Starting /dee2/code/volunteer_pipeline.sh SRR7169911 current disk space = 2810367041536 free memory = 1581357952 SRR7169911 SRAfilesize 4b6f7f5751b4deefac2816e006948817 SRR7169911.sra SRR7169911.sra file validated SRR7169911 is paired end SRR7169911 is conventional basespace SRR7169911 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169911_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.0985 27.0 18.0 31.0 18.0 32.0 2 31.53125 33.0 31.0 33.0 29.0 33.0 3 32.49075 33.0 33.0 33.0 31.0 33.0 4 32.831 33.0 33.0 34.0 31.0 34.0 5 33.23975 34.0 33.0 34.0 33.0 34.0 6 37.08425 38.0 37.0 38.0 36.0 38.0 7 37.42475 38.0 38.0 38.0 37.0 38.0 8 37.499 38.0 38.0 38.0 37.0 38.0 9 36.544 38.0 38.0 38.0 34.0 38.0 10-14 37.50695 38.0 38.0 38.0 37.2 38.0 15-19 37.36409999999999 38.0 38.0 38.0 36.6 38.0 20-24 37.37275 38.0 38.0 38.0 36.8 38.0 25-29 37.51915 38.0 38.0 38.0 37.6 38.0 30-34 37.4804 38.0 38.0 38.0 37.4 38.0 35-39 37.4363 38.0 38.0 38.0 37.0 38.0 40-44 37.31685 38.0 38.0 38.0 36.6 38.0 45-49 37.4136 38.0 38.0 38.0 37.0 38.0 50-54 37.313300000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.218 38.0 38.0 38.0 36.0 38.0 60-64 37.1372 38.0 38.0 38.0 36.0 38.0 65-69 37.00265 38.0 38.0 38.0 35.8 38.0 70-74 36.95125 38.0 38.0 38.0 35.8 38.0 75-79 36.8131 38.0 38.0 38.0 34.8 38.0 80-84 36.538700000000006 38.0 37.6 38.0 34.2 38.0 85-89 36.0755 38.0 37.0 38.0 32.6 38.0 90-94 36.472300000000004 38.0 37.6 38.0 34.0 38.0 95-99 36.30915 38.0 37.0 38.0 34.0 38.0 100-104 36.0746 38.0 36.8 38.0 32.8 38.0 105-109 35.030800000000006 38.0 35.4 38.0 26.4 38.0 110-114 34.92040000000001 38.0 35.2 38.0 26.0 38.0 115-119 35.1627 38.0 35.6 38.0 28.8 38.0 120-124 35.0343 38.0 35.4 38.0 28.2 38.0 125-129 33.4322 37.2 32.2 38.0 22.0 38.0 130-134 33.576100000000004 37.6 33.2 38.0 22.4 38.0 135-139 33.86115 38.0 33.4 38.0 23.4 38.0 140-144 32.86145 37.8 31.8 38.0 18.6 38.0 145-149 31.29345 36.4 31.0 38.0 13.2 38.0 150-151 26.948999999999998 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 0.0 16 1.0 17 1.0 18 2.0 19 3.0 20 6.0 21 10.0 22 3.0 23 7.0 24 6.0 25 9.0 26 19.0 27 21.0 28 25.0 29 34.0 30 38.0 31 76.0 32 102.0 33 148.0 34 278.0 35 575.0 36 1270.0 37 1359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 12.875 12.825000000000001 36.425000000000004 2 21.916437327995997 15.61170878158619 32.9246935201401 29.54716037027771 3 20.25 20.4 26.900000000000002 32.45 4 22.650000000000002 27.474999999999998 22.475 27.400000000000002 5 21.55 32.375 24.474999999999998 21.6 6 19.925 35.0 25.15 19.925 7 15.425 26.474999999999998 39.975 18.125 8 18.4 26.125 30.575000000000003 24.9 9 15.6 25.55 34.125 24.725 10-14 19.794999999999998 30.635 27.055 22.515 15-19 19.439999999999998 28.999999999999996 28.18 23.380000000000003 20-24 19.905 28.910000000000004 27.735 23.45 25-29 19.48 29.549999999999997 27.67 23.3 30-34 20.18 29.735 26.815 23.27 35-39 20.085 29.609999999999996 27.089999999999996 23.215 40-44 19.919999999999998 29.095 27.985 23.0 45-49 20.044999999999998 29.115000000000002 27.54 23.3 50-54 