.575 23.57 115-119 20.465 28.83 27.075 23.630000000000003 120-124 20.7 28.625 26.715 23.96 125-129 20.66 28.58 26.950000000000003 23.810000000000002 130-134 21.02 28.310000000000002 26.495 24.175 135-139 20.64 28.615000000000002 26.715 24.03 140-144 21.235 28.65 25.895000000000003 24.22 145-149 21.375 27.97 26.465 24.19 150-151 20.9375 28.9 26.075 24.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.0 23 1.0 24 4.0 25 4.5 26 3.0 27 6.0 28 9.5 29 14.0 30 18.5 31 28.0 32 37.5 33 51.0 34 68.0 35 85.0 36 95.0 37 121.0 38 151.0 39 163.0 40 207.0 41 242.5 42 234.5 43 239.0 44 260.0 45 258.5 46 254.0 47 251.5 48 227.0 49 202.5 50 171.5 51 132.0 52 104.5 53 91.5 54 70.5 55 50.0 56 40.5 57 26.5 58 19.0 59 12.5 60 9.5 61 7.0 62 5.5 63 4.0 64 1.5 65 2.5 66 2.0 67 2.0 68 3.0 69 1.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.23750000000000002 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.525 0.0 0.0 0.0 0.0 96-97 1.725 0.0 0.0 0.0 0.0 98-99 2.0375 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 3.0625 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 4.1375 0.0 0.0 0.0 0.0 110-111 4.525 0.0 0.0 0.0 0.0 112-113 5.1125 0.0 0.0 0.0 0.0 114-115 5.7125 0.0 0.0 0.0 0.0 116-117 6.5375 0.0 0.0 0.0 0.0 118-119 7.1875 0.0 0.0 0.0 0.0 120-121 7.6875 0.0 0.0 0.0 0.0 122-123 8.4625 0.0 0.0 0.0 0.0 124-125 9.1375 0.0 0.0 0.0 0.0 126-127 10.0 0.0 0.0 0.0 0.0 128-129 10.9 0.0 0.0 0.0 0.0 130-131 11.587499999999999 0.0 0.0 0.0 0.0 132-133 12.3 0.0 0.0 0.0 0.0 134-135 13.024999999999999 0.0 0.0 0.0 0.0 136-137 13.9875 0.0 0.0 0.0 0.0 138-139 14.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAAA 10 0.006830828 145.0 1 ACTTGGC 10 0.006830828 145.0 6 ACACTTG 10 0.006830828 145.0 4 CTTGGCC 10 0.006830828 145.0 7 CACTTGG 10 0.006830828 145.0 5 GAATTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7169907 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169907_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.41425 34.0 33.0 34.0 33.0 34.0 2 33.4805 34.0 33.0 34.0 33.0 34.0 3 33.49375 34.0 33.0 34.0 33.0 34.0 4 33.48825 34.0 33.0 34.0 33.0 34.0 5 33.487 34.0 33.0 34.0 33.0 34.0 6 37.6575 38.0 38.0 38.0 38.0 38.0 7 37.6055 38.0 38.0 38.0 38.0 38.0 8 37.594 38.0 38.0 38.0 38.0 38.0 9 37.23075 38.0 38.0 38.0 37.0 38.0 10-14 37.52900000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.53195 38.0 38.0 38.0 38.0 38.0 20-24 37.474450000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.311400000000006 38.0 38.0 38.0 37.4 38.0 30-34 37.53855 38.0 38.0 38.0 38.0 38.0 35-39 37.367599999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.40685 38.0 38.0 38.0 38.0 38.0 45-49 37.400999999999996 38.0 38.0 38.0 37.6 38.0 50-54 37.0147 38.0 38.0 38.0 36.4 38.0 55-59 37.4157 38.0 38.0 38.0 37.8 38.0 60-64 37.372400000000006 38.0 38.0 38.0 38.0 38.0 65-69 37.04515 38.0 38.0 38.0 36.6 38.0 70-74 36.4812 38.0 37.8 38.0 34.0 38.0 75-79 36.988150000000005 38.0 38.0 38.0 36.2 38.0 80-84 36.40745 38.0 37.8 38.0 34.0 38.0 85-89 37.00365 38.0 38.0 38.0 36.4 38.0 90-94 37.15065 38.0 38.0 38.0 37.0 38.0 95-99 37.097049999999996 38.0 38.0 38.0 36.8 38.0 100-104 36.799 38.0 38.0 38.0 35.6 38.0 105-109 36.722699999999996 38.0 38.0 38.0 35.2 38.0 110-114 36.768600000000006 38.0 38.0 38.0 35.4 38.0 115-119 36.68 38.0 38.0 38.0 35.2 38.0 120-124 36.23965 38.0 38.0 38.0 33.8 38.0 125-129 36.3019 38.0 38.0 38.0 34.0 38.0 130-134 36.131150000000005 38.0 38.0 38.0 34.0 38.0 135-139 35.72515 38.0 36.6 38.0 32.6 38.0 140-144 35.3894 38.0 36.0 38.0 31.4 38.0 145-149 35.0241 38.0 36.0 38.0 31.0 38.0 150-151 30.475625 35.