Starting /dee2/code/volunteer_pipeline.sh SRR7169909 current disk space = 3048973107200 free memory = 1575695204 SRR7169909 SRAfilesize 1a64546e969c06a92f0eeb070e77be9d SRR7169909.sra SRR7169909.sra file validated SRR7169909 is paired end SRR7169909 is conventional basespace SRR7169909 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169909_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.9275 25.0 18.0 33.0 18.0 33.0 2 25.6985 27.0 18.0 31.0 18.0 33.0 3 29.7135 31.0 29.0 33.0 25.0 33.0 4 31.8865 33.0 31.0 33.0 29.0 33.0 5 32.579 33.0 33.0 33.0 32.0 33.0 6 36.39125 38.0 36.0 38.0 34.0 38.0 7 35.14075 38.0 36.0 38.0 29.0 38.0 8 36.831 38.0 37.0 38.0 34.0 38.0 9 37.29 38.0 38.0 38.0 36.0 38.0 10-14 37.42139999999999 38.0 38.0 38.0 36.8 38.0 15-19 37.496199999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.56375 38.0 38.0 38.0 37.8 38.0 25-29 37.53075 38.0 38.0 38.0 37.6 38.0 30-34 37.4909 38.0 38.0 38.0 37.2 38.0 35-39 37.4446 38.0 38.0 38.0 37.0 38.0 40-44 37.349149999999995 38.0 38.0 38.0 36.8 38.0 45-49 37.40845 38.0 38.0 38.0 37.0 38.0 50-54 37.126 38.0 38.0 38.0 36.2 38.0 55-59 36.91835 38.0 38.0 38.0 35.4 38.0 60-64 37.01325 38.0 38.0 38.0 35.8 38.0 65-69 36.514050000000005 38.0 37.6 38.0 33.6 38.0 70-74 36.866150000000005 38.0 38.0 38.0 35.6 38.0 75-79 36.84125 38.0 38.0 38.0 35.6 38.0 80-84 36.69435 38.0 38.0 38.0 35.0 38.0 85-89 36.5818 38.0 38.0 38.0 34.0 38.0 90-94 35.1042 38.0 35.8 38.0 26.8 38.0 95-99 35.97455 38.0 36.8 38.0 32.0 38.0 100-104 35.0869 38.0 35.8 38.0 27.8 38.0 105-109 35.3809 38.0 36.2 38.0 28.6 38.0 110-114 34.458600000000004 37.8 34.4 38.0 25.0 38.0 115-119 34.68095 38.0 35.0 38.0 25.4 38.0 120-124 33.8432 37.6 32.8 38.0 23.6 38.0 125-129 34.09375 38.0 34.2 38.0 22.6 38.0 130-134 34.59535000000001 38.0 34.8 38.0 26.8 38.0 135-139 33.9464 38.0 34.4 38.0 24.0 38.0 140-144 33.15525 37.6 32.8 38.0 20.4 38.0 145-149 32.43945 37.4 33.2 38.0 14.2 38.0 150-151 29.266875 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 0.0 15 0.0 16 2.0 17 4.0 18 5.0 19 17.0 20 3.0 21 8.0 22 4.0 23 4.0 24 10.0 25 11.0 26 21.0 27 20.0 28 19.0 29 43.0 30 41.0 31 74.0 32 96.0 33 136.0 34 267.0 35 605.0 36 1355.0 37 1250.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.575 11.0 10.549999999999999 37.875 2 21.46609957468101 14.711033274956216 31.573680260195147 32.24918689016762 3 18.775 20.775 27.700000000000003 32.75 4 22.6 26.825 24.725 25.85 5 22.975 31.775 23.474999999999998 21.775 6 19.725 36.025 24.25 20.0 7 14.524999999999999 27.075 40.725 17.675 8 18.0 26.400000000000002 30.025000000000002 25.575 9 17.375 23.674999999999997 34.5 24.45 10-14 19.64 30.455 27.445000000000004 22.46 15-19 19.994999999999997 29.5 27.505000000000003 23.0 20-24 20.36 28.825 27.889999999999997 22.925 25-29 20.175 28.96 27.33 23.535 30-34 19.38 29.79 27.455000000000002 23.375 35-39 20.044999999999998 29.025000000000002 27.400000000000002 23.53 40-44 19.515 28.785 27.99 23.71 45-49 20.630000000000003 28.455000000000002 27.800000000000004 23.115 50-54 19.935 29.015 27.755000000000003 23.294999999999998 55-59 20.105 28.754999999999995 27.48 23.66 60-64 20.195 28.73 27.865000000000002 23.21 