Starting /dee2/code/volunteer_pipeline.sh SRR7169910 current disk space = 3049014996992 free memory = 1415935024 SRR7169910 SRAfilesize 8ac1e25c770288ca89aacda70da16d57 SRR7169910.sra SRR7169910.sra file validated SRR7169910 is paired end SRR7169910 is conventional basespace SRR7169910 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169910_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.24075 18.0 18.0 28.0 18.0 32.0 2 30.45325 31.0 29.0 33.0 27.0 33.0 3 32.16625 33.0 31.0 33.0 31.0 33.0 4 32.50225 33.0 33.0 33.0 31.0 33.0 5 33.089 33.0 33.0 34.0 33.0 34.0 6 37.17075 38.0 37.0 38.0 36.0 38.0 7 37.4605 38.0 38.0 38.0 37.0 38.0 8 37.53225 38.0 38.0 38.0 37.0 38.0 9 37.6385 38.0 38.0 38.0 38.0 38.0 10-14 37.3991 38.0 38.0 38.0 36.8 38.0 15-19 37.184250000000006 38.0 38.0 38.0 36.0 38.0 20-24 37.4852 38.0 38.0 38.0 37.0 38.0 25-29 37.455850000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.28375 38.0 38.0 38.0 37.0 38.0 35-39 37.30525 38.0 38.0 38.0 36.8 38.0 40-44 37.180899999999994 38.0 38.0 38.0 36.4 38.0 45-49 37.10265 38.0 38.0 38.0 36.2 38.0 50-54 36.8754 38.0 38.0 38.0 35.2 38.0 55-59 36.602349999999994 38.0 37.8 38.0 34.2 38.0 60-64 36.7346 38.0 38.0 38.0 34.8 38.0 65-69 36.7271 38.0 38.0 38.0 34.6 38.0 70-74 36.42995 38.0 37.6 38.0 33.8 38.0 75-79 36.49835 38.0 37.6 38.0 34.0 38.0 80-84 36.49145 38.0 37.6 38.0 34.0 38.0 85-89 36.371199999999995 38.0 37.2 38.0 33.8 38.0 90-94 36.1204 38.0 37.0 38.0 33.0 38.0 95-99 35.85915 38.0 37.0 38.0 31.8 38.0 100-104 35.64045 38.0 36.4 38.0 30.8 38.0 105-109 34.9309 38.0 35.2 38.0 27.8 38.0 110-114 35.24345 38.0 36.0 38.0 29.0 38.0 115-119 35.022400000000005 38.0 35.2 38.0 28.2 38.0 120-124 34.867 38.0 35.0 38.0 27.8 38.0 125-129 34.5537 38.0 34.8 38.0 26.2 38.0 130-134 33.87085 38.0 34.0 38.0 23.2 38.0 135-139 33.547650000000004 37.8 33.8 38.0 20.6 38.0 140-144 32.22235 36.4 31.4 38.0 14.2 38.0 145-149 31.153250000000003 36.0 31.0 38.0 10.8 38.0 150-151 26.592750000000002 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 3.0 8 1.0 9 0.0 10 2.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 1.0 17 2.0 18 4.0 19 4.0 20 4.0 21 5.0 22 8.0 23 7.0 24 11.0 25 7.0 26 16.0 27 17.0 28 31.0 29 49.0 30 48.0 31 81.0 32 118.0 33 140.0 34 291.0 35 601.0 36 1375.0 37 1169.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.675 12.4 14.374999999999998 35.55 2 22.7 15.024999999999999 33.6 28.675 3 18.663997998498875 20.040030022516888 28.271203402551915 33.02476857643232 4 21.375 28.299999999999997 24.625 25.7 5 21.85 32.4 25.25 20.5 6 19.650000000000002 35.0 24.45 20.9 7 13.850000000000001 26.200000000000003 42.425000000000004 17.525 8 17.9 25.825 30.175 26.1 9 16.475 26.0 34.625 22.900000000000002 10-14 18.855 29.81 28.155 23.18 15-19 19.49 29.154999999999998 28.04 23.315 20-24 19.48 28.555000000000003 28.565 23.400000000000002 25-29 19.125 29.205 28.175 23.494999999999997 30-34 19.905 29.360000000000003 27.82 22.915 35-39 20.169999999999998 28.46 28.24 23.13 40-44 19.759999999999998 28.84 27.339999999999996 24.060000000000002 45-49 20.18 28.294999999999998 28.345 23.18 50-54 19.425 29.244999999999997 28.04 23.29 55-59 19.835 28.98 27.975 23.21 60-64 19.855 28.560000000000002 27.915 23.669999999999998 65-69 19.805 28.77 27.915 23.51 70-74 19.765 