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 3.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 1.0 17 0.0 18 2.0 19 1.0 20 4.0 21 1.0 22 2.0 23 7.0 24 2.0 25 7.0 26 12.0 27 10.0 28 9.0 29 12.0 30 13.0 31 29.0 32 37.0 33 77.0 34 96.0 35 199.0 36 576.0 37 2877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.025 19.975 15.8 24.2 2 27.05 25.924999999999997 29.4 17.625 3 20.424999999999997 29.2 32.074999999999996 18.3 4 24.9 33.25 22.7 19.15 5 24.725 35.675000000000004 21.95 17.65 6 21.05 36.75 24.675 17.525 7 20.4 20.825 39.074999999999996 19.7 8 21.475 26.174999999999997 27.975 24.375 9 22.25 25.324999999999996 30.175 22.25 10-14 23.585 29.07 25.785000000000004 21.560000000000002 15-19 23.630000000000003 28.189999999999998 27.405 20.775 20-24 23.34 28.52 27.62 20.52 25-29 23.375 28.305000000000003 27.605 20.715 30-34 23.39 28.355000000000004 27.965 20.29 35-39 23.655 27.905 28.24 20.200000000000003 40-44 23.56 28.57 27.49 20.380000000000003 45-49 23.325000000000003 28.845 27.665 20.165 50-54 23.599999999999998 27.794999999999998 28.549999999999997 20.055 55-59 23.015 28.02 28.025 20.94 60-64 23.175 28.155 27.875 20.794999999999998 65-69 22.264999999999997 28.555000000000003 29.025000000000002 20.155 70-74 23.305 27.955000000000002 28.255000000000003 20.485 75-79 23.49 28.655 27.975 19.88 80-84 23.72 28.205000000000002 27.805000000000003 20.27 85-89 23.685000000000002 27.939999999999998 28.13 20.244999999999997 90-94 23.95 27.46 28.365000000000002 20.225 95-99 23.68 28.49 27.665 20.165 100-104 24.104999999999997 28.005000000000003 27.884999999999998 20.005 105-109 24.385 28.060000000000002 27.235 20.32 110-114 24.495 28.384999999999998 27.41 19.71 115-119 24.63 28.544999999999998 27.029999999999998 19.794999999999998 120-124 25.44 28.015 27.065 19.48 125-129 25.16 28.84 27.029999999999998 18.970000000000002 130-134 25.055 28.799999999999997 27.08 19.064999999999998 135-139 25.53 28.71 26.75 19.009999999999998 140-144 25.47 28.53 27.284999999999997 18.715 145-149 27.205000000000002 27.485 27.245 18.065 150-151 25.9625 30.2875 26.3 17.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.0 22 1.0 23 0.5 24 0.0 25 0.5 26 1.0 27 3.5 28 9.0 29 11.0 30 10.5 31 19.5 32 26.0 33 35.0 34 48.5 35 64.0 36 90.0 37 115.5 38 142.0 39 170.5 40 212.0 41 249.5 42 258.5 43 278.5 44 289.0 45 271.0 46 263.0 47 251.5 48 226.0 49 195.0 50 168.5 51 145.0 52 123.0 53 87.5 54 57.5 55 42.0 56 34.5 57 31.0 58 19.0 59 14.0 60 9.5 61 6.0 62 4.0 63 2.0 64 2.0 65 1.5 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.23750000000000002 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.675 0.0 0.0 0.0 0.0 98-99 1.9874999999999998 0.0 0.0 0.0 0.0 100-101 2.2375 0.0 0.0 0.0 0.0 102-103 2.6 0.0 0.0 0.0 0.0 104-105 3.0375 0.0 0.0 0.0 