Starting /dee2/code/volunteer_pipeline.sh SRR7169916 current disk space = 3049015328768 free memory = 1487153716 SRR7169916 SRAfilesize 484f325319e18050eeea42257c28606a SRR7169916.sra SRR7169916.sra file validated SRR7169916 is paired end SRR7169916 is conventional basespace SRR7169916 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169916_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.4755 28.0 18.0 31.0 18.0 32.0 2 31.7785 33.0 31.0 33.0 30.0 33.0 3 32.61225 33.0 33.0 33.0 31.0 33.0 4 32.967 33.0 33.0 34.0 33.0 34.0 5 33.41875 34.0 33.0 34.0 33.0 34.0 6 37.17675 38.0 37.0 38.0 36.0 38.0 7 35.74975 38.0 37.0 38.0 29.0 38.0 8 37.04375 38.0 38.0 38.0 36.0 38.0 9 37.541 38.0 38.0 38.0 37.0 38.0 10-14 37.61835 38.0 38.0 38.0 38.0 38.0 15-19 37.615500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.63125 38.0 38.0 38.0 38.0 38.0 25-29 37.62885 38.0 38.0 38.0 38.0 38.0 30-34 37.57445 38.0 38.0 38.0 38.0 38.0 35-39 37.56795 38.0 38.0 38.0 38.0 38.0 40-44 37.446999999999996 38.0 38.0 38.0 37.4 38.0 45-49 37.5544 38.0 38.0 38.0 38.0 38.0 50-54 37.297450000000005 38.0 38.0 38.0 36.8 38.0 55-59 37.009699999999995 38.0 38.0 38.0 35.8 38.0 60-64 37.128 38.0 38.0 38.0 36.0 38.0 65-69 36.6197 38.0 37.6 38.0 34.0 38.0 70-74 36.999100000000006 38.0 38.0 38.0 35.8 38.0 75-79 37.1135 38.0 38.0 38.0 36.0 38.0 80-84 36.9854 38.0 38.0 38.0 36.0 38.0 85-89 36.822950000000006 38.0 38.0 38.0 35.4 38.0 90-94 35.4667 38.0 36.2 38.0 27.8 38.0 95-99 36.299600000000005 38.0 37.4 38.0 33.2 38.0 100-104 35.43765 38.0 36.4 38.0 28.8 38.0 105-109 35.85145 38.0 36.6 38.0 30.8 38.0 110-114 35.1529 38.0 35.8 38.0 27.4 38.0 115-119 34.96185 38.0 35.4 38.0 26.6 38.0 120-124 34.17495 37.8 33.6 38.0 25.0 38.0 125-129 34.5489 38.0 34.8 38.0 24.6 38.0 130-134 34.85705 38.0 35.0 38.0 27.2 38.0 135-139 34.5531 38.0 34.8 38.0 25.2 38.0 140-144 33.62814999999999 37.6 33.6 38.0 23.4 38.0 145-149 33.015100000000004 37.4 33.8 38.0 18.6 38.0 150-151 30.11625 36.0 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 2.0 16 3.0 17 1.0 18 0.0 19 5.0 20 1.0 21 4.0 22 2.0 23 9.0 24 7.0 25 11.0 26 15.0 27 13.0 28 23.0 29 32.0 30 34.0 31 61.0 32 89.0 33 122.0 34 237.0 35 455.0 36 1258.0 37 1613.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.099999999999994 10.725 10.45 37.724999999999994 2 21.31598699024268 14.385789342006506 34.82611958969227 29.472104078058543 3 18.95 20.575 26.1 34.375 4 22.2 29.4 22.625 25.775 5 22.7 33.550000000000004 23.65 20.1 6 19.425 36.449999999999996 25.025 19.1 7 14.174999999999999 26.05 41.025 18.75 8 17.175 26.474999999999998 31.25 25.1 9 18.85 23.775 34.375 23.0 10-14 19.67 30.19 27.355 22.785 15-19 19.794999999999998 29.065 28.04 23.1 20-24 19.675 29.625 27.455000000000002 23.244999999999997 25-29 19.91 28.88 27.935 23.275000000000002 30-34 19.97 29.335 27.689999999999998 23.005 35-39 19.994999999999997 29.125 27.485 23.395 40-44 19.855 29.585 26.905 23.655 45-49 20.105 28.1 27.925 23.87 50-54 20.549999999999997 28.93 27.275 23.244999999999997 55-59 20.57 29.25 26.634999999999998 23.544999999999998 60-64 20.25 28.945 27.47 23.335 65-69 19.869999999999997 29.160000000000004 27.584999999999997 23.385 70-74 20.150000000000002 29.110000000000003 27.415 23.325000000000003 