29.244999999999997 27.925 23.064999999999998 75-79 19.64 28.335 28.485 23.54 80-84 20.01 28.555000000000003 28.18 23.255 85-89 19.845 28.634999999999998 27.884999999999998 23.635 90-94 20.225 28.07 28.82 22.884999999999998 95-99 19.965 28.26 28.16 23.615 100-104 20.685000000000002 28.084999999999997 28.23 23.0 105-109 20.595 28.634999999999998 27.575 23.195 110-114 20.24 28.26 28.15 23.35 115-119 20.175 28.33 28.4 23.095 120-124 20.345 28.105000000000004 28.13 23.419999999999998 125-129 20.185 28.49 27.750000000000004 23.575 130-134 20.62 28.24 27.825 23.315 135-139 19.835 28.345 27.894999999999996 23.925 140-144 20.575 27.325 28.035 24.065 145-149 20.525 28.64 27.639999999999997 23.195 150-151 20.3 28.050000000000004 28.9125 22.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.5 5 1.0 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 2.0 24 3.5 25 7.5 26 9.5 27 9.5 28 13.0 29 19.5 30 25.5 31 29.0 32 36.0 33 48.5 34 64.5 35 77.0 36 91.0 37 108.0 38 141.0 39 189.0 40 209.0 41 224.5 42 251.5 43 253.5 44 258.5 45 279.5 46 284.0 47 252.0 48 214.0 49 189.0 50 151.5 51 120.5 52 109.0 53 91.0 54 61.5 55 40.0 56 26.5 57 24.5 58 23.0 59 16.5 60 10.0 61 5.5 62 5.5 63 3.5 64 1.5 65 1.5 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.075 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.037500000000000006 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.07500000000000001 0.025 0.0 0.0 0.0 78-79 0.1 0.025 0.0 0.0 0.0 80-81 0.125 0.025 0.0 0.0 0.0 82-83 0.1375 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.2 0.025 0.0 0.0 0.0 88-89 0.2625 0.025 0.0 0.0 0.0 90-91 0.32499999999999996 0.025 0.0 0.0 0.0 92-93 0.4375 0.025 0.0 0.0 0.0 94-95 0.575 0.025 0.0 0.0 0.0 96-97 0.625 0.025 0.0 0.0 0.0 98-99 0.7124999999999999 0.025 0.0 0.0 0.0 100-101 0.8125 0.025 0.0 0.0 0.0 102-103 0.875 0.025 0.0 0.0 0.0 104-105 0.975 0.025 0.0 0.0 0.0 106-107 1.0875 0.025 0.0 0.0 0.0 108-109 1.2 0.025 0.0 0.0 0.0 110-111 1.275 0.025 0.0 0.0 0.0 112-113 1.3875 0.025 0.0 0.0 0.0 114-115 1.525 0.025 0.0 0.0 0.0 116-117 1.65 0.025 0.0 0.0 0.0 118-119 1.7625 0.025 0.0 0.0 0.0 120-121 1.8250000000000002 0.025 0.0 0.0 0.0 122-123 1.9500000000000002 0.025 0.0 0.0 0.0 124-125 2.0875 0.025 0.0 0.0 0.0 126-127 2.275 0.025 0.0 0.0 0.0 128-129 2.475 0.025 0.0 0.0 0.0 130-131 2.575 0.025 0.0 0.0 0.0 132-133 2.675 0.025 0.0 0.0 0.0 134-135 2.8875 0.025 0.0 0.0 0.0 136-137 3.1375 0.025 0.0 0.0 0.0 138-139 3.3125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGGGGT 10 0.0065806094 146.79747 3 >>END_MODULE SRR7169910 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169910_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.34225 34.0 33.0 34.0 33.0 34.0 2 33.47025 34.0 33.0 34.0 33.0 34.0 3 33.48475 34.0 33.0 34.0 33.0 34.0 4 33.4435 34.0 33.0 34.0 33.0 34.0 5 33.42675 34.0 33.0 34.0 33.0 34.0 6 37.60075 38.0 38.0 38.0 38.0 38.0 7 37.56825 38.0 38.0 38.0 38.0 38.0 8 37.57375 38.0 38.0 38.0 38.0 38.0 9 37.165 38.0 38.0 38.0 37.0 38.0 10-14 37.506449999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.49325 38.0 38.0 38.0 38.0 38.0 20-24 37.459250000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.263149999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.4057 38.0 38.0 38.0 38.0 38.0 35-39 37.32285 38.0 38.0 38.0 