Starting /dee2/code/volunteer_pipeline.sh SRR7169912 current disk space = 3048983375872 free memory = 1416420764 SRR7169912 SRAfilesize 3cfb57f3af986a96ee90a476324be239 SRR7169912.sra SRR7169912.sra file validated SRR7169912 is paired end SRR7169912 is conventional basespace SRR7169912 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169912_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.28075 18.0 18.0 28.0 18.0 32.0 2 30.52025 31.0 29.0 33.0 27.0 33.0 3 32.221 33.0 33.0 33.0 31.0 33.0 4 32.5125 33.0 33.0 33.0 31.0 34.0 5 33.16225 33.0 33.0 34.0 33.0 34.0 6 37.238 38.0 37.0 38.0 36.0 38.0 7 37.467 38.0 38.0 38.0 37.0 38.0 8 37.54025 38.0 38.0 38.0 37.0 38.0 9 37.60425 38.0 38.0 38.0 38.0 38.0 10-14 37.4671 38.0 38.0 38.0 36.8 38.0 15-19 37.19029999999999 38.0 38.0 38.0 36.4 38.0 20-24 37.56995 38.0 38.0 38.0 37.2 38.0 25-29 37.54505 38.0 38.0 38.0 37.6 38.0 30-34 37.4203 38.0 38.0 38.0 37.2 38.0 35-39 37.480599999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.32165 38.0 38.0 38.0 36.6 38.0 45-49 37.24665 38.0 38.0 38.0 36.2 38.0 50-54 37.0123 38.0 38.0 38.0 35.8 38.0 55-59 36.820299999999996 38.0 37.8 38.0 35.0 38.0 60-64 36.97795 38.0 38.0 38.0 35.2 38.0 65-69 37.0116 38.0 38.0 38.0 35.6 38.0 70-74 36.7053 38.0 37.6 38.0 34.4 38.0 75-79 36.71545 38.0 38.0 38.0 34.6 38.0 80-84 36.672450000000005 38.0 38.0 38.0 34.2 38.0 85-89 36.59185 38.0 37.6 38.0 34.0 38.0 90-94 36.419650000000004 38.0 37.0 38.0 34.0 38.0 95-99 36.1844 38.0 37.0 38.0 33.0 38.0 100-104 36.00985000000001 38.0 36.8 38.0 32.6 38.0 105-109 35.2257 38.0 35.6 38.0 29.0 38.0 110-114 35.55335 38.0 36.0 38.0 29.8 38.0 115-119 35.3681 38.0 36.0 38.0 29.4 38.0 120-124 35.23685 38.0 35.4 38.0 28.6 38.0 125-129 34.758 38.0 35.0 38.0 27.2 38.0 130-134 34.290499999999994 38.0 34.4 38.0 25.2 38.0 135-139 33.967349999999996 38.0 34.0 38.0 23.2 38.0 140-144 32.8043 37.2 32.4 38.0 17.2 38.0 145-149 31.688200000000002 36.0 31.4 38.0 13.6 38.0 150-151 27.142625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 5.0 20 2.0 21 2.0 22 3.0 23 7.0 24 5.0 25 10.0 26 8.0 27 17.0 28 28.0 29 33.0 30 48.0 31 62.0 32 93.0 33 154.0 34 305.0 35 577.0 36 1330.0 37 1305.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.7 12.55 12.35 36.4 2 22.1 15.525 32.925 29.45 3 18.284142071035518 21.860930465232617 26.588294147073537 33.26663331665833 4 22.650000000000002 27.950000000000003 24.75 24.65 5 22.125 31.5 24.95 21.425 6 19.75 35.199999999999996 25.05 20.0 7 14.424999999999999 26.150000000000002 42.05 17.375 8 18.925 26.224999999999998 29.2 25.650000000000002 9 17.175 24.474999999999998 35.025 23.325000000000003 10-14 19.695 30.06 27.345000000000002 22.900000000000002 15-19 19.96 28.95 27.765 23.325000000000003 20-24 19.875 28.549999999999997 27.900000000000002 23.674999999999997 25-29 19.465 29.335 27.439999999999998 23.76 30-34 19.53 29.270000000000003 27.755000000000003 23.445 35-39 20.26 28.765 27.785 23.189999999999998 40-44 20.11 28.815 27.860000000000003 23.215 45-49 20.365 29.165000000000003 27.405 23.064999999999998 