65-69 20.215 28.48 27.625 23.68 70-74 19.805 29.270000000000003 27.92 23.005 75-79 19.64 29.04 27.189999999999998 24.13 80-84 19.77 28.725 27.800000000000004 23.705000000000002 85-89 20.14 28.685 27.889999999999997 23.285 90-94 19.75 29.054999999999996 27.544999999999998 23.65 95-99 20.035 28.549999999999997 27.01 24.404999999999998 100-104 20.39 28.52 27.029999999999998 24.060000000000002 105-109 20.27 29.28 26.405 24.044999999999998 110-114 20.41 29.104999999999997 27.11 23.375 115-119 20.157330393827035 28.925744062531315 27.628018839563083 23.288906704078567 120-124 20.646679012963613 28.680114119825816 27.253616297111964 23.419590570098602 125-129 20.665 28.655 27.084999999999997 23.595 130-134 20.705000000000002 28.155 27.575 23.565 135-139 20.87 28.38 27.644999999999996 23.105 140-144 20.536294962229228 27.475111311221173 27.475111311221173 24.51348241532843 145-149 20.07 27.834999999999997 27.279999999999998 24.815 150-151 20.424999999999997 27.775 26.787499999999998 25.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 2.5 24 4.5 25 3.5 26 7.5 27 12.0 28 11.5 29 14.0 30 20.5 31 29.0 32 37.5 33 44.5 34 52.0 35 73.5 36 82.0 37 95.0 38 132.0 39 174.5 40 201.5 41 220.0 42 252.0 43 277.5 44 283.0 45 271.0 46 266.5 47 262.5 48 227.5 49 179.5 50 150.5 51 130.0 52 118.5 53 101.0 54 65.5 55 45.5 56 40.0 57 27.5 58 19.0 59 16.0 60 11.5 61 8.5 62 7.5 63 4.0 64 2.5 65 3.0 66 2.5 67 1.0 68 0.5 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.21 120-124 0.105 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.055 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57168052406148 98.8 2 0.3779289493575208 0.75 3 0.02519526329050139 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02519526329050139 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 15 0.375 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9875 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.3499999999999996 0.0 0.0 0.0 0.0 124-125 2.5 0.0 0.0 0.0 0.0 126-127 2.6375 0.0 0.0 0.0 0.0 128-129 2.9 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.325 0.0 0.0 0.0 0.0 134-135 3.675 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169909 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169909_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18325 34.0 33.0 34.0 33.0 34.0 2 33.25375 34.0 33.0 34.0 33.0 34.0 3 33.3165 34.0 33.0 34.0 33.0 34.0 4 33.276 34.0 33.0 34.0 33.0 34.0 5 33.27225 34.0 33.0 34.0 33.0 34.0 6 37.40875 38.0 38.0 38.0 38.0 38.0 7 37.48675 38.0 38.0 38.0 38.0 38.0 8 37.39575 38.0 38.0 38.0 38.0 38.0 9 37.43225 38.0 38.0 38.0 38.0 38.0 10-14 37.37050000000001 38.0 38.0 38.0 37.2 38.0 15-19 37.3961 38.0 38.0 38.0 37.4 38.0 20-24 37.0198 38.0 37.8 38.0 35.4 38.0 25-29 35.97275 38.0 37.0 38.0 30.8 38.0 30-34 37.1308 38.0 37.8 38.0 36.2 38.0 35-39 37.3149 38.0 38.0 38.0 37.0 38.0 40-44 37.12345 38.0 38.0 38.0 36.6 38.0 45-49 37.2214 38.0 38.0 38.0 36.8 38.0 50-54 36.96015 38.0 38.0 38.0 36.0 38.0 55-59 37.1822 38.0 38.0 38.0 36.6 38.0 60-64 37.05515 38.0 38.0 38.0 36.2 38.0 65-69 37.0514 38.0 38.0 38.0 36.0 38.0 70-74 37.0769 38.0 38.0 38.0 36.0 38.0 75-79 37.1183 38.0 38.0 38.0 36.4 38.0 