37.6 38.0 40-44 37.378750000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.35575 38.0 38.0 38.0 37.8 38.0 50-54 36.97175 38.0 38.0 38.0 36.4 38.0 55-59 37.330000000000005 38.0 38.0 38.0 37.6 38.0 60-64 37.3015 38.0 38.0 38.0 37.0 38.0 65-69 37.07865 38.0 38.0 38.0 36.6 38.0 70-74 36.59805 38.0 38.0 38.0 35.0 38.0 75-79 36.93315 38.0 38.0 38.0 36.0 38.0 80-84 36.44715000000001 38.0 38.0 38.0 34.6 38.0 85-89 36.96115 38.0 38.0 38.0 36.0 38.0 90-94 37.039300000000004 38.0 38.0 38.0 36.2 38.0 95-99 36.97935 38.0 38.0 38.0 36.0 38.0 100-104 36.62 38.0 38.0 38.0 35.0 38.0 105-109 36.63465 38.0 38.0 38.0 35.0 38.0 110-114 36.71294999999999 38.0 38.0 38.0 35.0 38.0 115-119 36.5332 38.0 38.0 38.0 34.6 38.0 120-124 36.171 38.0 37.8 38.0 33.8 38.0 125-129 36.17715 38.0 37.8 38.0 33.8 38.0 130-134 35.92185 38.0 37.2 38.0 33.2 38.0 135-139 35.64805 38.0 36.2 38.0 32.0 38.0 140-144 35.380199999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.91369999999999 38.0 36.0 38.0 30.2 38.0 150-151 30.523874999999997 35.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 1.0 5 3.0 6 3.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 2.0 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 4.0 21 2.0 22 4.0 23 7.0 24 7.0 25 10.0 26 8.0 27 9.0 28 15.0 29 18.0 30 20.0 31 28.0 32 42.0 33 80.0 34 103.0 35 229.0 36 538.0 37 2850.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.9 21.25 17.625 24.224999999999998 2 26.75 26.5 29.275000000000002 17.474999999999998 3 21.025 29.65 32.05 17.275 4 23.125 33.5 24.075 19.3 5 23.35 36.7 23.425 16.525000000000002 6 21.4 37.375 23.075000000000003 18.15 7 20.225 23.25 37.675 18.85 8 23.1 26.075 25.650000000000002 25.174999999999997 9 21.475 25.2 30.125 23.200000000000003 10-14 21.985 29.110000000000003 26.82 22.085 15-19 22.89 28.655 27.395000000000003 21.060000000000002 20-24 22.915 29.049999999999997 27.389999999999997 20.645 25-29 23.04 28.565 27.715 20.68 30-34 22.919999999999998 28.199999999999996 28.18 20.7 35-39 22.720000000000002 28.449999999999996 28.134999999999998 20.695 40-44 23.09 28.595 27.465 20.849999999999998 45-49 22.994999999999997 29.04 27.54 20.424999999999997 50-54 22.59 28.994999999999997 27.534999999999997 20.880000000000003 55-59 23.285 27.87 27.905 20.94 60-64 23.26 28.075 28.535 20.13 65-69 23.585 28.865000000000002 27.58 19.97 70-74 23.405 28.27 27.915 20.41 75-79 23.87 28.065 28.025 20.04 80-84 23.155 28.660000000000004 27.694999999999997 20.49 85-89 23.705000000000002 28.23 27.675 20.39 90-94 23.419999999999998 27.889999999999997 28.365000000000002 20.325 95-99 23.080000000000002 28.549999999999997 27.279999999999998 21.09 100-104 23.7 28.185 28.194999999999997 19.919999999999998 105-109 23.115 28.360000000000003 27.725 20.8 110-114 23.915 28.494999999999997 27.54 20.05 115-119 23.919999999999998 28.335 27.650000000000002 20.095 120-124 23.549999999999997 27.950000000000003 27.92 20.580000000000002 125-129 23.465 28.965000000000003 27.55 20.02 130-134 23.685000000000002 27.92 27.644999999999996 20.75 135-139 23.455000000000002 28.025 27.785 20.735 140-144 23.665 28.02 28.205000000000002 20.11 145-149 23.919999999999998 28.27 28.025 19.785 150-151 24.3625 28.3875 27.625 19.