Starting /dee2/code/volunteer_pipeline.sh SRR7169908 current disk space = 3049265250304 free memory = 1489993560 SRR7169908 SRAfilesize 7be72a7bc2e8bd3c485578e6ccd02601 SRR7169908.sra SRR7169908.sra file validated SRR7169908 is paired end SRR7169908 is conventional basespace SRR7169908 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169908_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.5285 18.0 18.0 25.0 18.0 32.0 2 29.79475 30.0 28.0 31.0 27.0 33.0 3 31.21825 33.0 31.0 33.0 29.0 33.0 4 32.316 33.0 33.0 33.0 31.0 33.0 5 32.941 33.0 33.0 33.0 33.0 34.0 6 36.93 38.0 37.0 38.0 35.0 38.0 7 37.3265 38.0 38.0 38.0 36.0 38.0 8 37.60925 38.0 38.0 38.0 37.0 38.0 9 37.61725 38.0 38.0 38.0 38.0 38.0 10-14 37.6356 38.0 38.0 38.0 38.0 38.0 15-19 37.5697 38.0 38.0 38.0 37.8 38.0 20-24 37.59095 38.0 38.0 38.0 38.0 38.0 25-29 37.595000000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.56925 38.0 38.0 38.0 38.0 38.0 35-39 37.44 38.0 38.0 38.0 37.4 38.0 40-44 37.53895 38.0 38.0 38.0 37.6 38.0 45-49 37.47695 38.0 38.0 38.0 37.2 38.0 50-54 37.36815 38.0 38.0 38.0 37.0 38.0 55-59 37.20175 38.0 38.0 38.0 36.4 38.0 60-64 37.125 38.0 38.0 38.0 36.0 38.0 65-69 37.0437 38.0 38.0 38.0 36.0 38.0 70-74 36.78425 38.0 38.0 38.0 35.0 38.0 75-79 36.661350000000006 38.0 38.0 38.0 34.6 38.0 80-84 36.620450000000005 38.0 37.8 38.0 34.2 38.0 85-89 36.6557 38.0 37.8 38.0 34.6 38.0 90-94 36.58505 38.0 37.8 38.0 34.0 38.0 95-99 36.51605 38.0 37.8 38.0 34.0 38.0 100-104 36.17085 38.0 37.2 38.0 33.4 38.0 105-109 34.9183 38.0 35.2 38.0 27.0 38.0 110-114 35.26435 38.0 35.6 38.0 28.8 38.0 115-119 35.69179999999999 38.0 36.0 38.0 31.2 38.0 120-124 35.44665 38.0 36.0 38.0 30.6 38.0 125-129 34.76995 38.0 35.0 38.0 26.8 38.0 130-134 34.55145 38.0 34.6 38.0 26.6 38.0 135-139 33.48175 38.0 33.0 38.0 20.0 38.0 140-144 33.16735 38.0 33.2 38.0 21.0 38.0 145-149 31.60085 36.6 30.8 38.0 11.2 38.0 150-151 26.8205 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 1.0 12 2.0 13 0.0 14 1.0 15 1.0 16 0.0 17 2.0 18 4.0 19 1.0 20 0.0 21 2.0 22 5.0 23 8.0 24 8.0 25 8.0 26 17.0 27 21.0 28 28.0 29 21.0 30 47.0 31 54.0 32 88.0 33 144.0 34 280.0 35 465.0 36 1293.0 37 1496.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.23723723723724 13.73873873873874 15.89089089089089 33.133133133133136 2 22.725 16.85 31.324999999999996 29.099999999999998 3 19.7 20.424999999999997 27.05 32.824999999999996 4 22.475 27.0 23.549999999999997 26.974999999999998 5 21.075 31.324999999999996 25.7 21.9 6 20.724999999999998 33.675 25.174999999999997 20.424999999999997 7 14.124999999999998 28.4 40.0 17.474999999999998 8 17.05 28.249999999999996 30.55 24.15 9 16.65832916458229 27.238619309654826 32.816408204102046 23.28664332166083 10-14 19.61 31.15 27.279999999999998 21.959999999999997 15-19 19.29 29.770000000000003 27.755000000000003 23.185 20-24 19.45 29.39 27.6 23.56 25-29 18.92 29.84 27.96 23.28 30-34 19.66 29.92 27.345000000000002 23.075000000000003 35-39 19.5 29.549999999999997 27.950000000000003 23.0 40-44 19.900000000000002 29.785 27.37 22.945 45-49 19.465 29.044999999999998 27.700000000000003 23.79 50-54 19.345000000000002 