Starting /dee2/code/volunteer_pipeline.sh SRR7169915 current disk space = 3049067655168 free memory = 1488231936 SRR7169915 SRAfilesize 1c4124a95e46f106086744ca14fd4122 SRR7169915.sra SRR7169915.sra file validated SRR7169915 is paired end SRR7169915 is conventional basespace SRR7169915 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169915_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.9965 25.0 18.0 31.0 18.0 32.0 2 31.5295 33.0 31.0 33.0 29.0 33.0 3 32.4085 33.0 33.0 33.0 31.0 33.0 4 32.857 33.0 33.0 34.0 33.0 34.0 5 33.39625 34.0 33.0 34.0 33.0 34.0 6 37.3095 38.0 38.0 38.0 36.0 38.0 7 35.92225 38.0 37.0 38.0 31.0 38.0 8 37.26725 38.0 38.0 38.0 36.0 38.0 9 37.557 38.0 38.0 38.0 37.0 38.0 10-14 37.6763 38.0 38.0 38.0 38.0 38.0 15-19 37.680499999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.6666 38.0 38.0 38.0 38.0 38.0 25-29 37.61515 38.0 38.0 38.0 38.0 38.0 30-34 37.588300000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.586149999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.48575 38.0 38.0 38.0 37.6 38.0 45-49 37.5162 38.0 38.0 38.0 37.6 38.0 50-54 37.27565 38.0 38.0 38.0 36.4 38.0 55-59 37.0493 38.0 38.0 38.0 35.8 38.0 60-64 37.12194999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.592949999999995 38.0 37.6 38.0 34.0 38.0 70-74 36.99995 38.0 38.0 38.0 35.8 38.0 75-79 37.033750000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.9227 38.0 38.0 38.0 35.8 38.0 85-89 36.7793 38.0 38.0 38.0 35.2 38.0 90-94 35.56705000000001 38.0 36.6 38.0 29.8 38.0 95-99 36.2731 38.0 37.6 38.0 33.2 38.0 100-104 35.56314999999999 38.0 36.6 38.0 29.6 38.0 105-109 35.813 38.0 37.2 38.0 30.8 38.0 110-114 35.13485 38.0 35.8 38.0 27.2 38.0 115-119 34.9942 38.0 35.4 38.0 26.6 38.0 120-124 34.254599999999996 37.8 33.6 38.0 25.0 38.0 125-129 34.56529999999999 38.0 35.2 38.0 24.2 38.0 130-134 35.0633 38.0 35.6 38.0 28.8 38.0 135-139 34.674400000000006 38.0 35.2 38.0 25.8 38.0 140-144 33.780300000000004 37.6 33.8 38.0 24.0 38.0 145-149 33.22535 37.8 33.8 38.0 21.4 38.0 150-151 30.628124999999997 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 3.0 15 2.0 16 4.0 17 2.0 18 1.0 19 4.0 20 3.0 21 5.0 22 9.0 23 3.0 24 11.0 25 13.0 26 12.0 27 17.0 28 21.0 29 24.0 30 39.0 31 59.0 32 66.0 33 102.0 34 202.0 35 455.0 36 1203.0 37 1737.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.475 11.375 10.2 35.949999999999996 2 21.66624968726545 13.660245183887914 33.97548161120841 30.69802351763823 3 19.75 18.9 26.224999999999998 35.125 4 21.375 27.200000000000003 23.225 28.199999999999996 5 23.425 31.95 23.599999999999998 21.025 6 21.224999999999998 34.275 24.775 19.725 7 14.75 28.825 37.95 18.475 8 18.5 26.724999999999998 30.15 24.625 9 17.424999999999997 25.124999999999996 32.85 24.6 10-14 19.825 30.220000000000002 27.48 22.475 15-19 19.650000000000002 29.25 27.450000000000003 23.65 20-24 20.085 29.15 27.05 23.715 25-29 19.945 29.205 27.310000000000002 23.54 30-34 19.645000000000003 29.12 27.305 23.93 35-39 19.615 29.035 27.465 23.885 40-44 20.07 29.185 27.165 23.580000000000002 45-49 20.355 28.465 27.465 23.715 50-54 19.925 29.37 26.865 23.84 55-59 19.66 28.810000000000002 27.24 24.29 60-64 20.865000000000002 28.79 26.935 23.41 65-69 20.34 28.825 26.724999999999998 24.11 70-74 20.365 28.985 27.229999999999997 23.419999999999998 75-79 20.125 28.345 27.095000000000002 24.435000000000002 80-84 20.24 28.03 27.755000000000003 23.974999999999998 85-89 20.62 28.64 27.115000000000002 23.625 90-94 20.735 27.985 27.37 23.91 95-99 20.22 28.310000000000002 27.744999999999997 23.724999999999998 100-104 20.655 28.294999999999998 27.36 23.69 105-109 20.525 28.48 27.435 23.56 110-114 20.43 28.52 27.18 23.87 115-119 20.681021532298445 28.462694041061592 27.26089133700551 23.59539308963445 120-124 20.476381104883906 28.462770216172938 26.506204963971175 24.554643714971977 