0.0 106-107 3.6 0.0 0.0 0.0 0.0 108-109 4.2125 0.0 0.0 0.0 0.0 110-111 4.6 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.7875 0.0 0.0 0.0 0.0 116-117 6.637499999999999 0.0 0.0 0.0 0.0 118-119 7.275 0.0 0.0 0.0 0.0 120-121 7.75 0.0 0.0 0.0 0.0 122-123 8.5375 0.0 0.0 0.0 0.0 124-125 9.1875 0.0 0.0 0.0 0.0 126-127 10.025 0.0 0.0 0.0 0.0 128-129 10.95 0.0 0.0 0.0 0.0 130-131 11.675 0.0 0.0 0.0 0.0 132-133 12.412500000000001 0.0 0.0 0.0 0.0 134-135 13.175 0.0 0.0 0.0 0.0 136-137 14.225000000000001 0.0 0.0 0.0 0.0 138-139 15.274999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612711 spots for SRR7169907.sra Written 612711 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra Read 612704 spots for SRR7169907.sra Written 612704 spots for SRR7169907.sra SRR ids: ['SRR7169907.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qc0c4z14 SRR7169907.sra spots: 12254087 blocks: [[1, 612704], [612705, 1225408], [1225409, 1838112], [1838113, 2450816], [2450817, 3063520], [3063521, 3676224], [3676225, 4288928], [4288929, 4901632], [4901633, 5514336], [5514337, 6127040], [6127041, 6739744], [6739745, 7352448], [7352449, 7965152], [7965153, 8577856], [8577857, 9190560], [9190561, 9803264], [9803265, 10415968], [10415969, 11028672], [11028673, 11641376], [11641377, 12254087]] SRR7169907 file size 4130807 SRR7169907 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169907 SRR7169907_1.fastq SRR7169907_2.fastq Input file: SRR7169907_1.fastq Paired file: SRR7169907_2.fastq trimmed: SRR7169907-trimmed-pair1.fastq, SRR7169907-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:23:40 2025 >> started Wed Feb 12 02:23:53 2025 >> done (12.952s) 12254087 read pairs processed; of these: 11510 ( 0.09%) short read pairs filtered out after trimming by size control 9642 ( 0.08%) empty read pairs filtered out after trimming by size control 12232935 (99.83%) read pairs available; of these: 6029756 (49.29%) trimmed read pairs available after processing 6203179 (50.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 10 0.00% 29 5 0.00% 30 3 0.00% 31 6 0.00% 32 7 0.00% 33 10 0.00% 34 5 0.00% 35 13 0.00% 36 13 0.00% 37 17 0.00% 38 16 0.00% 39 11 0.00% 40 19 0.00% 41 15 0.00% 42 25 0.00% 43 30 0.00% 44 24 0.00% 45 29 0.00% 46 31 0.00% 47 39 0.00% 48 50 0.00% 49 69 0.00% 50 68 0.00% 51 74 0.00% 52 101 0.00% 53 119 0.00% 54 125 0.00% 55 157 0.00% 56 154 0.00% 57 223 0.00% 58 234 0.00% 59 273 0.00% 60 331 0.00% 61 405 0.00% 62 498 0.00% 63 568 0.00% 64 639 0.01% 65 693 0.01% 66 765 0.01% 67 876 0.01% 68 1032 0.01% 69 1178 0.01% 70 1421 0.01% 71 1599 0.01% 72 1974 0.02% 73 2331 0.02% 74 2516 0.02% 75 2922 0.02% 76 3108 0.03% 77 3455 0.03% 78 3789 0.03% 79 4236 0.03% 80 4799 0.04% 81 5514 0.05% 82 6261 0.05% 83 7238 0.06% 84 8377 0.07% 85 9493 0.08% 86 10046 0.08% 87 10862 0.09% 88 11586 0.09% 89 12194 0.10% 90 13387 0.11% 91 14479 0.12% 92 15917 0.13% 93 17556 0.14% 94 18560 0.15% 95 19728 0.16% 96 21052 0.17% 97 21471 0.18% 98 22242 0.18% 99 22937 0.19% 100 24060 0.20% 101 25233 0.21% 102 27104 0.22% 103 28681 0.23% 104 30407 0.25% 105 31420 0.26% 106 32562 0.27% 107 33008 0.27% 108 33516 0.27% 109 34351 0.28% 110 35124 0.29% 111 