Starting /dee2/code/volunteer_pipeline.sh SRR7169914 current disk space = 3048959713280 free memory = 1576184824 SRR7169914 SRAfilesize c5caedc72878e1f96309758d4174522d SRR7169914.sra SRR7169914.sra file validated SRR7169914 is paired end SRR7169914 is conventional basespace SRR7169914 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169914_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.31725 28.0 18.0 31.0 18.0 33.0 2 31.65625 33.0 31.0 33.0 29.0 33.0 3 32.543 33.0 33.0 33.0 31.0 33.0 4 32.85775 33.0 33.0 34.0 31.0 34.0 5 33.33075 34.0 33.0 34.0 33.0 34.0 6 37.0625 38.0 37.0 38.0 36.0 38.0 7 35.664 38.0 37.0 38.0 29.0 38.0 8 37.09625 38.0 38.0 38.0 36.0 38.0 9 37.4285 38.0 38.0 38.0 37.0 38.0 10-14 37.51855 38.0 38.0 38.0 37.4 38.0 15-19 37.487399999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.54174999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.49085 38.0 38.0 38.0 37.6 38.0 30-34 37.3993 38.0 38.0 38.0 37.0 38.0 35-39 37.4015 38.0 38.0 38.0 37.2 38.0 40-44 37.3081 38.0 38.0 38.0 36.8 38.0 45-49 37.35565 38.0 38.0 38.0 37.0 38.0 50-54 37.05775 38.0 38.0 38.0 36.2 38.0 55-59 36.7892 38.0 38.0 38.0 35.0 38.0 60-64 36.85775 38.0 38.0 38.0 35.4 38.0 65-69 36.42925 38.0 37.6 38.0 33.6 38.0 70-74 36.716950000000004 38.0 38.0 38.0 34.6 38.0 75-79 36.731199999999994 38.0 38.0 38.0 35.0 38.0 80-84 36.66 38.0 38.0 38.0 34.6 38.0 85-89 36.492599999999996 38.0 38.0 38.0 34.0 38.0 90-94 35.0554 38.0 35.8 38.0 26.6 38.0 95-99 35.9499 38.0 36.8 38.0 32.0 38.0 100-104 35.15820000000001 38.0 35.8 38.0 27.8 38.0 105-109 35.40615 38.0 36.2 38.0 28.2 38.0 110-114 34.501549999999995 37.8 34.4 38.0 25.0 38.0 115-119 34.54795 38.0 34.8 38.0 25.4 38.0 120-124 33.73389999999999 37.6 32.8 38.0 23.6 38.0 125-129 34.107899999999994 38.0 34.2 38.0 22.6 38.0 130-134 34.52385 38.0 34.8 38.0 26.6 38.0 135-139 33.89065000000001 37.8 34.0 38.0 23.2 38.0 140-144 32.9517 37.6 32.6 38.0 20.0 38.0 145-149 32.35625 36.6 32.8 38.0 14.4 38.0 150-151 29.33475 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 2.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 1.0 17 5.0 18 5.0 19 3.0 20 5.0 21 3.0 22 7.0 23 8.0 24 4.0 25 11.0 26 13.0 27 23.0 28 34.0 29 32.0 30 50.0 31 67.0 32 108.0 33 154.0 34 271.0 35 539.0 36 1274.0 37 1370.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.25 11.725 11.025 37.0 2 22.266700025018764 14.911183387540655 31.848886664998748 30.97322992244183 3 18.525 20.474999999999998 25.374999999999996 35.625 4 21.099999999999998 27.200000000000003 22.925 28.775000000000002 5 22.2 31.474999999999998 24.9 21.425 6 19.225 34.55 25.7 20.525 7 14.875 28.375 39.574999999999996 17.175 8 17.849999999999998 27.55 30.975 23.625 9 17.175 24.85 35.0 22.975 10-14 19.52 31.235000000000003 27.084999999999997 22.16 15-19 19.650000000000002 29.020000000000003 27.82 23.51 20-24 19.455 29.74 27.765 23.04 25-29 19.400000000000002 30.04 27.415 23.145 30-34 19.75 30.130000000000003 26.955000000000002 23.165 35-39 19.695 29.84 27.075 23.39 40-44 19.725 29.525000000000002 27.765 22.985 45-49 19.975 29.160000000000004 27.43 