125-129 20.974999999999998 28.435 26.810000000000002 23.78 130-134 20.65 28.27 27.189999999999998 23.89 135-139 20.865000000000002 27.52 27.46 24.154999999999998 140-144 21.107664598759253 28.34700820492295 26.83109865919552 23.714228537122274 145-149 21.295 28.355000000000004 26.505000000000003 23.845 150-151 21.6875 27.625 25.95 24.7375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.5 24 2.5 25 4.0 26 3.5 27 6.5 28 9.5 29 11.5 30 20.0 31 27.0 32 27.0 33 38.5 34 52.5 35 61.0 36 82.5 37 97.5 38 116.0 39 150.5 40 192.5 41 220.5 42 243.5 43 266.5 44 261.0 45 265.0 46 263.5 47 266.5 48 245.5 49 204.0 50 185.5 51 147.0 52 116.5 53 109.0 54 86.0 55 58.0 56 39.5 57 27.5 58 24.5 59 19.0 60 11.0 61 4.0 62 4.5 63 6.0 64 4.5 65 3.5 66 3.0 67 2.5 68 1.5 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.15 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.06 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.7125 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.45 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169915 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169915_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.32225 34.0 33.0 34.0 33.0 34.0 2 33.40425 34.0 33.0 34.0 33.0 34.0 3 33.42075 34.0 33.0 34.0 33.0 34.0 4 33.40325 34.0 33.0 34.0 33.0 34.0 5 33.394 34.0 33.0 34.0 33.0 34.0 6 37.5405 38.0 38.0 38.0 38.0 38.0 7 37.5515 38.0 38.0 38.0 38.0 38.0 8 37.506 38.0 38.0 38.0 38.0 38.0 9 37.58625 38.0 38.0 38.0 38.0 38.0 10-14 37.4824 38.0 38.0 38.0 38.0 38.0 15-19 37.489999999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.1854 38.0 38.0 38.0 36.6 38.0 25-29 36.26535 38.0 37.6 38.0 32.8 38.0 30-34 37.2944 38.0 38.0 38.0 37.4 38.0 35-39 37.435750000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.29115 38.0 38.0 38.0 37.4 38.0 45-49 37.4226 38.0 38.0 38.0 38.0 38.0 50-54 37.257 38.0 38.0 38.0 37.4 38.0 55-59 37.367650000000005 38.0 38.0 38.0 37.8 38.0 60-64 37.276050000000005 38.0 38.0 38.0 37.6 38.0 65-69 37.2283 38.0 38.0 38.0 37.4 38.0 70-74 37.20805 38.0 38.0 38.0 37.4 38.0 75-79 37.21575 38.0 38.0 38.0 37.0 38.0 80-84 37.151849999999996 38.0 38.0 38.0 37.0 38.0 85-89 36.87705 38.0 38.0 38.0 36.2 38.0 90-94 37.1182 38.0 38.0 38.0 37.0 38.0 95-99 37.04175 38.0 38.0 38.0 37.0 38.0 100-104 36.945750000000004 38.0 38.0 38.0 36.6 38.0 105-109 36.8288 38.0 38.0 38.0 36.0 38.0 110-114 36.763999999999996 38.0 38.0 38.0 35.6 38.0 115-119 36.58925 38.0 38.0 38.0 35.0 38.0 120-124 36.52804999999999 38.0 38.0 38.0 35.0 38.0 125-129 36.3881 38.0 38.0 38.0 34.2 38.0 130-134 36.16384999999999 38.0 38.0 38.0 33.8 38.0 135-139 35.4486 38.0 36.8 38.0 31.8 38.0 140-144 35.498149999999995 38.0 36.2 38.0 32.2 38.0 145-149 34.7389 38.0 35.8 38.0 27.4 38.0 150-151 31.5315 36.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 3.0 5 1.0 6 0.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 0.0 13 1.0 14 4.0 15 2.0 16 2.0 17 3.0 18 2.0 19 4.0 20 5.0 21 10.0 22 6.0 23 5.0 24 5.0 25 5.0 26 7.0 27 10.0 28 13.0 29 19.0 30 21.0 31 22.0 32 32.0 33 47.0 34 95.0 35 177.0 36 470.0 37 3016.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.925 21.125 13.275 24.675 2 27.525 26.674999999999997 27.725 18.075 3 21.425 28.999999999999996 28.749999999999996 20.825 4 24.58729364682341 34.167083541770886 23.06153076538269 18.18409204602301 5 24.187093546773387 35.26763381690846 22.761380690345174 17.78389194597299 6 20.75 37.85 23.375 18.025 7 20.925 20.974999999999998 37.974999999999994 20.125 8 21.6 24.625 27.975 25.8 9 21.775 25.624999999999996 29.525000000000002 23.075000000000003 10-14 23.75 28.655 26.400000000000002 21.195 15-19 23.65 28.410000000000004 26.939999999999998 21.0 20-24 23.68 28.26 27.139999999999997 20.919999999999998 25-29 23.5 28.335 27.265 20.9 30-34 23.044999999999998 28.549999999999997 26.88 21.525 35-39 23.18 28.005000000000003 27.87 