19.63 29.715000000000003 27.54 23.115 55-59 19.965 29.049999999999997 27.405 23.580000000000002 60-64 19.245 28.665000000000003 28.115000000000002 23.974999999999998 65-69 19.775000000000002 28.999999999999996 27.389999999999997 23.835 70-74 20.03 28.970000000000002 27.55 23.45 75-79 20.135 28.765 27.474999999999998 23.625 80-84 20.115 28.79 27.715 23.380000000000003 85-89 19.689999999999998 28.74 27.884999999999998 23.685000000000002 90-94 20.24 28.71 27.765 23.285 95-99 20.04 28.89 27.415 23.655 100-104 20.61 28.58 27.634999999999998 23.175 105-109 20.445 29.099999999999998 27.694999999999997 22.759999999999998 110-114 20.7 28.77 27.305 23.225 115-119 20.62 28.655 27.534999999999997 23.189999999999998 120-124 20.330000000000002 28.265 27.57 23.835 125-129 20.165 28.18 28.134999999999998 23.52 130-134 20.115 29.125 27.150000000000002 23.61 135-139 20.89 28.63 26.945000000000004 23.535 140-144 20.39 28.384999999999998 27.589999999999996 23.635 145-149 20.294999999999998 28.15 27.939999999999998 23.615 150-151 20.6875 28.525 26.950000000000003 23.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 3.5 25 5.5 26 4.5 27 7.0 28 15.0 29 17.5 30 21.0 31 26.0 32 33.5 33 48.0 34 59.5 35 78.5 36 96.0 37 117.0 38 148.0 39 180.0 40 200.0 41 220.5 42 235.5 43 255.0 44 281.5 45 266.0 46 254.5 47 247.0 48 223.5 49 194.0 50 164.5 51 142.0 52 115.0 53 81.5 54 64.5 55 57.0 56 34.0 57 21.5 58 17.5 59 15.5 60 13.5 61 8.5 62 6.0 63 5.0 64 3.0 65 2.0 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6375 0.0 0.0 0.0 0.0 122-123 1.875 0.0 0.0 0.0 0.0 124-125 2.0875 0.0 0.0 0.0 0.0 126-127 2.2874999999999996 0.0 0.0 0.0 0.0 128-129 2.4375 0.0 0.0 0.0 0.0 130-131 2.6 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.8125 0.0 0.0 0.0 0.0 136-137 2.9749999999999996 0.0 0.0 0.0 0.0 138-139 3.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169911 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169911_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.319 34.0 33.0 34.0 33.0 34.0 2 33.359 34.0 33.0 34.0 33.0 34.0 3 33.42825 34.0 33.0 34.0 33.0 34.0 4 33.36525 34.0 33.0 34.0 33.0 34.0 5 33.3925 34.0 33.0 34.0 33.0 34.0 6 37.549 38.0 38.0 38.0 38.0 38.0 7 37.58275 38.0 38.0 38.0 38.0 38.0 8 37.44825 38.0 38.0 38.0 38.0 38.0 9 37.46075 38.0 38.0 38.0 38.0 38.0 10-14 37.4234 38.0 38.0 38.0 38.0 38.0 15-19 37.43055 38.0 38.0 38.0 38.0 38.0 20-24 37.42145 38.0 38.0 38.0 38.0 38.0 25-29 37.11745 38.0 38.0 38.0 36.4 38.0 30-34 37.37885 38.0 38.0 38.0 37.4 38.0 35-39 37.14385 38.0 38.0 38.0 36.6 38.0 40-44 37.374300000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.009249999999994 38.0 38.0 38.0 36.2 38.0 50-54 37.19955 38.0 38.0 38.0 36.8 38.0 55-59 37.3163 38.0 38.0 38.0 37.0 38.0 60-64 37.17040000000001 38.0 38.0 38.0 36.8 38.0 65-69 37.1908 38.0 38.0 38.0 36.8 38.0 70-74 37.20185 38.0 38.0 38.0 37.0 38.0 75-79 37.18725 38.0 38.0 38.0 36.8 38.0 80-84 37.0196 38.0 38.0 38.0 36.0 38.0 85-89 36.936899999999994 38.0 38.0 38.0 36.0 38.0 90-94 36.95085 38.0 38.0 38.0 36.0 38.0 95-99 