Starting /dee2/code/volunteer_pipeline.sh SRR7169913 current disk space = 3049192902656 free memory = 1176298860 SRR7169913 SRAfilesize 821bba585ccf3e88f948a870b2d0b40e SRR7169913.sra SRR7169913.sra file validated SRR7169913 is paired end SRR7169913 is conventional basespace SRR7169913 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169913_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.745 18.0 18.0 30.0 18.0 32.0 2 30.199 31.0 29.0 33.0 27.0 33.0 3 31.852 33.0 31.0 33.0 29.0 33.0 4 32.4975 33.0 33.0 33.0 31.0 33.0 5 33.15125 33.0 33.0 34.0 33.0 34.0 6 37.10225 38.0 37.0 38.0 36.0 38.0 7 36.461 38.0 37.0 38.0 34.0 38.0 8 37.2695 38.0 38.0 38.0 36.0 38.0 9 37.532 38.0 38.0 38.0 37.0 38.0 10-14 37.609899999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5941 38.0 38.0 38.0 37.6 38.0 20-24 37.543699999999994 38.0 38.0 38.0 37.8 38.0 25-29 37.616949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5908 38.0 38.0 38.0 38.0 38.0 35-39 37.5425 38.0 38.0 38.0 38.0 38.0 40-44 37.414699999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.5253 38.0 38.0 38.0 38.0 38.0 50-54 37.39945 38.0 38.0 38.0 37.0 38.0 55-59 37.29725 38.0 38.0 38.0 37.0 38.0 60-64 37.23165 38.0 38.0 38.0 36.0 38.0 65-69 37.143649999999994 38.0 38.0 38.0 36.0 38.0 70-74 37.14635 38.0 38.0 38.0 36.0 38.0 75-79 37.06215 38.0 38.0 38.0 36.0 38.0 80-84 36.940599999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.51335 38.0 37.6 38.0 34.0 38.0 90-94 36.425200000000004 38.0 37.6 38.0 33.0 38.0 95-99 36.3374 38.0 37.0 38.0 33.4 38.0 100-104 35.35375 38.0 36.2 38.0 29.0 38.0 105-109 36.094 38.0 36.8 38.0 32.8 38.0 110-114 36.0452 38.0 37.0 38.0 33.0 38.0 115-119 35.572950000000006 38.0 36.2 38.0 30.6 38.0 120-124 34.65955 38.0 35.0 38.0 25.2 38.0 125-129 35.2127 38.0 35.6 38.0 28.6 38.0 130-134 33.98825000000001 37.8 34.2 38.0 23.2 38.0 135-139 34.608700000000006 38.0 35.0 38.0 27.0 38.0 140-144 33.6767 37.8 33.8 38.0 20.2 38.0 145-149 32.127700000000004 36.4 31.6 38.0 14.6 38.0 150-151 28.425375000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 0.0 17 2.0 18 3.0 19 1.0 20 4.0 21 2.0 22 3.0 23 3.0 24 7.0 25 10.0 26 11.0 27 16.0 28 18.0 29 21.0 30 41.0 31 52.0 32 84.0 33 148.0 34 225.0 35 471.0 36 1257.0 37 1615.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.65 11.675 13.100000000000001 37.574999999999996 2 21.4 15.325 35.475 27.800000000000004 3 19.575 20.849999999999998 26.474999999999998 33.1 4 21.5 29.45 24.224999999999998 24.825 5 21.0 33.775 25.575 19.650000000000002 6 20.25 35.65 24.975 19.125 7 14.35 26.3 41.625 17.724999999999998 8 18.875 25.724999999999998 31.3 24.099999999999998 9 18.35 24.75 34.025 22.875 10-14 19.72 29.854999999999997 27.529999999999998 22.895 15-19 20.01 28.865000000000002 28.075 23.05 20-24 19.935 28.985 27.689999999999998 23.39 25-29 19.939999999999998 29.160000000000004 27.46 23.44 30-34 19.57 28.825 28.025 23.580000000000002 35-39 19.675 29.354999999999997 27.165 23.805 40-44 20.025000000000002 28.860000000000003 27.889999999999997 23.225 45-49 20.145 29.189999999999998 27.089999999999996 23.575 50-54 20.169999999999998 29.470000000000002 27.634999999999998 22.725 55-59 20.735 28.88 27.185 