20.945 40-44 23.765 27.57 27.47 21.195 45-49 23.875 27.834999999999997 27.54 20.75 50-54 22.99 28.03 27.744999999999997 21.235 55-59 24.02 28.050000000000004 27.284999999999997 20.645 60-64 23.990000000000002 27.845 27.26 20.905 65-69 23.625 27.47 28.050000000000004 20.855 70-74 23.985 27.625 27.66 20.73 75-79 23.755000000000003 28.425 27.235 20.585 80-84 23.535 27.925 27.88 20.66 85-89 24.099999999999998 27.845 27.694999999999997 20.36 90-94 23.76 27.41 27.83 21.0 95-99 23.56 27.295 28.28 20.865000000000002 100-104 24.165 28.12 27.589999999999996 20.125 105-109 24.055 27.185 28.225 20.535 110-114 23.745 27.815 28.105000000000004 20.335 115-119 24.275 27.165 28.065 20.495 120-124 24.27 27.33 27.92 20.48 125-129 24.425 27.415 27.76 20.4 130-134 24.495 27.325 27.810000000000002 20.369999999999997 135-139 25.035035035035037 27.33233233233233 27.68268268268268 19.94994994994995 140-144 24.465 27.515 27.334999999999997 20.685000000000002 145-149 25.165 28.03 26.924999999999997 19.88 150-151 25.85 26.937499999999996 27.700000000000003 19.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 1.0 26 1.5 27 4.5 28 5.0 29 5.5 30 8.0 31 11.0 32 13.5 33 21.5 34 35.5 35 52.0 36 65.0 37 85.0 38 121.0 39 162.0 40 201.5 41 234.0 42 254.5 43 276.0 44 285.5 45 291.0 46 284.0 47 262.5 48 248.0 49 219.0 50 184.5 51 150.0 52 120.5 53 100.5 54 79.0 55 59.5 56 46.5 57 28.5 58 20.0 59 19.0 60 11.5 61 7.0 62 7.5 63 5.5 64 1.5 65 1.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4125 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.6624999999999996 0.0 0.0 0.0 0.0 124-125 4.050000000000001 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.725 0.0 0.0 0.0 0.0 130-131 5.0625 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.675000000000001 0.0 0.0 0.0 0.0 136-137 6.1 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATGG 10 0.006830828 145.0 8 GAAAACA 10 0.006830828 145.0 2 AAAAAAA 20 0.00593511 29.0 115-119 >>END_MODULE Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602426 spots for SRR7169915.sra Written 602426 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra Read 602408 spots for SRR7169915.sra Written 602408 spots for SRR7169915.sra SRR ids: ['SRR7169915.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8tu3f6l SRR7169915.sra spots: 12048178 blocks: [[1, 602408], [602409, 1204816], [1204817, 1807224], [1807225, 2409632], [2409633, 3012040], [3012041, 3614448], [3614449, 4216856], [4216857, 4819264], [4819265, 5421672], [5421673, 6024080], [6024081, 6626488], [6626489, 7228896], [7228897, 7831304], [7831305, 8433712], [8433713, 9036120], [9036121, 9638528], [9638529, 10240936], [10240937, 10843344], [10843345, 11445752], [11445753, 12048178]] SRR7169915 file size 4061031 SRR7169915 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169915 SRR7169915_1.fastq SRR7169915_2.fastq Input file: SRR7169915_1.fastq Paired file: SRR7169915_2.fastq trimmed: SRR7169915-trimmed-pair1.fastq, SRR7169915-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:46:49 2025 >> started Wed Feb 12 02:47:01 2025 >> done (12.655s) 12048178 read pairs processed; of these: 11796 ( 0.10%) short read pairs filtered out after trimming by size control 12817 ( 0.11%) empty read pairs filtered out after trimming by size control 12023565 (99.80%) read pairs available; of these: 5155598 (42.88%) trimmed read pairs available after processing 6867967 (57.