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.5 23 4.0 24 2.5 25 2.5 26 3.5 27 5.0 28 9.5 29 10.5 30 15.0 31 23.0 32 27.0 33 38.0 34 49.5 35 65.0 36 87.0 37 118.5 38 153.0 39 186.0 40 206.0 41 217.5 42 256.5 43 296.5 44 304.5 45 300.0 46 265.5 47 219.5 48 220.0 49 198.0 50 158.5 51 131.5 52 99.0 53 77.0 54 61.5 55 49.5 56 32.5 57 20.0 58 19.0 59 16.0 60 9.5 61 6.5 62 6.5 63 6.0 64 6.0 65 4.0 66 1.0 67 1.0 68 0.5 69 2.0 70 3.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.8374999999999999 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2374999999999998 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.0 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138-139 3.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAAATA 10 0.006830828 145.0 6 >>END_MODULE Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486575 spots for SRR7169910.sra Written 486575 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra Read 486562 spots for SRR7169910.sra Written 486562 spots for SRR7169910.sra SRR ids: ['SRR7169910.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mnhqtv3d SRR7169910.sra spots: 9731253 blocks: [[1, 486562], [486563, 973124], [973125, 1459686], [1459687, 1946248], [1946249, 2432810], [2432811, 2919372], [2919373, 3405934], [3405935, 3892496], [3892497, 4379058], [4379059, 4865620], [4865621, 5352182], [5352183, 5838744], [5838745, 6325306], [6325307, 6811868], [6811869, 7298430], [7298431, 7784992], [7784993, 8271554], [8271555, 8758116], [8758117, 9244678], [9244679, 9731253]] SRR7169910 file size 3276426 SRR7169910 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169910 SRR7169910_1.fastq SRR7169910_2.fastq Input file: SRR7169910_1.fastq Paired file: SRR7169910_2.fastq trimmed: SRR7169910-trimmed-pair1.fastq, SRR7169910-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:06:16 2025 >> started Wed Feb 12 03:06:27 2025 >> done (11.206s) 9731253 read pairs processed; of these: 9643 ( 0.10%) short read pairs filtered out after trimming by size control 12199 ( 0.13%) empty read pairs filtered out after trimming by size control 9709411 (99.78%) read pairs available; of these: 4131862 (42.56%) trimmed read pairs available after processing 5577549 (57.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 4 0.00% 25 6 0.00% 26 8 0.00% 27 7 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 1 0.00% 32 5 0.00% 33 3 0.00% 34 7 0.00% 35 3 0.00% 36 8 0.00% 37 8 0.00% 38 6 0.00% 39 5 0.00% 40 7 0.00% 41 11 0.00% 42 15 0.00% 43 18 0.00% 44 17 0.00% 45 12 0.00% 46 22 0.00% 47 19 0.00% 48 25 0.00% 49 26 0.00% 50 24 0.00% 51 39 0.00% 52 48 0.00% 53 59 0.00% 54 61 0.00% 55 60 0.00% 56 68 0.00% 57 74 0.00% 58 85 0.00% 59 105 0.00% 60 119 0.00% 61 146 0.00% 62 178 0.00% 63 191 0.00% 64 181 0.00% 65 221 0.00% 66 249 0.00% 67 293 0.00% 68 319 0.00% 69 392 0.00% 70 420 0.00% 71 519 0.01% 72 565 0.01% 73 629 0.01% 74 659 0.01% 75 828 0.01% 76 893 0.01% 77 1062 0.01% 78 1113 0.01% 79 1182 0.01% 80 1272 0.01% 81 1510 0.02% 82 1656 0.02% 83 1864 0.02% 84 2378 0.02% 85 2948 0.03% 86 3126 0.03% 87 3441 0.04% 88 3566 0.04% 89 3666 0.04% 90 3841 0.04% 91 3968 0.04% 92 4215 0.04% 93 4357 0.04% 94 4592 0.05% 95 4857 0.05% 96 4990 0.05% 97 5230 0.05% 98 5292 0.05% 99 5372 0.06% 100 5655 0.06% 101 5872 0.06% 102 6174 0.06% 103 6659 0.07% 104 6949 0.07% 105 7421 0.08% 