23.435 50-54 19.305 29.09 28.165000000000003 23.44 55-59 20.03 29.325000000000003 27.584999999999997 23.06 60-64 19.259999999999998 29.4 27.625 23.715 65-69 19.785 29.25 27.779999999999998 23.185 70-74 19.665 29.805 27.11 23.419999999999998 75-79 19.935 29.095 26.97 24.0 80-84 19.950000000000003 29.28 27.35 23.419999999999998 85-89 19.869999999999997 29.255 27.175 23.7 90-94 20.395 29.555 26.905 23.145 95-99 20.06 29.125 27.11 23.705000000000002 100-104 20.085 29.37 27.12 23.425 105-109 20.560000000000002 28.58 27.389999999999997 23.47 110-114 20.45 28.48 27.650000000000002 23.419999999999998 115-119 20.16524787180771 28.6129193790686 28.162243365047573 23.059589384076116 120-124 20.62546910182637 29.03177383037278 26.880160120090068 23.462596947710786 125-129 20.27 28.389999999999997 26.985 24.355 130-134 20.830000000000002 28.77 27.355 23.044999999999998 135-139 21.005 27.994999999999997 27.0 24.0 140-144 20.949427242259016 28.232704717122704 27.31229053073883 23.505577509879448 145-149 20.615 28.71 27.565 23.11 150-151 20.225 27.650000000000002 27.775 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 2.5 24 6.0 25 6.0 26 6.5 27 11.0 28 12.0 29 16.5 30 20.5 31 32.0 32 48.0 33 64.5 34 78.5 35 85.0 36 101.5 37 114.5 38 131.0 39 155.0 40 181.0 41 218.0 42 235.5 43 238.5 44 255.0 45 274.5 46 280.5 47 250.0 48 218.5 49 209.5 50 169.5 51 128.0 52 114.5 53 91.0 54 68.5 55 53.5 56 36.0 57 23.5 58 17.0 59 10.5 60 7.0 61 5.5 62 3.5 63 4.0 64 4.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.15 120-124 0.075 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.045 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.2 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5499999999999998 0.0 0.0 0.0 0.0 122-123 1.625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.25 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGAGT 10 0.006830828 145.0 2 TCCAGAG 10 0.006830828 145.0 1 CAGAGTG 10 0.006830828 145.0 3 TTGATTG 10 0.006830828 145.0 5 >>END_MODULE SRR7169914 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169914_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29075 34.0 33.0 34.0 33.0 34.0 2 33.3935 34.0 33.0 34.0 33.0 34.0 3 33.411 34.0 33.0 34.0 33.0 34.0 4 33.338 34.0 33.0 34.0 33.0 34.0 5 33.38225 34.0 33.0 34.0 33.0 34.0 6 37.54825 38.0 38.0 38.0 38.0 38.0 7 37.557 38.0 38.0 38.0 38.0 38.0 8 37.563 38.0 38.0 38.0 38.0 38.0 9 37.55 38.0 38.0 38.0 38.0 38.0 10-14 37.51105 38.0 38.0 38.0 38.0 38.0 15-19 37.5089 38.0 38.0 38.0 38.0 38.0 20-24 37.18515 38.0 38.0 38.0 36.6 38.0 25-29 36.21995 38.0 37.6 38.0 32.0 38.0 30-34 37.290200000000006 38.0 38.0 38.0 37.4 38.0 35-39 37.4461 38.0 38.0 38.0 38.0 38.0 40-44 37.248000000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.36345 38.0 38.0 38.0 37.6 38.0 50-54 37.1909 38.0 38.0 38.0 36.8 38.0 55-59 37.355000000000004 38.0 38.0 38.0 37.2 38.0 60-64 37.27524999999999 38.0 38.0 38.0 37.0 38.0 65-69 37.2375 38.0 38.0 38.0 37.0 38.0 70-74 37.27125 38.0 38.0 38.0 37.2 38.0 75-79 37.2462 38.0 38.0 38.0 37.0 38.0 80-84 37.1653 38.0 38.0 38.0 37.0 38.0 