50-54 19.855 28.73 27.815 23.599999999999998 55-59 20.32 28.965000000000003 27.075 23.64 60-64 19.915 28.249999999999996 28.315 23.52 65-69 19.71 28.535 27.6 24.154999999999998 70-74 19.325 29.09 27.744999999999997 23.84 75-79 19.585 28.410000000000004 27.865000000000002 24.14 80-84 20.16 28.22 27.865000000000002 23.755000000000003 85-89 20.349999999999998 27.48 28.465 23.705000000000002 90-94 19.81 28.555000000000003 27.87 23.765 95-99 20.015 28.035 27.889999999999997 24.060000000000002 100-104 20.335 28.65 27.625 23.39 105-109 19.6 28.435 28.155 23.810000000000002 110-114 20.445 28.335 28.335 22.884999999999998 115-119 20.4 28.084999999999997 27.985 23.53 120-124 20.125 27.85 28.194999999999997 23.830000000000002 125-129 20.39 28.365000000000002 27.99 23.255 130-134 20.525 28.03 28.189999999999998 23.255 135-139 20.255000000000003 28.194999999999997 28.105000000000004 23.445 140-144 20.47 27.73 27.615000000000002 24.185000000000002 145-149 20.65 27.900000000000002 28.000000000000004 23.45 150-151 20.1375 28.075 28.3125 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 2.5 22 2.0 23 0.5 24 1.5 25 2.0 26 5.5 27 9.0 28 6.0 29 9.5 30 17.0 31 21.0 32 31.5 33 41.0 34 48.5 35 72.5 36 91.0 37 112.0 38 150.0 39 176.5 40 179.5 41 208.0 42 255.0 43 267.0 44 280.0 45 293.5 46 284.5 47 267.0 48 243.0 49 203.0 50 169.0 51 137.0 52 110.5 53 88.0 54 59.5 55 41.0 56 25.5 57 20.0 58 20.0 59 14.5 60 8.5 61 6.5 62 5.0 63 2.5 64 1.5 65 1.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.625 0.0 0.0 0.0 0.0 122-123 1.775 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 1.9875 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.4124999999999996 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.7249999999999996 0.0 0.0 0.0 0.0 138-139 2.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATAAA 10 0.006830828 145.0 8 >>END_MODULE SRR7169912 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169912_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.384 34.0 33.0 34.0 33.0 34.0 2 33.4285 34.0 33.0 34.0 33.0 34.0 3 33.46225 34.0 33.0 34.0 33.0 34.0 4 33.39125 34.0 33.0 34.0 33.0 34.0 5 33.429 34.0 33.0 34.0 33.0 34.0 6 37.60725 38.0 38.0 38.0 38.0 38.0 7 37.57375 38.0 38.0 38.0 38.0 38.0 8 37.58075 38.0 38.0 38.0 38.0 38.0 9 37.116 38.0 38.0 38.0 37.0 38.0 10-14 37.519499999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.500800000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.46515 38.0 38.0 38.0 38.0 38.0 25-29 37.3327 38.0 38.0 38.0 37.4 38.0 30-34 37.51055 38.0 38.0 38.0 38.0 38.0 35-39 37.343849999999996 38.0 38.0 38.0 37.4 38.0 40-44 37.45035 38.0 38.0 38.0 38.0 38.0 45-49 37.3457 38.0 38.0 38.0 37.6 38.0 50-54 36.962900000000005 38.0 38.0 38.0 36.0 38.0 55-59 37.3141 38.0 38.0 38.0 37.2 38.0 60-64 37.307050000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.997699999999995 38.0 38.0 38.0 36.4 38.0 70-74 36.468450000000004 38.0 37.8 38.0 33.8 38.0 75-79 36.9593 38.0 38.0 38.0 36.0 38.0 80-84 36.38265 38.0 37.6 38.0 34.0 38.0 85-89 36.9298 38.0 38.0 38.0 