23.200000000000003 60-64 20.54 28.765 27.6 23.095 65-69 19.865 28.565 28.27 23.3 70-74 20.07 28.565 28.050000000000004 23.315 75-79 20.560000000000002 28.735 27.525 23.18 80-84 20.005 29.15 27.365000000000002 23.48 85-89 20.485 28.84 27.205000000000002 23.47 90-94 20.735 28.754999999999995 26.900000000000002 23.61 95-99 19.7 28.999999999999996 27.58 23.72 100-104 20.72 29.220000000000002 26.584999999999997 23.474999999999998 105-109 20.605 28.64 27.445000000000004 23.31 110-114 20.59 29.03 27.21 23.169999999999998 115-119 20.955 28.615000000000002 26.939999999999998 23.49 120-124 20.13 28.499999999999996 27.310000000000002 24.060000000000002 125-129 20.03 28.444999999999997 27.860000000000003 23.665 130-134 20.51 28.67 26.924999999999997 23.895 135-139 20.830000000000002 28.9 26.784999999999997 23.485 140-144 20.52 28.425 27.665 23.39 145-149 21.08 28.28 27.155 23.485 150-151 21.2625 28.199999999999996 26.650000000000002 23.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 2.0 18 2.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 1.0 25 3.5 26 9.5 27 10.5 28 11.5 29 17.0 30 20.5 31 22.5 32 30.5 33 45.0 34 57.0 35 74.5 36 96.0 37 101.5 38 128.5 39 172.5 40 187.5 41 210.0 42 243.0 43 256.0 44 279.5 45 295.5 46 288.0 47 273.0 48 234.5 49 186.0 50 156.0 51 136.5 52 108.5 53 93.0 54 76.5 55 50.0 56 35.0 57 27.5 58 16.0 59 8.5 60 6.5 61 4.0 62 3.5 63 3.0 64 3.0 65 1.0 66 0.5 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.025 0.0 118-119 1.6124999999999998 0.0 0.0 0.025 0.0 120-121 1.7374999999999998 0.0 0.0 0.025 0.0 122-123 1.85 0.0 0.0 0.025 0.0 124-125 1.9874999999999998 0.0 0.0 0.025 0.0 126-127 2.1375 0.0 0.0 0.025 0.0 128-129 2.25 0.0 0.0 0.025 0.0 130-131 2.425 0.0 0.0 0.025 0.0 132-133 2.65 0.0 0.0 0.025 0.0 134-135 2.7750000000000004 0.0 0.0 0.025 0.0 136-137 3.0 0.0 0.0 0.025 0.0 138-139 3.2625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169913 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169913_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.352 34.0 33.0 34.0 33.0 34.0 2 33.425 34.0 33.0 34.0 33.0 34.0 3 33.44975 34.0 33.0 34.0 33.0 34.0 4 33.41825 34.0 33.0 34.0 33.0 34.0 5 33.414 34.0 33.0 34.0 33.0 34.0 6 37.51275 38.0 38.0 38.0 38.0 38.0 7 37.54225 38.0 38.0 38.0 38.0 38.0 8 37.56625 38.0 38.0 38.0 38.0 38.0 9 37.53525 38.0 38.0 38.0 38.0 38.0 10-14 37.5731 38.0 38.0 38.0 38.0 38.0 15-19 37.5672 38.0 38.0 38.0 38.0 38.0 20-24 37.366299999999995 38.0 38.0 38.0 37.6 38.0 25-29 36.927 38.0 38.0 38.0 35.4 38.0 30-34 36.6485 38.0 37.8 38.0 34.4 38.0 35-39 37.26915 38.0 38.0 38.0 37.4 38.0 40-44 37.1182 38.0 38.0 38.0 36.6 38.0 45-49 37.2084 38.0 38.0 38.0 36.8 38.0 50-54 37.3837 38.0 38.0 38.0 37.2 38.0 55-59 37.45115 38.0 38.0 38.0 37.8 38.0 60-64 37.363350000000004 38.0 38.0 38.0 37.4 38.0 65-69 37.3557 38.0 38.0 38.0 37.0 38.0 70-74 37.36155 38.0 38.0 38.0 37.0 38.0 75-79 37.30925 38.0 38.0 38.0 37.0 38.0 80-84 37.21065 38.0 38.0 38.0 37.0 38.0 85-89 37.116249999999994 38.0 38.0 38.0 36.6 38.0 90-94 37.177350000000004 38.0 38.0 38.0 36.4 38.0 95-99 37.0419 38.0 38.0 38.0 36.0 38.0 100-104 36.935199999999995 38.0 38.0 38.0 36.0 38.0 105-109 36.86255 38.0 38.0 38.0 35.8 38.0 110-114 36.82145 38.0 38.0 38.0 35.4 38.0 115-119 36.62175 38.0 38.0 38.0 34.4 38.0 120-124 36.422900000000006 38.0 38.0 38.0 34.0 38.0 125-129 36.3963 38.0 38.0 38.0 34.2 38.0 130-134 36.094849999999994 38.0 37.4 38.0 33.4 38.0 135-139 35.783 38.0 36.2 38.0 32.8 38.0 140-144 35.599199999999996 38.0 36.0 38.0 32.2 38.0 145-149 35.0751 38.0 36.0 38.0 30.2 38.0 150-151 31.037375 35.5 30.