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 4 0.00% 25 1 0.00% 26 2 0.00% 27 4 0.00% 28 0 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 2 0.00% 34 11 0.00% 35 4 0.00% 36 6 0.00% 37 7 0.00% 38 8 0.00% 39 5 0.00% 40 10 0.00% 41 11 0.00% 42 14 0.00% 43 8 0.00% 44 17 0.00% 45 21 0.00% 46 28 0.00% 47 19 0.00% 48 30 0.00% 49 34 0.00% 50 31 0.00% 51 59 0.00% 52 49 0.00% 53 75 0.00% 54 66 0.00% 55 75 0.00% 56 104 0.00% 57 100 0.00% 58 130 0.00% 59 144 0.00% 60 180 0.00% 61 207 0.00% 62 235 0.00% 63 267 0.00% 64 279 0.00% 65 331 0.00% 66 374 0.00% 67 406 0.00% 68 501 0.00% 69 536 0.00% 70 710 0.01% 71 782 0.01% 72 888 0.01% 73 1033 0.01% 74 1186 0.01% 75 1419 0.01% 76 1618 0.01% 77 1715 0.01% 78 1750 0.01% 79 2088 0.02% 80 2347 0.02% 81 2572 0.02% 82 2941 0.02% 83 3343 0.03% 84 4573 0.04% 85 4948 0.04% 86 5200 0.04% 87 5843 0.05% 88 6058 0.05% 89 6415 0.05% 90 6796 0.06% 91 7227 0.06% 92 7604 0.06% 93 8433 0.07% 94 9016 0.07% 95 9630 0.08% 96 10317 0.09% 97 10739 0.09% 98 11005 0.09% 99 11200 0.09% 100 11985 0.10% 101 12322 0.10% 102 13205 0.11% 103 13786 0.11% 104 14581 0.12% 105 15742 0.13% 106 15999 0.13% 107 16743 0.14% 108 17300 0.14% 109 17464 0.15% 110 17909 0.15% 111 18598 0.15% 112 19319 0.16% 113 20217 0.17% 114 21442 0.18% 115 21981 0.18% 116 22840 0.19% 117 23404 0.19% 118 23953 0.20% 119 24330 0.20% 120 24685 0.21% 121 24997 0.21% 122 25695 0.21% 123 26804 0.22% 124 28025 0.23% 125 28792 0.24% 126 30137 0.25% 127 30837 0.26% 128 31941 0.27% 129 32211 0.27% 130 33094 0.28% 131 34313 0.29% 132 35299 0.29% 133 36654 0.30% 134 38058 0.32% 135 39954 0.33% 136 41339 0.34% 137 43584 0.36% 138 45805 0.38% 139 48084 0.40% 140 50811 0.42% 141 54123 0.45% 142 59459 0.49% 143 65934 0.55% 144 74437 0.62% 145 89625 0.75% 146 109628 0.91% 147 146623 1.22% 148 222292 1.85% 149 453677 3.77% 150 2631750 21.89% 151 6867967 57.12% 12023565 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=246.34 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.2 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=153.37 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=14.6 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCTCGG SRR7169915 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:47:51 Started mapping on | Feb 12 02:47:51 Finished on | Feb 12 02:49:14 Mapping speed, Million of reads per hour | 521.50 Number of input reads | 12023565 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11342173 Uniquely mapped reads % | 94.33% Average mapped length | 293.75 Number of splices: Total | 10226584 Number of splices: Annotated (sjdb) | 10060864 Number of splices: GT/AG | 10082927 Number of splices: GC/AG | 113069 Number of splices: AT/AC | 8341 Number of splices: Non-canonical | 22247 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193203 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 12181 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.92% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 498939 498939 498939 N_multimapping 193203 193203 193203 N_noFeature 227059 11211131 273853 N_ambiguous 129823 603 45200 UnstrandedReadsAssigned:10985291 PositiveStrandReadsAssigned:130439 NegativeStrandReadsAssigned:11023120 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169915 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169915-trimmed-pair1.fastq SRR7169915-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,023,565 reads, 10,963,917 reads pseudoaligned [quant] estimated average fragment length: 235.243 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR7169915.ke.tsv 34699 SRR7169915.se.tsv 87100 total ==> SRR7169915.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.76 192 9.1243 Potri.005G024800.1.v4.1 1035 800.757 27 2.85823 Potri.004G059700.1.v4.1 961 726.777 1 0.116636 Potri.007G009000.2.v4.1 1416 1181.76 0 0 Potri.003G141000.2.v4.1 2943 2708.76 199 6.22755 Potri.016G087400.1.v4.1 270 81.8547 847 877.15 Potri.015G069301.1.v4.1 564 332.771 0 0 Potri.010G195200.1.v4.1 1773 1538.76 13 0.716156 Potri.012G127500.1.v4.1 977 742.767 3783 431.735 ==> SRR7169915.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1127 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 210 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169915 completed mapping pipeline successfully