106 7495 0.08% 107 7648 0.08% 108 7827 0.08% 109 8053 0.08% 110 8299 0.09% 111 8838 0.09% 112 9087 0.09% 113 9749 0.10% 114 10160 0.10% 115 10775 0.11% 116 10991 0.11% 117 11057 0.11% 118 11203 0.12% 119 11013 0.11% 120 11655 0.12% 121 12014 0.12% 122 12412 0.13% 123 12936 0.13% 124 13294 0.14% 125 14073 0.14% 126 14545 0.15% 127 15139 0.16% 128 15293 0.16% 129 15879 0.16% 130 16572 0.17% 131 17391 0.18% 132 18315 0.19% 133 19267 0.20% 134 20596 0.21% 135 22040 0.23% 136 23112 0.24% 137 25396 0.26% 138 27297 0.28% 139 29273 0.30% 140 32613 0.34% 141 36580 0.38% 142 40960 0.42% 143 48496 0.50% 144 59027 0.61% 145 75278 0.78% 146 97228 1.00% 147 135876 1.40% 148 217409 2.24% 149 450191 4.64% 150 2327596 23.97% 151 5577549 57.44% 9709411 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=30 prefix-density=0.13 prefix-fanout=3.3 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=151.45 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.2 sequence=AAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=33 prefix-density=0.23 prefix-fanout=3.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=292.24 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=30.8 sequence=AAGAAGAAGAAA SRR7169910 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:07:14 Started mapping on | Feb 12 03:07:14 Finished on | Feb 12 03:08:35 Mapping speed, Million of reads per hour | 431.53 Number of input reads | 9709411 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 8844619 Uniquely mapped reads % | 91.09% Average mapped length | 295.88 Number of splices: Total | 8040328 Number of splices: Annotated (sjdb) | 7866137 Number of splices: GT/AG | 7904818 Number of splices: GC/AG | 107569 Number of splices: AT/AC | 7137 Number of splices: Non-canonical | 20804 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180365 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 10345 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.91% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 695270 695270 695270 N_multimapping 180365 180365 180365 N_noFeature 307362 8731662 359423 N_ambiguous 106469 1296 44565 UnstrandedReadsAssigned:8430788 PositiveStrandReadsAssigned:111661 NegativeStrandReadsAssigned:8440631 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169910 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169910-trimmed-pair1.fastq SRR7169910-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,709,411 reads, 8,406,546 reads pseudoaligned [quant] estimated average fragment length: 293.562 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR7169910.ke.tsv 34699 SRR7169910.se.tsv 87100 total ==> SRR7169910.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.44 266 18.5481 Potri.005G024800.1.v4.1 1035 742.438 49 7.94061 Potri.004G059700.1.v4.1 961 668.467 5 0.899928 Potri.007G009000.2.v4.1 1416 1123.44 0 0 Potri.003G141000.2.v4.1 2943 2650.44 188 8.53411 Potri.016G087400.1.v4.1 270 72.2262 856 1425.93 Potri.015G069301.1.v4.1 564 280.265 0 0 Potri.010G195200.1.v4.1 1773 1480.44 84 6.82664 Potri.012G127500.1.v4.1 977 684.467 3843 675.516 ==> SRR7169910.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1923 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7169910 completed mapping pipeline successfully