36.8733 38.0 38.0 38.0 35.8 38.0 100-104 36.66759999999999 38.0 38.0 38.0 35.0 38.0 105-109 36.61455000000001 38.0 38.0 38.0 34.8 38.0 110-114 36.50095 38.0 38.0 38.0 34.2 38.0 115-119 36.37425 38.0 38.0 38.0 34.0 38.0 120-124 36.10375 38.0 37.8 38.0 33.4 38.0 125-129 35.43575 38.0 36.4 38.0 29.6 38.0 130-134 35.6994 38.0 36.6 38.0 32.2 38.0 135-139 34.4307 38.0 34.6 38.0 26.0 38.0 140-144 33.944849999999995 38.0 33.6 38.0 24.0 38.0 145-149 33.415949999999995 38.0 33.0 38.0 21.0 38.0 150-151 29.878125 35.5 27.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 3.0 17 2.0 18 1.0 19 5.0 20 5.0 21 4.0 22 6.0 23 4.0 24 5.0 25 15.0 26 9.0 27 15.0 28 21.0 29 23.0 30 40.0 31 35.0 32 48.0 33 81.0 34 128.0 35 262.0 36 702.0 37 2572.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 20.5 16.55 26.450000000000003 2 26.463231615807903 26.3631815907954 29.764882441220607 17.408704352176088 3 20.3 28.849999999999998 31.65 19.2 4 24.287143571785894 33.66683341670835 22.836418209104554 19.209604802401202 5 24.349999999999998 35.65 22.35 17.65 6 21.75 36.625 23.474999999999998 18.15 7 20.549999999999997 21.5 37.8 20.150000000000002 8 22.525000000000002 25.900000000000002 25.85 25.724999999999998 9 21.675 25.124999999999996 30.175 23.025000000000002 10-14 22.795 28.605000000000004 26.740000000000002 21.86 15-19 22.925 28.465 27.66 20.95 20-24 22.84 27.915 28.110000000000003 21.135 25-29 23.330000000000002 28.16 28.084999999999997 20.424999999999997 30-34 23.155 28.34 27.665 20.84 35-39 22.955000000000002 28.205000000000002 28.16 20.68 40-44 23.22 28.999999999999996 27.625 20.155 45-49 22.745 28.215 28.285 20.755000000000003 50-54 22.425 28.51 27.96 21.105 55-59 23.18 28.255000000000003 27.655 20.91 60-64 22.825 28.044999999999998 28.705000000000002 20.424999999999997 65-69 23.830000000000002 27.79 27.755000000000003 20.625 70-74 22.939999999999998 28.335 27.42 21.305 75-79 23.51 26.965 28.925 20.599999999999998 80-84 22.68 27.975 28.375 20.97 85-89 24.015 27.54 28.275 20.169999999999998 90-94 23.415 27.315 28.249999999999996 21.02 95-99 23.419999999999998 27.625 27.91 21.044999999999998 100-104 23.9 28.060000000000002 27.889999999999997 20.150000000000002 105-109 23.54 27.500000000000004 27.794999999999998 21.165 110-114 23.93 27.715 27.76 20.595 115-119 23.674999999999997 27.615000000000002 28.125 20.585 120-124 23.73 27.810000000000002 27.85 20.61 125-129 23.805 27.445000000000004 28.105000000000004 20.645 130-134 24.195 27.744999999999997 27.71 20.349999999999998 135-139 24.185000000000002 27.245 28.225 20.345 140-144 23.865 27.98 27.98 20.175 145-149 24.495 27.49 27.88 20.135 150-151 24.224999999999998 27.474999999999998 27.950000000000003 20.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 3.5 27 7.0 28 9.0 29 13.0 30 15.0 31 13.0 32 23.5 33 34.5 34 38.0 35 44.5 36 73.0 37 105.5 38 136.5 39 166.5 40 207.5 41 242.5 42 262.0 43 288.5 44 303.5 45 305.0 46 291.5 47 259.0 48 225.0 49 204.5 50 171.0 51 132.0 52 106.5 53 89.5 54 68.5 55 48.0 56 35.0 57 22.5 58 12.0 59 9.0 60 8.0 61 4.0 62 1.5 63 1.0 64 2.0 65 2.0 66 2.5 67 3.5 68 1.