80-84 36.91495 38.0 38.0 38.0 36.0 38.0 85-89 36.56245 38.0 38.0 38.0 34.8 38.0 90-94 36.7872 38.0 38.0 38.0 35.8 38.0 95-99 36.66925 38.0 38.0 38.0 35.2 38.0 100-104 36.42745000000001 38.0 38.0 38.0 34.6 38.0 105-109 36.36805 38.0 38.0 38.0 34.0 38.0 110-114 36.374649999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.2215 38.0 38.0 38.0 34.0 38.0 120-124 35.93835 38.0 37.6 38.0 33.4 38.0 125-129 35.76285 38.0 37.0 38.0 32.6 38.0 130-134 35.5137 38.0 36.4 38.0 31.4 38.0 135-139 34.724149999999995 38.0 35.6 38.0 26.8 38.0 140-144 34.5908 38.0 35.2 38.0 26.2 38.0 145-149 33.734700000000004 38.0 35.0 38.0 20.6 38.0 150-151 30.474375000000002 36.5 29.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 0.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 5.0 18 1.0 19 9.0 20 13.0 21 5.0 22 8.0 23 8.0 24 5.0 25 13.0 26 14.0 27 23.0 28 24.0 29 22.0 30 40.0 31 52.0 32 59.0 33 84.0 34 145.0 35 251.0 36 659.0 37 2550.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.35 22.650000000000002 13.850000000000001 24.15 2 29.075 26.3 27.250000000000004 17.375 3 20.95 29.575000000000003 31.974999999999998 17.5 4 23.605901475368842 34.48362090522631 21.980495123780948 19.929982495623904 5 25.056264066016503 36.35908977244311 21.230307576894223 17.35433858464616 6 21.05 37.724999999999994 23.3 17.925 7 21.05 22.625 36.475 19.85 8 23.1 25.275 27.150000000000002 24.474999999999998 9 21.325 24.725 29.45 24.5 10-14 23.115 28.935 26.375 21.575 15-19 23.380000000000003 28.255000000000003 27.36 21.005 20-24 22.73 28.444999999999997 27.605 21.22 25-29 23.06 28.565 27.52 20.855 30-34 23.48 27.91 27.6 21.01 35-39 23.605 28.225 27.405 20.765 40-44 23.82 27.994999999999997 27.85 20.335 45-49 23.45 28.22 27.905 20.424999999999997 50-54 23.385 28.595 27.365000000000002 20.655 55-59 23.625 27.794999999999998 27.725 20.855 60-64 23.375 27.825 28.02 20.78 65-69 22.715 27.894999999999996 28.044999999999998 21.345 70-74 23.43 27.87 28.244999999999997 20.455000000000002 75-79 23.75 27.744999999999997 27.735 20.77 80-84 23.16 28.189999999999998 27.994999999999997 20.655 85-89 23.665 28.04 27.334999999999997 20.96 90-94 23.9 27.905 27.58 20.615 95-99 23.935000000000002 28.37 27.38 20.315 100-104 24.13 28.32 27.175 20.375 105-109 23.885 28.444999999999997 27.500000000000004 20.169999999999998 110-114 23.915 27.76 27.73 20.595 115-119 24.395 27.71 27.05 20.845 120-124 24.45 27.61 27.725 20.215 125-129 24.060000000000002 27.810000000000002 27.77 20.36 130-134 24.55 28.27 27.07 20.11 135-139 24.768437390477143 27.381965653632406 27.812546938366793 20.037050017523658 140-144 24.135 28.655 27.189999999999998 20.02 145-149 24.525 27.58 27.465 20.43 150-151 25.224999999999998 27.175 28.125 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 3.5 28 5.0 29 5.0 30 5.5 31 10.5 32 17.5 33 26.5 34 45.5 35 67.5 36 79.5 37 95.0 38 132.0 39 167.5 40 195.0 41 227.5 42 256.0 43 281.0 44 300.5 45 287.5 46 270.5 47 267.5 48 253.0 49 228.5 50 182.5 51 147.5 52 118.5 53 86.0 54 63.0 55 46.0 56 35.0 57 23.5 58 18.5 59 13.5 60 9.0 61 7.0 62 6.5 63 4.5 64 3.0 65 1.