85-89 36.87295 38.0 38.0 38.0 35.8 38.0 90-94 37.0958 38.0 38.0 38.0 36.6 38.0 95-99 37.052800000000005 38.0 38.0 38.0 36.2 38.0 100-104 36.86345 38.0 38.0 38.0 35.8 38.0 105-109 36.81215 38.0 38.0 38.0 35.8 38.0 110-114 36.721000000000004 38.0 38.0 38.0 35.2 38.0 115-119 36.58624999999999 38.0 38.0 38.0 34.6 38.0 120-124 36.3788 38.0 38.0 38.0 34.2 38.0 125-129 36.24210000000001 38.0 38.0 38.0 34.0 38.0 130-134 35.99345 38.0 38.0 38.0 33.4 38.0 135-139 35.363299999999995 38.0 35.8 38.0 30.6 38.0 140-144 35.33395 38.0 36.0 38.0 31.4 38.0 145-149 34.600649999999995 38.0 35.4 38.0 27.2 38.0 150-151 31.355375 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 3.0 10 0.0 11 0.0 12 0.0 13 3.0 14 2.0 15 0.0 16 1.0 17 4.0 18 3.0 19 3.0 20 4.0 21 3.0 22 5.0 23 6.0 24 6.0 25 10.0 26 7.0 27 11.0 28 7.0 29 15.0 30 27.0 31 31.0 32 47.0 33 72.0 34 108.0 35 196.0 36 548.0 37 2870.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.875 20.4 15.8 26.924999999999997 2 25.775 25.374999999999996 30.575000000000003 18.275 3 20.4 27.35 31.225 21.025 4 23.14235676757568 32.44933700275207 24.043032274205654 20.365273955466602 5 24.993745308981737 35.17638228671503 22.66700025018764 17.162872154115586 6 21.325 37.65 23.025000000000002 18.0 7 20.4 22.225 37.925 19.45 8 21.575 27.075 26.424999999999997 24.925 9 22.25 24.425 29.375 23.95 10-14 23.3 29.049999999999997 26.540000000000003 21.11 15-19 22.96 27.76 28.325 20.955 20-24 23.02 27.98 28.285 20.715 25-29 23.655 27.96 27.515 20.87 30-34 22.285 28.68 28.165000000000003 20.87 35-39 22.825 28.15 27.389999999999997 21.634999999999998 40-44 22.869999999999997 27.839999999999996 28.29 21.0 45-49 22.965 27.125 28.38 21.529999999999998 50-54 23.445 27.750000000000004 27.54 21.265 55-59 23.07 27.67 28.1 21.16 60-64 22.91 28.084999999999997 28.1 20.905 65-69 23.27 28.13 28.144999999999996 20.455000000000002 70-74 23.035 27.884999999999998 27.865000000000002 21.215 75-79 23.599999999999998 27.800000000000004 28.035 20.565 80-84 23.630000000000003 27.834999999999997 27.794999999999998 20.74 85-89 23.23 27.66 28.615000000000002 20.495 90-94 23.125 27.794999999999998 28.27 20.810000000000002 95-99 23.494999999999997 27.939999999999998 27.55 21.015 100-104 24.04 27.72 27.965 20.275000000000002 105-109 23.53 28.04 27.794999999999998 20.635 110-114 24.085 27.955000000000002 27.715 20.244999999999997 115-119 24.005000000000003 27.57 27.62 20.805 120-124 23.82 27.700000000000003 27.91 20.57 125-129 23.89 27.650000000000002 28.275 20.185 130-134 23.845 28.1 27.72 20.335 135-139 24.459567654123298 27.42193755004003 27.762209767814248 20.356285028022416 140-144 24.185000000000002 27.644999999999996 27.67 20.5 145-149 24.495 28.000000000000004 27.305 20.200000000000003 150-151 24.712500000000002 27.3 28.287499999999998 19.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 2.5 27 4.5 28 6.0 29 9.0 30 14.0 31 18.5 32 23.5 33 32.0 34 46.0 35 63.0 36 75.5 37 96.5 38 129.5 39 162.5 40 206.0 41 235.0 42 250.0 43 284.0 44 291.0 45 281.5 46 264.5 47 243.0 48 250.0 49 236.5 50 187.0 51 146.5 52 110.5 53 87.0 54 68.0 55 41.0 56 32.5 57 28.5 58 25.0 59 18.5 60 10.5 61 7.0 62 3.0 63 1.0 64 1.5 65 1.