35.8 38.0 90-94 37.01755 38.0 38.0 38.0 36.0 38.0 95-99 36.915850000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.620250000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.50265 38.0 38.0 38.0 34.4 38.0 110-114 36.649950000000004 38.0 38.0 38.0 34.8 38.0 115-119 36.522299999999994 38.0 38.0 38.0 34.6 38.0 120-124 36.19855 38.0 37.8 38.0 33.8 38.0 125-129 36.1112 38.0 37.8 38.0 33.6 38.0 130-134 35.85625 38.0 37.0 38.0 33.0 38.0 135-139 35.556799999999996 38.0 36.2 38.0 32.0 38.0 140-144 35.1909 38.0 36.0 38.0 31.0 38.0 145-149 34.709199999999996 38.0 35.6 38.0 29.8 38.0 150-151 30.3365 35.5 28.5 38.0 13.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 2.0 5 0.0 6 2.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 2.0 14 1.0 15 1.0 16 3.0 17 1.0 18 3.0 19 2.0 20 2.0 21 5.0 22 6.0 23 5.0 24 5.0 25 14.0 26 8.0 27 8.0 28 11.0 29 11.0 30 31.0 31 29.0 32 39.0 33 72.0 34 127.0 35 260.0 36 598.0 37 2741.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.85 22.05 15.15 25.95 2 25.825 27.925 28.299999999999997 17.95 3 19.75 29.775000000000002 31.45 19.025 4 23.799999999999997 35.425000000000004 22.85 17.925 5 24.7 35.8 20.9 18.6 6 21.6 37.8 23.575 17.025000000000002 7 20.575 21.8 38.475 19.15 8 22.825 25.2 26.424999999999997 25.55 9 21.075 25.974999999999998 30.425 22.525000000000002 10-14 23.330000000000002 28.904999999999998 26.06 21.705 15-19 22.67 28.294999999999998 28.035 21.0 20-24 22.74 28.675 27.655 20.93 25-29 22.685 27.985 28.57 20.76 30-34 23.005 28.325 28.04 20.630000000000003 35-39 22.42 28.21 27.985 21.385 40-44 23.315 27.915 27.860000000000003 20.91 45-49 23.16 28.139999999999997 28.115000000000002 20.585 50-54 22.994999999999997 28.595 27.465 20.945 55-59 22.84 28.365000000000002 28.084999999999997 20.71 60-64 23.419999999999998 27.794999999999998 28.384999999999998 20.4 65-69 23.29 28.515 27.685 20.51 70-74 23.215 27.800000000000004 28.125 20.86 75-79 23.605 28.235 27.560000000000002 20.599999999999998 80-84 23.57 28.34 27.83 20.26 85-89 23.61 27.785 27.915 20.69 90-94 24.065 27.685 27.33 20.919999999999998 95-99 23.43 28.16 27.905 20.505000000000003 100-104 23.945 28.065 27.41 20.580000000000002 105-109 24.195 27.900000000000002 27.450000000000003 20.455000000000002 110-114 23.875 28.73 27.375 20.02 115-119 24.355 28.205000000000002 27.634999999999998 19.805 120-124 23.544999999999998 28.725 27.6 20.13 125-129 23.62 28.395 27.38 20.605 130-134 23.635 28.050000000000004 27.865000000000002 20.45 135-139 23.735 27.915 28.04 20.31 140-144 23.74 28.37 27.834999999999997 20.055 145-149 24.115000000000002 28.360000000000003 27.66 19.865 150-151 24.325 28.6375 26.775 20.2625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 2.0 25 2.0 26 2.0 27 4.0 28 4.5 29 6.0 30 12.0 31 15.5 32 22.5 33 33.5 34 40.0 35 55.0 36 83.0 37 111.5 38 141.5 39 169.5 40 201.5 41 230.5 42 256.0 43 287.5 44 295.0 45 297.5 46 300.5 47 269.5 48 234.0 49 209.5 50 167.5 51 132.5 52 106.5 53 78.5 54 64.5 55 45.5 56 29.0 57 27.0 58 23.0 59 12.0 60 4.5 61 3.5 62 3.5 63 2.5 64 1.0 65 1.5 66 1.5 67 0.0 68 1.