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 2.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 3.0 19 3.0 20 4.0 21 3.0 22 2.0 23 1.0 24 7.0 25 7.0 26 7.0 27 5.0 28 10.0 29 19.0 30 18.0 31 38.0 32 40.0 33 58.0 34 107.0 35 208.0 36 569.0 37 2874.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 21.15 14.099999999999998 27.700000000000003 2 25.831457864466117 27.25681420355089 29.83245811452863 17.079269817454364 3 20.1 29.9 30.599999999999998 19.400000000000002 4 22.18054513628407 34.55863965991498 23.730932733183295 19.529882470617654 5 23.78094523630908 35.708927231807955 22.55563890972743 17.95448862215554 6 20.275000000000002 37.25 23.925 18.55 7 18.8 21.7 39.775 19.725 8 22.275 24.474999999999998 27.650000000000002 25.6 9 21.325 25.374999999999996 28.65 24.65 10-14 22.7 28.595 26.825 21.88 15-19 22.62 28.365000000000002 27.735 21.279999999999998 20-24 22.185 28.749999999999996 27.800000000000004 21.265 25-29 23.05 27.825 28.199999999999996 20.925 30-34 22.695 28.27 27.529999999999998 21.505 35-39 22.525000000000002 27.97 28.265 21.240000000000002 40-44 22.689999999999998 28.01 28.4 20.9 45-49 22.23 28.205000000000002 28.355000000000004 21.21 50-54 22.634999999999998 28.110000000000003 28.044999999999998 21.21 55-59 23.025000000000002 27.74 27.905 21.33 60-64 23.28 27.71 28.005000000000003 21.005 65-69 23.405 27.66 27.884999999999998 21.05 70-74 22.755 27.61 29.054999999999996 20.580000000000002 75-79 23.315 27.405 28.365000000000002 20.915 80-84 23.165 28.28 27.595 20.96 85-89 23.849999999999998 28.225 27.62 20.305 90-94 22.655 28.345 28.175 20.825 95-99 23.48 27.555000000000003 28.18 20.785 100-104 23.825 27.555000000000003 27.955000000000002 20.665 105-109 22.695 28.499999999999996 27.794999999999998 21.01 110-114 23.715 27.725 27.689999999999998 20.87 115-119 24.14 27.165 28.499999999999996 20.195 120-124 23.34 27.625 28.095 20.94 125-129 23.925 27.744999999999997 27.485 20.845 130-134 23.895 27.015 27.855 21.235 135-139 23.765 27.779999999999998 27.615000000000002 20.84 140-144 23.68 27.58 28.535 20.205000000000002 145-149 24.235 27.884999999999998 28.110000000000003 19.77 150-151 24.6875 27.125 27.6625 20.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 2.0 25 2.0 26 3.5 27 5.5 28 8.0 29 8.5 30 11.0 31 16.5 32 21.0 33 28.5 34 39.0 35 63.5 36 82.5 37 106.5 38 134.0 39 164.0 40 203.0 41 240.5 42 271.5 43 288.0 44 283.0 45 285.0 46 296.5 47 271.5 48 239.0 49 217.0 50 180.5 51 128.0 52 90.5 53 71.5 54 64.0 55 54.5 56 39.0 57 24.0 58 14.5 59 11.0 60 8.0 61 5.0 62 3.5 63 2.5 64 3.5 65 3.