75-79 19.915 28.415000000000003 27.715 23.955000000000002 80-84 20.45 28.754999999999995 27.589999999999996 23.205000000000002 85-89 20.62 28.58 27.18 23.62 90-94 20.544999999999998 28.249999999999996 27.400000000000002 23.805 95-99 20.515 28.965000000000003 27.075 23.445 100-104 20.51 29.37 26.255 23.865 105-109 21.279999999999998 28.665000000000003 27.24 22.814999999999998 110-114 20.365 29.13 27.3 23.205000000000002 115-119 21.334134615384613 28.991386217948715 26.412259615384613 23.26221955128205 120-124 20.72658126501201 28.52281825460368 27.331865492393913 23.41873498799039 125-129 20.424999999999997 28.549999999999997 27.29 23.735 130-134 20.294999999999998 28.255000000000003 27.310000000000002 24.14 135-139 21.36 28.075 26.72 23.845 140-144 21.014456505427443 28.097643939772897 26.807063178430298 24.080836376369366 145-149 20.75 28.065 27.12 24.065 150-151 21.325 28.225 27.150000000000002 23.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.0 20 1.0 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 5.5 27 6.5 28 7.5 29 14.0 30 18.0 31 25.5 32 35.5 33 51.0 34 63.0 35 74.0 36 100.0 37 120.0 38 131.0 39 144.5 40 195.0 41 232.0 42 227.5 43 248.0 44 268.5 45 263.5 46 272.5 47 264.0 48 228.5 49 199.5 50 165.0 51 137.5 52 115.5 53 97.0 54 79.0 55 52.5 56 35.5 57 31.0 58 23.0 59 14.0 60 9.0 61 8.0 62 7.0 63 5.0 64 5.5 65 3.0 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.16 120-124 0.08 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.045 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 3.0375 0.0 0.0 0.0 0.0 116-117 3.2750000000000004 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.9625000000000004 0.0 0.0 0.0 0.0 122-123 4.300000000000001 0.0 0.0 0.0 0.0 124-125 4.699999999999999 0.0 0.0 0.0 0.0 126-127 5.1 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 6.262499999999999 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.2 0.0 0.0 0.0 0.0 136-137 7.7625 0.0 0.0 0.0 0.0 138-139 8.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAAATG 10 0.006846698 144.88751 2 CAAATGT 10 0.006846698 144.88751 3 >>END_MODULE SRR7169916 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169916_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.29975 34.0 33.0 34.0 33.0 34.0 2 33.38775 34.0 33.0 34.0 33.0 34.0 3 33.40925 34.0 33.0 34.0 33.0 34.0 4 33.379 34.0 33.0 34.0 33.0 34.0 5 33.42425 34.0 33.0 34.0 33.0 34.0 6 37.5715 38.0 38.0 38.0 38.0 38.0 7 37.55775 38.0 38.0 38.0 38.0 38.0 8 37.549 38.0 38.0 38.0 38.0 38.0 9 37.53725 38.0 38.0 38.0 38.0 38.0 10-14 37.5269 38.0 38.0 38.0 38.0 38.0 15-19 37.53985 38.0 38.0 38.0 38.0 38.0 20-24 37.17575 38.0 38.0 38.0 36.2 38.0 25-29 36.16155 38.0 37.6 38.0 32.0 38.0 30-34 37.23845 38.0 38.0 38.0 37.2 38.0 35-39 37.461349999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.3016 38.0 38.0 38.0 37.6 38.0 45-49 37.42100000000001 38.0 38.0 38.0 37.8 38.0 50-54 37.2813 38.0 38.0 38.0 37.4 38.0 55-59 37.3455 38.0 38.0 38.0 37.8 38.0 60-64 37.224849999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.19345 38.0 38.0 38.0 37.0 38.0 70-74 37.23315 38.0 38.0 38.0 37.0 38.0 75-79 37.22865 38.0 38.0 38.0 37.0 38.0 80-84 37.1411 38.0 38.0 38.0 37.0 38.0 85-89 36.8288 38.0 38.0 38.0 35.8 38.0 90-94 37.0683 