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.05 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.575 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.1500000000000004 0.0 0.0 0.0 0.0 138-139 3.3499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 40 0.0076550315 18.125 125-129 >>END_MODULE Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641740 spots for SRR7169911.sra Written 641740 spots for SRR7169911.sra Read 641756 spots for SRR7169911.sra Written 641756 spots for SRR7169911.sra SRR ids: ['SRR7169911.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aitzjdg9 SRR7169911.sra spots: 12834816 blocks: [[1, 641740], [641741, 1283480], [1283481, 1925220], [1925221, 2566960], [2566961, 3208700], [3208701, 3850440], [3850441, 4492180], [4492181, 5133920], [5133921, 5775660], [5775661, 6417400], [6417401, 7059140], [7059141, 7700880], [7700881, 8342620], [8342621, 8984360], [8984361, 9626100], [9626101, 10267840], [10267841, 10909580], [10909581, 11551320], [11551321, 12193060], [12193061, 12834816]] SRR7169911 file size 4327597 SRR7169911 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169911 SRR7169911_1.fastq SRR7169911_2.fastq Input file: SRR7169911_1.fastq Paired file: SRR7169911_2.fastq trimmed: SRR7169911-trimmed-pair1.fastq, SRR7169911-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:14:07 2025 >> started Fri Apr 11 12:14:20 2025 >> done (13.087s) 12834816 read pairs processed; of these: 10920 ( 0.09%) short read pairs filtered out after trimming by size control 10057 ( 0.08%) empty read pairs filtered out after trimming by size control 12813839 (99.84%) read pairs available; of these: 5817377 (45.40%) trimmed read pairs available after processing 6996462 (54.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 2 0.00% 22 5 0.00% 23 5 0.00% 24 3 0.00% 25 1 0.00% 26 5 0.00% 27 5 0.00% 28 4 0.00% 29 1 0.00% 30 7 0.00% 31 4 0.00% 32 4 0.00% 33 1 0.00% 34 6 0.00% 35 7 0.00% 36 7 0.00% 37 5 0.00% 38 10 0.00% 39 8 0.00% 40 10 0.00% 41 11 0.00% 42 15 0.00% 43 15 0.00% 44 12 0.00% 45 21 0.00% 46 20 0.00% 47 23 0.00% 48 22 0.00% 49 29 0.00% 50 31 0.00% 51 41 0.00% 52 39 0.00% 53 53 0.00% 54 51 0.00% 55 60 0.00% 56 78 0.00% 57 76 0.00% 58 96 0.00% 59 102 0.00% 60 115 0.00% 61 146 0.00% 62 189 0.00% 63 184 0.00% 64 228 0.00% 65 224 0.00% 66 227 0.00% 67 255 0.00% 68 317 0.00% 69 373 0.00% 70 398 0.00% 71 512 0.00% 72 605 0.00% 73 631 0.00% 74 731 0.01% 75 825 0.01% 76 931 0.01% 77 1085 0.01% 78 1047 0.01% 79 1216 0.01% 80 1357 0.01% 81 1452 0.01% 82 1740 0.01% 83 2007 0.02% 84 2801 0.02% 85 3046 0.02% 86 3342 0.03% 87 3720 0.03% 88 3851 0.03% 89 3967 0.03% 90 4149 0.03% 91 4447 0.03% 92 4847 0.04% 93 5171 0.04% 94 5414 0.04% 95 5798 0.05% 96 6022 0.05% 97 6200 0.05% 98 6320 0.05% 99 6739 0.05% 100 7129 0.06% 101 7513 0.06% 102 7724 0.06% 103 8236 0.06% 104 8831 0.07% 105 9182 0.07% 106 9476 0.07% 107 9716 0.08% 108 9942 0.08% 109 10492 0.08% 110 10703 0.08% 111 11099 0.09% 112 11562 0.09% 113 