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5375000000000001 0.0 0.0 0.0 0.0 104-105 0.6625000000000001 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.4 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.7 0.0 0.0 0.0 0.0 120-121 1.8250000000000002 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.0625 0.0 0.0 0.0 0.0 126-127 2.2125000000000004 0.0 0.0 0.0 0.0 128-129 2.325 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.725 0.0 0.0 0.0 0.0 134-135 2.8625 0.0 0.0 0.0 0.0 136-137 3.0999999999999996 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAAG 10 0.006830828 145.0 6 CCTCCAC 10 0.006830828 145.0 5 TACCTCC 10 0.006830828 145.0 3 ACCTCCA 20 3.5877043E-4 108.75 4 >>END_MODULE Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra Read 574241 spots for SRR7169913.sra Written 574241 spots for SRR7169913.sra Read 574226 spots for SRR7169913.sra Written 574226 spots for SRR7169913.sra SRR ids: ['SRR7169913.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lwdrwc_b SRR7169913.sra spots: 11484535 blocks: [[1, 574226], [574227, 1148452], [1148453, 1722678], [1722679, 2296904], [2296905, 2871130], [2871131, 3445356], [3445357, 4019582], [4019583, 4593808], [4593809, 5168034], [5168035, 5742260], [5742261, 6316486], [6316487, 6890712], [6890713, 7464938], [7464939, 8039164], [8039165, 8613390], [8613391, 9187616], [9187617, 9761842], [9761843, 10336068], [10336069, 10910294], [10910295, 11484535]] SRR7169913 file size 3870031 SRR7169913 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169913 SRR7169913_1.fastq SRR7169913_2.fastq Input file: SRR7169913_1.fastq Paired file: SRR7169913_2.fastq trimmed: SRR7169913-trimmed-pair1.fastq, SRR7169913-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:42:37 2025 >> started Wed Feb 12 02:42:49 2025 >> done (12.440s) 11484535 read pairs processed; of these: 9419 ( 0.08%) short read pairs filtered out after trimming by size control 7561 ( 0.07%) empty read pairs filtered out after trimming by size control 11467555 (99.85%) read pairs available; of these: 5043860 (43.98%) trimmed read pairs available after processing 6423695 (56.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 3 0.00% 26 5 0.00% 27 3 0.00% 28 1 0.00% 29 3 0.00% 30 0 0.00% 31 1 0.00% 32 3 0.00% 33 7 0.00% 34 2 0.00% 35 11 0.00% 36 6 0.00% 37 4 0.00% 38 6 0.00% 39 6 0.00% 40 7 0.00% 41 14 0.00% 42 11 0.00% 43 17 0.00% 44 15 0.00% 45 10 0.00% 46 18 0.00% 47 15 0.00% 48 15 0.00% 49 34 0.00% 50 32 0.00% 51 43 0.00% 52 48 0.00% 53 48 0.00% 54 46 0.00% 55 65 0.00% 56 66 0.00% 57 57 0.00% 58 89 0.00% 59 83 0.00% 60 109 0.00% 61 152 0.00% 62 121 0.00% 63 170 0.00% 64 171 0.00% 65 199 0.00% 66 228 0.00% 67 291 0.00% 68 310 0.00% 69 345 0.00% 70 404 0.00% 71 425 0.00% 72 543 0.00% 73 599 0.01% 74 664 0.01% 75 733 0.01% 76 783 0.01% 77 902 0.01% 78 944 0.01% 79 1057 0.01% 80 1197 0.01% 81 1285 0.01% 82 1590 0.01% 83 1845 0.02% 84 2336 0.02% 85 2645 0.02% 86 2799 0.02% 87 3108 0.03% 88 3317 0.03% 89 3433 0.03% 90 3695 0.03% 91 3892 0.03% 92 4148 0.04% 93 4479 0.04% 94 4883 0.04% 95 5051 0.04% 96 5352 0.05% 97 5510 0.05% 98 5826 0.05% 99 5957 0.05% 100 6344 0.06% 101 6667 0.06% 102 7181 0.06% 103 7667 0.07% 104 8110 0.07% 105 8493 0.07% 106 8799 0.08% 107 8801 0.08% 108 9061 0.08% 109 9452 0.08% 110 9752 0.09% 111 10156 0.09% 112 10573 0.09% 113 11110 0.10% 114 11821 0.10% 115 12251 0.11% 116 12499 0.11% 117 12781 