38.0 38.0 38.0 37.0 38.0 95-99 36.9855 38.0 38.0 38.0 36.6 38.0 100-104 36.81735 38.0 38.0 38.0 35.8 38.0 105-109 36.7462 38.0 38.0 38.0 35.6 38.0 110-114 36.7241 38.0 38.0 38.0 35.0 38.0 115-119 36.52415 38.0 38.0 38.0 34.4 38.0 120-124 36.24955 38.0 38.0 38.0 34.2 38.0 125-129 36.1781 38.0 38.0 38.0 34.0 38.0 130-134 35.9917 38.0 38.0 38.0 33.8 38.0 135-139 35.31485 38.0 35.8 38.0 30.8 38.0 140-144 35.2181 38.0 35.8 38.0 30.4 38.0 145-149 34.34875 38.0 35.2 38.0 25.4 38.0 150-151 31.090249999999997 36.5 29.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 3.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 3.0 11 0.0 12 1.0 13 0.0 14 3.0 15 5.0 16 3.0 17 1.0 18 0.0 19 3.0 20 4.0 21 3.0 22 5.0 23 7.0 24 9.0 25 5.0 26 13.0 27 14.0 28 18.0 29 15.0 30 27.0 31 26.0 32 38.0 33 73.0 34 94.0 35 185.0 36 557.0 37 2877.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.875 20.8 14.374999999999998 24.95 2 24.95 27.325 30.349999999999998 17.375 3 19.775000000000002 30.475 30.45 19.3 4 24.568426319739807 34.00050037528146 21.99149362021516 19.439579684763572 5 24.143107330497873 35.60170127595696 22.566925193895422 17.68826619964974 6 20.724999999999998 37.55 23.775 17.95 7 20.325 19.825 39.275 20.575 8 22.5 25.75 26.950000000000003 24.8 9 20.424999999999997 26.650000000000002 29.2 23.724999999999998 10-14 23.25 28.754999999999995 26.3 21.695 15-19 22.535 28.084999999999997 27.889999999999997 21.490000000000002 20-24 23.69 27.935 27.334999999999997 21.04 25-29 22.8 28.83 27.29 21.08 30-34 22.91 28.494999999999997 27.694999999999997 20.9 35-39 22.88 28.42 27.689999999999998 21.01 40-44 23.080000000000002 28.13 27.87 20.919999999999998 45-49 22.99 28.134999999999998 28.01 20.865000000000002 50-54 23.02 27.965 28.37 20.645 55-59 23.54 27.779999999999998 28.15 20.53 60-64 22.275 27.975 28.595 21.154999999999998 65-69 22.915 27.605 28.365000000000002 21.115000000000002 70-74 23.22 27.935 28.310000000000002 20.535 75-79 23.395 27.894999999999996 28.22 20.49 80-84 22.88 28.139999999999997 27.860000000000003 21.12 85-89 22.825 27.894999999999996 28.48 20.8 90-94 23.745 27.67 28.215 20.369999999999997 95-99 23.830000000000002 27.395000000000003 28.34 20.435 100-104 23.635 27.82 27.63 20.915 105-109 23.724999999999998 27.41 28.315 20.549999999999997 110-114 23.57 27.87 28.04 20.52 115-119 24.165 27.815 27.825 20.195 120-124 24.075 28.015 27.49 20.419999999999998 125-129 24.85 27.625 27.615000000000002 19.91 130-134 24.985 28.555000000000003 26.650000000000002 19.81 135-139 24.64964964964965 28.353353353353356 27.547547547547545 19.44944944944945 140-144 24.91 27.55 27.744999999999997 19.794999999999998 145-149 25.230000000000004 27.860000000000003 27.62 19.29 150-151 25.7375 28.15 27.250000000000004 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 3.0 25 3.5 26 5.5 27 7.5 28 7.5 29 8.5 30 14.5 31 22.0 32 27.5 33 39.0 34 49.5 35 62.5 36 84.0 37 104.0 38 128.5 39 168.5 40 202.0 41 228.5 42 257.5 43 281.5 44 297.5 45 290.5 46 270.5 47 250.0 48 224.0 49 188.5 50 155.5 51 142.0 52 116.5 53 83.5 54 67.5 55 50.0 56 36.0 57 28.0 58 20.5 59 17.0 60 14.5 61 10.5 62 9.0 63 5.5 64 2.5 65 3.5 66 3.