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.135 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72347913524385 99.175 2 0.2513826043237808 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025138260432378077 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 13 0.325 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1625 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.925 0.0 0.0 0.0 0.0 136-137 4.1 0.0 0.0 0.0 0.0 138-139 4.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579255 spots for SRR7169909.sra Written 579255 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra Read 579246 spots for SRR7169909.sra Written 579246 spots for SRR7169909.sra SRR ids: ['SRR7169909.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jq6snw71 SRR7169909.sra spots: 11584929 blocks: [[1, 579246], [579247, 1158492], [1158493, 1737738], [1737739, 2316984], [2316985, 2896230], [2896231, 3475476], [3475477, 4054722], [4054723, 4633968], [4633969, 5213214], [5213215, 5792460], [5792461, 6371706], [6371707, 6950952], [6950953, 7530198], [7530199, 8109444], [8109445, 8688690], [8688691, 9267936], [9267937, 9847182], [9847183, 10426428], [10426429, 11005674], [11005675, 11584929]] SRR7169909 file size 3904051 SRR7169909 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169909 SRR7169909_1.fastq SRR7169909_2.fastq Input file: SRR7169909_1.fastq Paired file: SRR7169909_2.fastq trimmed: SRR7169909-trimmed-pair1.fastq, SRR7169909-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:50:03 2025 >> started Wed Feb 12 02:50:15 2025 >> done (11.798s) 11584929 read pairs processed; of these: 9936 ( 0.09%) short read pairs filtered out after trimming by size control 66882 ( 0.58%) empty read pairs filtered out after trimming by size control 11508111 (99.34%) read pairs available; of these: 4992740 (43.38%) trimmed read pairs available after processing 6515371 (56.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 2 0.00% 24 2 0.00% 25 0 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 1 0.00% 30 2 0.00% 31 1 0.00% 32 7 0.00% 33 3 0.00% 34 8 0.00% 35 8 0.00% 36 6 0.00% 37 6 0.00% 38 5 0.00% 39 2 0.00% 40 13 0.00% 41 12 0.00% 42 15 0.00% 43 16 0.00% 44 18 0.00% 45 10 0.00% 46 25 0.00% 47 28 0.00% 48 35 0.00% 49 51 0.00% 50 38 0.00% 51 68 0.00% 52 63 0.00% 53 64 0.00% 54 78 0.00% 55 58 0.00% 56 80 0.00% 57 97 0.00% 58 116 0.00% 59 117 0.00% 60 167 0.00% 61 222 0.00% 62 208 0.00% 63 235 0.00% 64 225 0.00% 65 272 0.00% 66 283 0.00% 67 348 0.00% 68 380 0.00% 69 453 0.00% 70 506 0.00% 71 612 0.01% 72 714 0.01% 73 836 0.01% 74 892 0.01% 75 1005 0.01% 76 1162 0.01% 77 1288 0.01% 78 1313 0.01% 79 1475 0.01% 80 1682 0.01% 81 1845 0.02% 82 2181 0.02% 83 2437 0.02% 84 3093 0.03% 85 3604 0.03% 86 3750 0.03% 87 4182 0.04% 88 4385 0.04% 89 4557 0.04% 90 4860 0.04% 91 5119 0.04% 92 5349 0.05% 93 5937 0.05% 94 6231 0.05% 95 6509 0.06% 96 6829 0.06% 97 7094 0.06% 98 7357 0.06% 99 7502 0.07% 100 7846 0.07% 101 8328 0.07% 102 8782 0.08% 103 9288 0.08% 104 9751 0.08% 105 10216 0.09% 106 10485 0.09% 107 10498 0.09% 108 10700 0.09% 109 10898 0.09% 110 11330 0.10% 111 11943 0.10% 112 12453 0.11% 113 13135 0.11% 114 13616 0.12% 115 14200 0.12% 116 14585 0.13% 117 15192 0.13% 118 15073 