30.130000000000003 27.42 23.105 55-59 20.135 29.235 26.979999999999997 23.65 60-64 19.465 29.630000000000003 26.97 23.935000000000002 65-69 20.23 29.125 27.405 23.24 70-74 19.945 29.57 27.1 23.385 75-79 19.67 28.835 27.700000000000003 23.794999999999998 80-84 19.97 29.25 27.505000000000003 23.275000000000002 85-89 19.994999999999997 29.175 27.169999999999998 23.66 90-94 20.345 28.64 27.650000000000002 23.365 95-99 20.349999999999998 29.09 27.205000000000002 23.355 100-104 20.115 29.395 27.155 23.335 105-109 20.71 29.360000000000003 26.75 23.18 110-114 20.974999999999998 28.95 27.27 22.805 115-119 19.975 29.835 26.805 23.385 120-124 20.916045802290114 28.126406320316015 27.60638031901595 23.35116755837792 125-129 20.581319725849216 28.92590925008755 27.330031517334536 23.1627395067287 130-134 21.265 28.125 26.935 23.674999999999997 135-139 20.97 28.365000000000002 26.945000000000004 23.72 140-144 19.919999999999998 29.060000000000002 26.525 24.495 145-149 19.88 28.560000000000002 27.310000000000002 24.25 150-151 19.8625 28.487499999999997 28.000000000000004 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 2.0 22 1.5 23 1.0 24 1.5 25 2.0 26 8.5 27 12.0 28 10.5 29 19.0 30 26.5 31 33.5 32 46.5 33 57.0 34 69.0 35 88.0 36 104.5 37 123.0 38 147.5 39 162.0 40 188.0 41 219.0 42 233.0 43 257.0 44 282.5 45 280.0 46 260.5 47 241.5 48 224.5 49 194.0 50 147.5 51 118.5 52 106.5 53 95.5 54 70.5 55 43.0 56 28.5 57 21.5 58 20.0 59 14.0 60 10.0 61 6.0 62 5.5 63 5.5 64 2.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.055 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21796165489405 98.32499999999999 2 0.6559031281533804 1.3 3 0.12613521695257315 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.8375 0.0 0.0 0.0 0.0 118-119 1.9875 0.0 0.0 0.0 0.0 120-121 2.1375 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGGCCT 10 0.006830828 145.0 3 CCAGTCA 20 0.00593511 29.0 110-114 >>END_MODULE SRR7169908 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169908_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.113 34.0 33.0 34.0 33.0 34.0 2 33.24775 34.0 33.0 34.0 33.0 34.0 3 33.252 34.0 33.0 34.0 33.0 34.0 4 33.32225 34.0 33.0 34.0 33.0 34.0 5 33.30075 34.0 33.0 34.0 33.0 34.0 6 37.473 38.0 38.0 38.0 38.0 38.0 7 37.49 38.0 38.0 38.0 38.0 38.0 8 37.418 38.0 38.0 38.0 38.0 38.0 9 37.42425 38.0 38.0 38.0 38.0 38.0 10-14 37.406600000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.33045 38.0 38.0 38.0 37.8 38.0 20-24 37.133449999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.30005 38.0 38.0 38.0 38.0 38.0 30-34 37.170399999999994 38.0 38.0 38.0 37.4 38.0 35-39 37.31315000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.22795 38.0 38.0 38.0 37.8 38.0 45-49 37.135000000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.22825 38.0 38.0 38.0 37.8 38.0 55-59 37.19105 38.0 38.0 38.0 38.0 38.0 60-64 37.074650000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.03935 38.0 38.0 38.0 37.0 38.0 70-74 36.61475 38.0 38.0 38.0 35.2 38.0 75-79 36.60945 38.0 38.0 38.0 35.0 38.0 80-84 36.966750000000005 38.0 38.0 38.0 36.8 38.0 85-89 36.941700000000004 38.0 38.0 