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.075 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.1 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.47500000000000003 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.9500000000000002 0.0 0.0 0.0 0.0 108-109 2.2750000000000004 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 2.8375 0.0 0.0 0.0 0.0 114-115 3.225 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.9625 0.0 0.0 0.0 0.0 126-127 5.3625 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.5375 0.0 0.0 0.0 0.0 132-133 7.025 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 8.1 0.0 0.0 0.0 0.0 138-139 8.712499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTACA 10 0.0068555363 144.825 7 >>END_MODULE Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609347 spots for SRR7169916.sra Written 609347 spots for SRR7169916.sra Read 609353 spots for SRR7169916.sra Written 609353 spots for SRR7169916.sra SRR ids: ['SRR7169916.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j3l77c6_ SRR7169916.sra spots: 12186946 blocks: [[1, 609347], [609348, 1218694], [1218695, 1828041], [1828042, 2437388], [2437389, 3046735], [3046736, 3656082], [3656083, 4265429], [4265430, 4874776], [4874777, 5484123], [5484124, 6093470], [6093471, 6702817], [6702818, 7312164], [7312165, 7921511], [7921512, 8530858], [8530859, 9140205], [9140206, 9749552], [9749553, 10358899], [10358900, 10968246], [10968247, 11577593], [11577594, 12186946]] SRR7169916 file size 4108055 SRR7169916 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169916 SRR7169916_1.fastq SRR7169916_2.fastq Input file: SRR7169916_1.fastq Paired file: SRR7169916_2.fastq trimmed: SRR7169916-trimmed-pair1.fastq, SRR7169916-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 02:47:57 2025 >> started Wed Feb 12 02:48:11 2025 >> done (14.265s) 12186946 read pairs processed; of these: 11511 ( 0.09%) short read pairs filtered out after trimming by size control 10066 ( 0.08%) empty read pairs filtered out after trimming by size control 12165369 (99.82%) read pairs available; of these: 5581601 (45.88%) trimmed read pairs available after processing 6583768 (54.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 5 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 2 0.00% 27 1 0.00% 28 5 0.00% 29 4 0.00% 30 2 0.00% 31 5 0.00% 32 4 0.00% 33 7 0.00% 34 5 0.00% 35 8 0.00% 36 7 0.00% 37 5 0.00% 38 9 0.00% 39 15 0.00% 40 7 0.00% 41 12 0.00% 42 14 0.00% 43 22 0.00% 44 15 0.00% 45 24 0.00% 46 21 0.00% 47 25 0.00% 48 30 0.00% 49 37 0.00% 50 43 0.00% 51 54 0.00% 52 60 0.00% 53 74 0.00% 54 68 0.00% 55 79 0.00% 56 86 0.00% 57 111 0.00% 58 132 0.00% 59 149 0.00% 60 198 0.00% 61 213 0.00% 62 219 0.00% 63 281 0.00% 64 294 0.00% 65 301 0.00% 66 395 0.00% 67 458 0.00% 68 502 0.00% 69 578 0.00% 70 694 0.01% 71 779 0.01% 72 918 0.01% 73 1092 0.01% 74 1181 0.01% 75 1417 0.01% 76 1478 0.01% 77 1672 0.01% 78 1928 0.02% 79 2045 0.02% 80 2369 0.02% 81 2784 0.02% 82 3204 0.03% 83 3687 0.03% 84 4682 0.04% 85 5102 0.04% 86 5450 0.04% 87 6029 0.05% 88 6412 0.05% 89 6901 0.06% 90 7469 0.06% 91 8274 0.07% 92 8950 0.07% 93 9613 0.08% 94 10761 0.09% 95 11364 0.09% 96 11787 0.10% 97 12415 0.10% 98 13126 0.11% 99 13438 0.11% 100 14420 0.12% 101 15328 0.13% 102 16560 0.14% 103 17635 0.14% 104 18707 0.15% 105 19919 