0.13% 119 15409 0.13% 120 15954 0.14% 121 16195 0.14% 122 16465 0.14% 123 17275 0.15% 124 18461 0.16% 125 18975 0.16% 126 19578 0.17% 127 20353 0.18% 128 21080 0.18% 129 21738 0.19% 130 22818 0.20% 131 23396 0.20% 132 24699 0.21% 133 26360 0.23% 134 27849 0.24% 135 29881 0.26% 136 31532 0.27% 137 33077 0.29% 138 36322 0.32% 139 38497 0.33% 140 42672 0.37% 141 46993 0.41% 142 53046 0.46% 143 61610 0.54% 144 73184 0.64% 145 91871 0.80% 146 118677 1.03% 147 165709 1.44% 148 259821 2.26% 149 537504 4.67% 150 2719241 23.63% 151 6515371 56.62% 11508111 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=41 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=89.02 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=19.0 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTG criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=35 prefix-density=0.28 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=61.80 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=15.1 sequence=TGTTGGTGGTGG SRR7169909 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:51:00 Started mapping on | Feb 12 02:51:00 Finished on | Feb 12 02:52:07 Mapping speed, Million of reads per hour | 618.35 Number of input reads | 11508111 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10855048 Uniquely mapped reads % | 94.33% Average mapped length | 295.42 Number of splices: Total | 10289135 Number of splices: Annotated (sjdb) | 10131175 Number of splices: GT/AG | 10144371 Number of splices: GC/AG | 118307 Number of splices: AT/AC | 7121 Number of splices: Non-canonical | 19336 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192146 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 10081 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.89% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 471110 471110 471110 N_multimapping 192146 192146 192146 N_noFeature 228812 10739431 271021 N_ambiguous 120461 589 46668 UnstrandedReadsAssigned:10505775 PositiveStrandReadsAssigned:115028 NegativeStrandReadsAssigned:10537359 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169909 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169909-trimmed-pair1.fastq SRR7169909-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,508,111 reads, 10,442,701 reads pseudoaligned [quant] estimated average fragment length: 292.218 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 977 rounds 52401 SRR7169909.ke.tsv 34699 SRR7169909.se.tsv 87100 total ==> SRR7169909.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.78 196 11.4415 Potri.005G024800.1.v4.1 1035 743.782 12 1.62629 Potri.004G059700.1.v4.1 961 669.804 1 0.150493 Potri.007G009000.2.v4.1 1416 1124.78 0 0 Potri.003G141000.2.v4.1 2943 2651.78 193 7.3364 Potri.016G087400.1.v4.1 270 76.9438 650 851.536 Potri.015G069301.1.v4.1 564 281.498 0 0 Potri.010G195200.1.v4.1 1773 1481.78 10 0.680266 Potri.012G127500.1.v4.1 977 685.788 3081 452.862 ==> SRR7169909.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1013 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 133 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169909 completed mapping pipeline successfully