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7625 0.0 0.0 0.0 0.0 110-111 1.0 0.0 0.0 0.0 0.0 112-113 1.2375 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.5875 0.0 0.0 0.0 0.0 122-123 1.725 0.0 0.0 0.0 0.0 124-125 1.85 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.25 0.0 0.0 0.0 0.0 132-133 2.3125 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.6375 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTATCC 10 0.006830828 145.0 5 TTGCTGC 10 0.006830828 145.0 6 >>END_MODULE Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra Read 562430 spots for SRR7169912.sra Written 562430 spots for SRR7169912.sra Read 562416 spots for SRR7169912.sra Written 562416 spots for SRR7169912.sra SRR ids: ['SRR7169912.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ap6ul7to SRR7169912.sra spots: 11248334 blocks: [[1, 562416], [562417, 1124832], [1124833, 1687248], [1687249, 2249664], [2249665, 2812080], [2812081, 3374496], [3374497, 3936912], [3936913, 4499328], [4499329, 5061744], [5061745, 5624160], [5624161, 6186576], [6186577, 6748992], [6748993, 7311408], [7311409, 7873824], [7873825, 8436240], [8436241, 8998656], [8998657, 9561072], [9561073, 10123488], [10123489, 10685904], [10685905, 11248334]] SRR7169912 file size 3789990 SRR7169912 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169912 SRR7169912_1.fastq SRR7169912_2.fastq Input file: SRR7169912_1.fastq Paired file: SRR7169912_2.fastq trimmed: SRR7169912-trimmed-pair1.fastq, SRR7169912-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:09:30 2025 >> started Wed Feb 12 03:09:44 2025 >> done (13.476s) 11248334 read pairs processed; of these: 8638 ( 0.08%) short read pairs filtered out after trimming by size control 7078 ( 0.06%) empty read pairs filtered out after trimming by size control 11232618 (99.86%) read pairs available; of these: 4752750 (42.31%) trimmed read pairs available after processing 6479868 (57.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 5 0.00% 28 2 0.00% 29 7 0.00% 30 7 0.00% 31 6 0.00% 32 6 0.00% 33 2 0.00% 34 9 0.00% 35 9 0.00% 36 7 0.00% 37 5 0.00% 38 6 0.00% 39 7 0.00% 40 12 0.00% 41 9 0.00% 42 12 0.00% 43 26 0.00% 44 19 0.00% 45 18 0.00% 46 22 0.00% 47 24 0.00% 48 30 0.00% 49 19 0.00% 50 35 0.00% 51 52 0.00% 52 46 0.00% 53 50 0.00% 54 62 0.00% 55 54 0.00% 56 68 0.00% 57 87 0.00% 58 88 0.00% 59 91 0.00% 60 128 0.00% 61 156 0.00% 62 174 0.00% 63 174 0.00% 64 205 0.00% 65 224 0.00% 66 266 0.00% 67 280 0.00% 68 293 0.00% 69 386 0.00% 70 401 0.00% 71 448 0.00% 72 555 0.00% 73 639 0.01% 74 692 0.01% 75 715 0.01% 76 818 0.01% 77 837 0.01% 78 890 0.01% 79 1057 0.01% 80 1209 0.01% 81 1383 0.01% 82 1560 0.01% 83 1805 0.02% 84 2273 0.02% 85 2667 0.02% 86 2825 0.03% 87 2892 0.03% 88 3097 0.03% 89 3289 0.03% 90 3489 0.03% 91 3779 0.03% 92 4073 0.04% 93 4295 0.04% 94 4617 0.04% 95 4955 0.04% 96 5071 0.05% 97 5340 0.05% 98 5350 0.05% 99 5700 0.05% 100 5875 0.05% 101 6089 0.05% 102 6616 0.06% 103 6959 0.06% 104 7606 0.07% 105 7758 0.07% 106 8038 0.07% 107 