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.08 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 2.0 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACCT 10 0.006830828 145.0 145 >>END_MODULE Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558886 spots for SRR7169914.sra Written 558886 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra Read 558883 spots for SRR7169914.sra Written 558883 spots for SRR7169914.sra SRR ids: ['SRR7169914.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__b552yob SRR7169914.sra spots: 11177663 blocks: [[1, 558883], [558884, 1117766], [1117767, 1676649], [1676650, 2235532], [2235533, 2794415], [2794416, 3353298], [3353299, 3912181], [3912182, 4471064], [4471065, 5029947], [5029948, 5588830], [5588831, 6147713], [6147714, 6706596], [6706597, 7265479], [7265480, 7824362], [7824363, 8383245], [8383246, 8942128], [8942129, 9501011], [9501012, 10059894], [10059895, 10618777], [10618778, 11177663]] SRR7169914 file size 3766042 SRR7169914 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169914 SRR7169914_1.fastq SRR7169914_2.fastq Input file: SRR7169914_1.fastq Paired file: SRR7169914_2.fastq trimmed: SRR7169914-trimmed-pair1.fastq, SRR7169914-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:27:41 2025 >> started Wed Feb 12 03:27:54 2025 >> done (12.308s) 11177663 read pairs processed; of these: 9187 ( 0.08%) short read pairs filtered out after trimming by size control 10093 ( 0.09%) empty read pairs filtered out after trimming by size control 11158383 (99.83%) read pairs available; of these: 4766239 (42.71%) trimmed read pairs available after processing 6392144 (57.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 4 0.00% 23 7 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 11 0.00% 28 1 0.00% 29 5 0.00% 30 6 0.00% 31 8 0.00% 32 4 0.00% 33 2 0.00% 34 10 0.00% 35 7 0.00% 36 9 0.00% 37 9 0.00% 38 11 0.00% 39 10 0.00% 40 10 0.00% 41 11 0.00% 42 14 0.00% 43 14 0.00% 44 11 0.00% 45 19 0.00% 46 23 0.00% 47 22 0.00% 48 34 0.00% 49 31 0.00% 50 55 0.00% 51 53 0.00% 52 43 0.00% 53 60 0.00% 54 79 0.00% 55 71 0.00% 56 83 0.00% 57 96 0.00% 58 107 0.00% 59 144 0.00% 60 133 0.00% 61 175 0.00% 62 224 0.00% 63 227 0.00% 64 242 0.00% 65 291 0.00% 66 301 0.00% 67 349 0.00% 68 348 0.00% 69 423 0.00% 70 513 0.00% 71 571 0.01% 72 675 0.01% 73 763 0.01% 74 812 0.01% 75 970 0.01% 76 1177 0.01% 77 1264 0.01% 78 1280 0.01% 79 1366 0.01% 80 1535 0.01% 81 1734 0.02% 82 1926 0.02% 83 2241 0.02% 84 2863 0.03% 85 3211 0.03% 86 3520 0.03% 87 3883 0.03% 88 4075 0.04% 89 4344 0.04% 90 4427 0.04% 91 4621 0.04% 92 4839 0.04% 93 5132 0.05% 94 5449 0.05% 95 5795 0.05% 96 6094 0.05% 97 6274 0.06% 98 6550 0.06% 99 6637 0.06% 100 6995 0.06% 101 7293 0.07% 102 7853 0.07% 103 8093 0.07% 104 8410 0.08% 105 9004 0.08% 106 9477 0.08% 107 9601 0.09% 108 10049 0.09% 109 10138 0.09% 110 10337 0.09% 111 10480 0.09% 112 11148 0.10% 113 11681 0.10% 114 12386 0.11% 115 12973 0.12% 116 13361 0.12% 117 13642 0.12% 