0.16% 106 20260 0.17% 107 20781 0.17% 108 21330 0.18% 109 21908 0.18% 110 22878 0.19% 111 24022 0.20% 112 25071 0.21% 113 26367 0.22% 114 27831 0.23% 115 28991 0.24% 116 29747 0.24% 117 30040 0.25% 118 30578 0.25% 119 30367 0.25% 120 31527 0.26% 121 32367 0.27% 122 33649 0.28% 123 35361 0.29% 124 36983 0.30% 125 38383 0.32% 126 39111 0.32% 127 39967 0.33% 128 40260 0.33% 129 41535 0.34% 130 41989 0.35% 131 42596 0.35% 132 44813 0.37% 133 46553 0.38% 134 48678 0.40% 135 51219 0.42% 136 52728 0.43% 137 54249 0.45% 138 56221 0.46% 139 58241 0.48% 140 60746 0.50% 141 64659 0.53% 142 69926 0.57% 143 76588 0.63% 144 87604 0.72% 145 102598 0.84% 146 123910 1.02% 147 163013 1.34% 148 240024 1.97% 149 478464 3.93% 150 2613277 21.48% 151 6583768 54.12% 12165369 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=39 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=306.03 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.5 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=32 prefix-density=0.28 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=213.37 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=24.3 sequence=GAAGAAGAAGAAA SRR7169916 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 02:48:53 Started mapping on | Feb 12 02:48:53 Finished on | Feb 12 02:49:54 Mapping speed, Million of reads per hour | 717.96 Number of input reads | 12165369 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11657120 Uniquely mapped reads % | 95.82% Average mapped length | 292.20 Number of splices: Total | 10575204 Number of splices: Annotated (sjdb) | 10390860 Number of splices: GT/AG | 10417425 Number of splices: GC/AG | 124195 Number of splices: AT/AC | 8906 Number of splices: Non-canonical | 24678 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 212553 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 11981 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 306356 306356 306356 N_multimapping 212553 212553 212553 N_noFeature 324285 11529470 375376 N_ambiguous 124622 655 47593 UnstrandedReadsAssigned:11208213 PositiveStrandReadsAssigned:126995 NegativeStrandReadsAssigned:11234151 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169916 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169916-trimmed-pair1.fastq SRR7169916-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,165,369 reads, 11,170,345 reads pseudoaligned [quant] estimated average fragment length: 225.836 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7169916.ke.tsv 34699 SRR7169916.se.tsv 87100 total ==> SRR7169916.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.16 200 10.3612 Potri.005G024800.1.v4.1 1035 810.164 36 4.12792 Potri.004G059700.1.v4.1 961 736.175 2 0.252378 Potri.007G009000.2.v4.1 1416 1191.16 0 0 Potri.003G141000.2.v4.1 2943 2718.16 234.033 7.99839 Potri.016G087400.1.v4.1 270 88.8131 1074 1123.39 Potri.015G069301.1.v4.1 564 342.597 0 0 Potri.010G195200.1.v4.1 1773 1548.16 16 0.960074 Potri.012G127500.1.v4.1 977 752.17 4162 514.03 ==> SRR7169916.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 998 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 191 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169916 completed mapping pipeline successfully