8198 0.07% 108 8159 0.07% 109 8638 0.08% 110 8722 0.08% 111 9375 0.08% 112 9666 0.09% 113 10139 0.09% 114 10727 0.10% 115 10961 0.10% 116 11412 0.10% 117 11738 0.10% 118 11750 0.10% 119 12007 0.11% 120 12160 0.11% 121 12575 0.11% 122 13036 0.12% 123 13898 0.12% 124 14519 0.13% 125 15155 0.13% 126 15896 0.14% 127 16596 0.15% 128 16870 0.15% 129 17631 0.16% 130 18369 0.16% 131 19123 0.17% 132 20196 0.18% 133 21347 0.19% 134 23269 0.21% 135 24813 0.22% 136 26361 0.23% 137 28968 0.26% 138 31194 0.28% 139 34029 0.30% 140 37136 0.33% 141 41985 0.37% 142 47694 0.42% 143 56095 0.50% 144 68569 0.61% 145 88018 0.78% 146 114191 1.02% 147 159569 1.42% 148 254573 2.27% 149 526901 4.69% 150 2701653 24.05% 151 6479868 57.69% 11232618 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=353.23 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=38 prefix-density=0.38 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=249.51 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=29.2 sequence=AAGAAGAAGAAA SRR7169912 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:10:34 Started mapping on | Feb 12 03:10:35 Finished on | Feb 12 03:11:34 Mapping speed, Million of reads per hour | 685.38 Number of input reads | 11232618 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 10566758 Uniquely mapped reads % | 94.07% Average mapped length | 296.26 Number of splices: Total | 10297932 Number of splices: Annotated (sjdb) | 10134872 Number of splices: GT/AG | 10150396 Number of splices: GC/AG | 118704 Number of splices: AT/AC | 7519 Number of splices: Non-canonical | 21313 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181582 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 58089 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 493221 493221 493221 N_multimapping 181582 181582 181582 N_noFeature 233316 10458565 275666 N_ambiguous 115327 630 49033 UnstrandedReadsAssigned:10218115 PositiveStrandReadsAssigned:107563 NegativeStrandReadsAssigned:10242059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169912 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169912-trimmed-pair1.fastq SRR7169912-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,232,618 reads, 10,180,292 reads pseudoaligned [quant] estimated average fragment length: 307.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,114 rounds 52401 SRR7169912.ke.tsv 34699 SRR7169912.se.tsv 87100 total ==> SRR7169912.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1711.73 163 9.31223 Potri.005G024800.1.v4.1 1035 728.726 16 2.14712 Potri.004G059700.1.v4.1 961 654.77 0 0 Potri.007G009000.2.v4.1 1416 1109.73 0 0 Potri.003G141000.2.v4.1 2943 2636.73 169.027 6.26891 Potri.016G087400.1.v4.1 270 74.633 742.541 972.948 Potri.015G069301.1.v4.1 564 268.993 0 0 Potri.010G195200.1.v4.1 1773 1466.73 8 0.533385 Potri.012G127500.1.v4.1 977 670.739 3431 500.227 ==> SRR7169912.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1120 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169912 completed mapping pipeline successfully