38.0 37.0 38.0 90-94 36.94455000000001 38.0 38.0 38.0 36.8 38.0 95-99 36.8632 38.0 38.0 38.0 36.2 38.0 100-104 36.71855 38.0 38.0 38.0 36.0 38.0 105-109 36.6097 38.0 38.0 38.0 35.2 38.0 110-114 36.100350000000006 38.0 37.4 38.0 33.0 38.0 115-119 36.38095 38.0 38.0 38.0 34.2 38.0 120-124 36.2895 38.0 38.0 38.0 34.2 38.0 125-129 36.115449999999996 38.0 38.0 38.0 33.8 38.0 130-134 35.77915 38.0 37.4 38.0 32.4 38.0 135-139 35.504000000000005 38.0 36.6 38.0 31.0 38.0 140-144 32.6863 37.6 32.0 38.0 16.8 38.0 145-149 34.28 38.0 35.0 38.0 27.4 38.0 150-151 29.91225 35.5 27.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 1.0 5 2.0 6 0.0 7 3.0 8 2.0 9 4.0 10 3.0 11 3.0 12 1.0 13 1.0 14 4.0 15 3.0 16 1.0 17 4.0 18 3.0 19 10.0 20 3.0 21 1.0 22 3.0 23 5.0 24 4.0 25 3.0 26 20.0 27 6.0 28 16.0 29 18.0 30 24.0 31 31.0 32 36.0 33 49.0 34 114.0 35 222.0 36 643.0 37 2743.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.35 21.9 17.5 25.25 2 25.924999999999997 28.475 27.925 17.675 3 21.405351337834457 29.857464366091524 29.057264316079017 19.679919979995 4 24.256064016004 33.683420855213804 22.005501375343837 20.05501375343836 5 24.85621405351338 34.63365841460365 22.73068267066767 17.779444861215303 6 22.125 36.8 23.225 17.849999999999998 7 20.474999999999998 21.975 36.975 20.575 8 22.95573893473368 25.481370342585645 26.18154538634659 25.381345336334082 9 22.75 26.474999999999998 27.375 23.400000000000002 10-14 23.095 29.085 25.900000000000002 21.92 15-19 23.255 28.21 27.415 21.12 20-24 22.88 28.51 27.415 21.195 25-29 23.995 27.894999999999996 27.375 20.735 30-34 23.080000000000002 28.449999999999996 27.36 21.11 35-39 23.34 28.525 27.384999999999998 20.75 40-44 23.84 27.92 27.355 20.885 45-49 23.515 27.865000000000002 27.52 21.099999999999998 50-54 23.111155557777888 28.25641282064103 27.44137206860343 21.19105955297765 55-59 24.455 27.800000000000004 27.315 20.43 60-64 23.185 28.42 27.97 20.424999999999997 65-69 23.57 28.125 27.935 20.369999999999997 70-74 23.575 27.779999999999998 27.975 20.669999999999998 75-79 23.599999999999998 27.775 28.060000000000002 20.565 80-84 23.465 27.52 28.43 20.585 85-89 23.035 28.384999999999998 27.61 20.97 90-94 23.225 28.37 28.055000000000003 20.349999999999998 95-99 23.805 28.58 27.295 20.32 100-104 23.35 28.050000000000004 27.97 20.630000000000003 105-109 23.742374237423743 27.792779277927792 28.222822282228222 20.242024202420243 110-114 23.52 28.075 27.96 20.445 115-119 23.365 27.77 28.125 20.74 120-124 23.945 28.215 27.384999999999998 20.455000000000002 125-129 24.47 28.29 27.355 19.885 130-134 23.91 28.410000000000004 27.825 19.855 135-139 24.11 28.74 27.334999999999997 19.814999999999998 140-144 24.065 27.485 28.305000000000003 20.145 145-149 24.685000000000002 27.36 28.285 19.67 150-151 23.6625 28.075 28.7 19.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 1.0 25 1.0 26 1.0 27 2.5 28 6.5 29 7.5 30 10.0 31 14.5 32 19.0 33 22.0 34 32.0 35 49.5 36 69.5 37 92.0 38 118.0 39 151.5 40 197.0 41 234.0 42 270.5 43 298.5 44 293.5 45 295.5 46 308.0 47 289.0 48 248.0 49 213.0 50 171.5 51 147.0 52 127.5 53 91.0 54 61.0 55 42.5 56 30.0 57 22.5 58 19.0 59 11.0 60 7.5 61 7.0 62 3.5 63 4.0 64 2.0 65 0.0 66 0.