118 13708 0.12% 119 14041 0.13% 120 14140 0.13% 121 14535 0.13% 122 14758 0.13% 123 15274 0.14% 124 15929 0.14% 125 16812 0.15% 126 17436 0.16% 127 18174 0.16% 128 18791 0.17% 129 19339 0.17% 130 20124 0.18% 131 20872 0.19% 132 22067 0.20% 133 23370 0.21% 134 24609 0.22% 135 25626 0.23% 136 27771 0.25% 137 29608 0.27% 138 31855 0.29% 139 34273 0.31% 140 37503 0.34% 141 41934 0.38% 142 47481 0.43% 143 55832 0.50% 144 66478 0.60% 145 83114 0.74% 146 108441 0.97% 147 153532 1.38% 148 244554 2.19% 149 515906 4.62% 150 2677081 23.99% 151 6392144 57.29% 11158383 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=20 fanout-score=32.20 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=11.0 sequence=TTCTCATCAAGGT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=39 prefix-density=0.26 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=26 fanout-score=37.27 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=10.0 sequence=TGTTGGTGGTGG SRR7169914 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:28:38 Started mapping on | Feb 12 03:28:38 Finished on | Feb 12 03:29:55 Mapping speed, Million of reads per hour | 521.69 Number of input reads | 11158383 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 10572389 Uniquely mapped reads % | 94.75% Average mapped length | 295.87 Number of splices: Total | 9506578 Number of splices: Annotated (sjdb) | 9351864 Number of splices: GT/AG | 9378355 Number of splices: GC/AG | 102768 Number of splices: AT/AC | 6935 Number of splices: Non-canonical | 18520 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 179665 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 9894 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 416303 416303 416303 N_multimapping 179665 179665 179665 N_noFeature 232058 10441054 273959 N_ambiguous 135203 633 45320 UnstrandedReadsAssigned:10205128 PositiveStrandReadsAssigned:130702 NegativeStrandReadsAssigned:10253110 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169914 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169914-trimmed-pair1.fastq SRR7169914-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,158,383 reads, 10,172,723 reads pseudoaligned [quant] estimated average fragment length: 281.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7169914.ke.tsv 34699 SRR7169914.se.tsv 87100 total ==> SRR7169914.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.43 142 7.64692 Potri.005G024800.1.v4.1 1035 754.433 13 1.61224 Potri.004G059700.1.v4.1 961 680.449 1 0.137503 Potri.007G009000.2.v4.1 1416 1135.43 0 0 Potri.003G141000.2.v4.1 2943 2662.43 185 6.50129 Potri.016G087400.1.v4.1 270 73.054 939.571 1203.35 Potri.015G069301.1.v4.1 564 289.882 0 0 Potri.010G195200.1.v4.1 1773 1492.43 20 1.25384 Potri.012G127500.1.v4.1 977 696.433 1604 215.492 ==> SRR7169914.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1284 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 146 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 41 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169914 completed mapping pipeline successfully