12124 0.09% 114 12725 0.10% 115 13444 0.10% 116 13600 0.11% 117 14225 0.11% 118 14490 0.11% 119 14505 0.11% 120 14873 0.12% 121 15662 0.12% 122 16145 0.13% 123 16836 0.13% 124 17630 0.14% 125 18637 0.15% 126 19132 0.15% 127 20117 0.16% 128 20875 0.16% 129 21433 0.17% 130 22332 0.17% 131 23571 0.18% 132 24849 0.19% 133 26410 0.21% 134 28392 0.22% 135 30774 0.24% 136 33068 0.26% 137 35644 0.28% 138 39210 0.31% 139 42465 0.33% 140 47161 0.37% 141 52890 0.41% 142 60765 0.47% 143 71562 0.56% 144 86515 0.68% 145 109686 0.86% 146 145055 1.13% 147 208479 1.63% 148 336385 2.63% 149 680179 5.31% 150 3220400 25.13% 151 6996462 54.60% 12813839 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=38 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=125.30 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=13.8 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=202.07 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=22.9 sequence=GAAGAAGAAGAAA SRR7169911 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:15:01 Started mapping on | Apr 11 12:15:02 Finished on | Apr 11 12:16:16 Mapping speed, Million of reads per hour | 623.38 Number of input reads | 12813839 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 12019682 Uniquely mapped reads % | 93.80% Average mapped length | 295.99 Number of splices: Total | 11169663 Number of splices: Annotated (sjdb) | 10990841 Number of splices: GT/AG | 11009362 Number of splices: GC/AG | 129253 Number of splices: AT/AC | 8172 Number of splices: Non-canonical | 22876 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196741 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 23024 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609640 609640 609640 N_multimapping 196741 196741 196741 N_noFeature 271136 11888976 315815 N_ambiguous 138828 719 52287 UnstrandedReadsAssigned:11609718 PositiveStrandReadsAssigned:129987 NegativeStrandReadsAssigned:11651580 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169911 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169911-trimmed-pair1.fastq SRR7169911-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,813,839 reads, 11,550,478 reads pseudoaligned [quant] estimated average fragment length: 290.591 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR7169911.ke.tsv 34699 SRR7169911.se.tsv 87100 total ==> SRR7169911.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.41 196 10.0147 Potri.005G024800.1.v4.1 1035 745.409 41 4.85754 Potri.004G059700.1.v4.1 961 671.442 1 0.131528 Potri.007G009000.2.v4.1 1416 1126.41 0 0 Potri.003G141000.2.v4.1 2943 2653.41 284.042 9.45377 Potri.016G087400.1.v4.1 270 72.0875 847 1037.65 Potri.015G069301.1.v4.1 564 282.272 0 0 Potri.010G195200.1.v4.1 1773 1483.41 23 1.36928 Potri.012G127500.1.v4.1 977 687.42 3074 394.919 ==> SRR7169911.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1568 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 229 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169911 completed mapping pipeline successfully