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06518443658413 98.02499999999999 2 0.808489135927236 1.6 3 0.12632642748863063 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.1875 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.55 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.1625 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 3.9 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496474 spots for SRR7169908.sra Written 496474 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra Read 496473 spots for SRR7169908.sra Written 496473 spots for SRR7169908.sra SRR ids: ['SRR7169908.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fobf8mxi SRR7169908.sra spots: 9929461 blocks: [[1, 496473], [496474, 992946], [992947, 1489419], [1489420, 1985892], [1985893, 2482365], [2482366, 2978838], [2978839, 3475311], [3475312, 3971784], [3971785, 4468257], [4468258, 4964730], [4964731, 5461203], [5461204, 5957676], [5957677, 6454149], [6454150, 6950622], [6950623, 7447095], [7447096, 7943568], [7943569, 8440041], [8440042, 8936514], [8936515, 9432987], [9432988, 9929461]] SRR7169908 file size 3343205 SRR7169908 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169908 SRR7169908_1.fastq SRR7169908_2.fastq Input file: SRR7169908_1.fastq Paired file: SRR7169908_2.fastq trimmed: SRR7169908-trimmed-pair1.fastq, SRR7169908-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:18:34 2025 >> started Wed Feb 12 02:18:45 2025 >> done (11.378s) 9929461 read pairs processed; of these: 16371 ( 0.16%) short read pairs filtered out after trimming by size control 14991 ( 0.15%) empty read pairs filtered out after trimming by size control 9898099 (99.68%) read pairs available; of these: 4578067 (46.25%) trimmed read pairs available after processing 5320032 (53.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 6 0.00% 21 4 0.00% 22 2 0.00% 23 8 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 2 0.00% 29 2 0.00% 30 6 0.00% 31 5 0.00% 32 4 0.00% 33 4 0.00% 34 8 0.00% 35 10 0.00% 36 7 0.00% 37 2 0.00% 38 7 0.00% 39 6 0.00% 40 4 0.00% 41 15 0.00% 42 5 0.00% 43 14 0.00% 44 13 0.00% 45 15 0.00% 46 24 0.00% 47 18 0.00% 48 25 0.00% 49 40 0.00% 50 29 0.00% 51 30 0.00% 52 41 0.00% 53 49 0.00% 54 49 0.00% 55 61 0.00% 56 67 0.00% 57 89 0.00% 58 80 0.00% 59 95 0.00% 60 122 0.00% 61 130 0.00% 62 155 0.00% 63 183 0.00% 64 206 0.00% 65 220 0.00% 66 252 0.00% 67 239 0.00% 68 291 0.00% 69 314 0.00% 70 380 0.00% 71 469 0.00% 72 467 0.00% 73 639 0.01% 74 611 0.01% 75 818 0.01% 76 967 0.01% 77 1143 0.01% 78 1067 0.01% 79 1153 0.01% 80 1182 0.01% 81 1400 0.01% 82 1686 0.02% 83 1886 0.02% 84 2623 0.03% 85 3179 0.03% 86 3389 0.03% 87 3590 0.04% 88 3888 0.04% 89 3969 0.04% 90 4283 0.04% 91 4415 0.04% 92 4710 0.05% 93 4998 0.05% 94 5125 0.05% 95 5391 0.05% 96 5682 0.06% 97 6054 0.06% 98 6209 0.06% 99 6336 0.06% 100 6932 0.07% 101 6978 0.07% 102 7287 0.07% 103 7964 0.08% 104 8318 0.08% 105 8845 0.09% 106 9194 0.09% 107 9414 0.10% 108 9683 0.10% 109 9920 0.10% 110 10023 0.10% 111 10547 0.11% 112 10862 0.11% 113 11330 0.11% 