36607 0.30% 112 38106 0.31% 113 39907 0.33% 114 41702 0.34% 115 42931 0.35% 116 43685 0.36% 117 44255 0.36% 118 44729 0.37% 119 44364 0.36% 120 44974 0.37% 121 46007 0.38% 122 47578 0.39% 123 49049 0.40% 124 51112 0.42% 125 52642 0.43% 126 53573 0.44% 127 54248 0.44% 128 53992 0.44% 129 54690 0.45% 130 55092 0.45% 131 55388 0.45% 132 57516 0.47% 133 59845 0.49% 134 61296 0.50% 135 63356 0.52% 136 64564 0.53% 137 66289 0.54% 138 68137 0.56% 139 69793 0.57% 140 71343 0.58% 141 74842 0.61% 142 79579 0.65% 143 85144 0.70% 144 95000 0.78% 145 108546 0.89% 146 127778 1.04% 147 159466 1.30% 148 228322 1.87% 149 434061 3.55% 150 2414738 19.74% 151 6203179 50.71% 12232935 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.3 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=422.85 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=21.3 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.9 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=278.46 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=29.8 sequence=AAGAAGAAGAAA SRR7169907 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:24:35 Started mapping on | Feb 12 02:24:35 Finished on | Feb 12 02:25:51 Mapping speed, Million of reads per hour | 579.45 Number of input reads | 12232935 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11560247 Uniquely mapped reads % | 94.50% Average mapped length | 288.26 Number of splices: Total | 9934274 Number of splices: Annotated (sjdb) | 9745675 Number of splices: GT/AG | 9776984 Number of splices: GC/AG | 121473 Number of splices: AT/AC | 9014 Number of splices: Non-canonical | 26803 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 214077 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 14263 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.60% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 469188 469188 469188 N_multimapping 214077 214077 214077 N_noFeature 344540 11419928 408659 N_ambiguous 126525 989 49570 UnstrandedReadsAssigned:11089182 PositiveStrandReadsAssigned:139330 NegativeStrandReadsAssigned:11102018 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169907 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169907-trimmed-pair1.fastq SRR7169907-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,232,935 reads, 11,057,768 reads pseudoaligned [quant] estimated average fragment length: 207.59 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7169907.ke.tsv 34699 SRR7169907.se.tsv 87100 total ==> SRR7169907.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1811.41 215 11.3057 Potri.005G024800.1.v4.1 1035 828.41 78 8.96863 Potri.004G059700.1.v4.1 961 754.424 1 0.126259 Potri.007G009000.2.v4.1 1416 1209.41 0 0 Potri.003G141000.2.v4.1 2943 2736.41 231.049 8.04267 Potri.016G087400.1.v4.1 270 97.7473 806 785.429 Potri.015G069301.1.v4.1 564 359.862 0 0 Potri.010G195200.1.v4.1 1773 1566.41 56 3.40533 Potri.012G127500.1.v4.1 977 770.42 5155 637.35 ==> SRR7169907.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1383 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 306 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR7169907 completed mapping pipeline successfully