0.11% 118 13056 0.11% 119 13109 0.11% 120 13607 0.12% 121 13843 0.12% 122 14394 0.13% 123 15013 0.13% 124 15721 0.14% 125 16739 0.15% 126 17459 0.15% 127 17997 0.16% 128 18448 0.16% 129 19260 0.17% 130 19781 0.17% 131 20751 0.18% 132 22236 0.19% 133 23547 0.21% 134 25249 0.22% 135 26989 0.24% 136 28827 0.25% 137 31162 0.27% 138 34059 0.30% 139 37154 0.32% 140 41102 0.36% 141 46337 0.40% 142 52657 0.46% 143 61164 0.53% 144 74487 0.65% 145 93884 0.82% 146 123772 1.08% 147 173573 1.51% 148 280455 2.45% 149 582621 5.08% 150 2801587 24.43% 151 6423695 56.02% 11467555 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=43 prefix-density=0.23 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=256.42 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=9.74 fanout-score-rank=11 prefix-density=0.38 prefix-fanout=6.4 sequence=TCAATGCTGTTGGAGGTGGTACTGGTTCTGGTCTTGGGTCACTTCTCCTGGAGAGGCTCTCTGTTGACTATGGCAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=44 fanout-score=76.88 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=10.5 sequence=CTGTTGTTGAGGCCATGACATGTGGTTTGCCAAC SRR7169913 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:43:30 Started mapping on | Feb 12 02:43:31 Finished on | Feb 12 02:44:27 Mapping speed, Million of reads per hour | 737.20 Number of input reads | 11467555 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10919121 Uniquely mapped reads % | 95.22% Average mapped length | 296.08 Number of splices: Total | 9987749 Number of splices: Annotated (sjdb) | 9824205 Number of splices: GT/AG | 9855536 Number of splices: GC/AG | 105099 Number of splices: AT/AC | 7110 Number of splices: Non-canonical | 20004 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193626 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 12659 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 363565 363565 363565 N_multimapping 193626 193626 193626 N_noFeature 284211 10777469 331324 N_ambiguous 143089 578 48146 UnstrandedReadsAssigned:10491821 PositiveStrandReadsAssigned:141074 NegativeStrandReadsAssigned:10539651 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169913 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169913-trimmed-pair1.fastq SRR7169913-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,467,555 reads, 10,461,999 reads pseudoaligned [quant] estimated average fragment length: 289.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,011 rounds 52401 SRR7169913.ke.tsv 34699 SRR7169913.se.tsv 87100 total ==> SRR7169913.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1729.62 162 9.87358 Potri.005G024800.1.v4.1 1035 746.621 11 1.55311 Potri.004G059700.1.v4.1 961 672.679 1 0.156712 Potri.007G009000.2.v4.1 1416 1127.62 0 0 Potri.003G141000.2.v4.1 2943 2654.62 158.049 6.27623 Potri.016G087400.1.v4.1 270 72.6951 758 1099.19 Potri.015G069301.1.v4.1 564 284.186 0 0 Potri.010G195200.1.v4.1 1773 1484.62 14 0.994084 Potri.012G127500.1.v4.1 977 688.644 965 147.721 ==> SRR7169913.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1039 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 135 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7169913 completed mapping pipeline successfully