114 11886 0.12% 115 12451 0.13% 116 12915 0.13% 117 13034 0.13% 118 13416 0.14% 119 13549 0.14% 120 13539 0.14% 121 13955 0.14% 122 14398 0.15% 123 15202 0.15% 124 15724 0.16% 125 16676 0.17% 126 17054 0.17% 127 17732 0.18% 128 18094 0.18% 129 18614 0.19% 130 19296 0.19% 131 19927 0.20% 132 20974 0.21% 133 22699 0.23% 134 23684 0.24% 135 24836 0.25% 136 26723 0.27% 137 28914 0.29% 138 30868 0.31% 139 34051 0.34% 140 36884 0.37% 141 41685 0.42% 142 49285 0.50% 143 60600 0.61% 144 67372 0.68% 145 86666 0.88% 146 107832 1.09% 147 154250 1.56% 148 258571 2.61% 149 534058 5.40% 150 2472672 24.98% 151 5320032 53.75% 9898099 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=32 prefix-density=0.27 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=38 fanout-score=223.84 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=42 prefix-density=0.25 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=44 fanout-score=131.54 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGT SRR7169908 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:19:35 Started mapping on | Feb 12 02:19:35 Finished on | Feb 12 02:20:50 Mapping speed, Million of reads per hour | 475.11 Number of input reads | 9898099 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 9205415 Uniquely mapped reads % | 93.00% Average mapped length | 295.28 Number of splices: Total | 8260358 Number of splices: Annotated (sjdb) | 8118757 Number of splices: GT/AG | 8142230 Number of splices: GC/AG | 94843 Number of splices: AT/AC | 6530 Number of splices: Non-canonical | 16755 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 149943 % of reads mapped to multiple loci | 1.51% Number of reads mapped to too many loci | 5556 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.40% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 556375 556375 556375 N_multimapping 149943 149943 149943 N_noFeature 193421 9087246 229269 N_ambiguous 124831 510 42163 UnstrandedReadsAssigned:8887163 PositiveStrandReadsAssigned:117659 NegativeStrandReadsAssigned:8933983 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169908 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169908-trimmed-pair1.fastq SRR7169908-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,898,099 reads, 8,881,240 reads pseudoaligned [quant] estimated average fragment length: 270.004 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7169908.ke.tsv 34699 SRR7169908.se.tsv 87100 total ==> SRR7169908.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749 143 8.52793 Potri.005G024800.1.v4.1 1035 765.996 22 2.99566 Potri.004G059700.1.v4.1 961 692.007 1 0.150725 Potri.007G009000.2.v4.1 1416 1147 0 0 Potri.003G141000.2.v4.1 2943 2674 134 5.22685 Potri.016G087400.1.v4.1 270 72.7671 787 1128.07 Potri.015G069301.1.v4.1 564 299.284 0 0 Potri.010G195200.1.v4.1 1773 1504 10 0.693505 Potri.012G127500.1.v4.1 977 708.002 3276 482.621 ==> SRR7169908.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1152 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 147 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169908 completed mapping pipeline successfully