Starting /dee2/code/volunteer_pipeline.sh SRR7169929 current disk space = 3048964784128 free memory = 1579204832 SRR7169929 SRAfilesize f85f4531c367739561846a050f403840 SRR7169929.sra SRR7169929.sra file validated SRR7169929 is paired end SRR7169929 is conventional basespace SRR7169929 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5905 34.0 34.0 34.0 33.0 34.0 2 33.675 34.0 34.0 34.0 33.0 34.0 3 33.7385 34.0 34.0 34.0 33.0 34.0 4 33.687 34.0 34.0 34.0 33.0 34.0 5 33.69925 34.0 34.0 34.0 33.0 34.0 6 37.2415 38.0 38.0 38.0 36.0 38.0 7 37.5625 38.0 38.0 38.0 37.0 38.0 8 37.679 38.0 38.0 38.0 38.0 38.0 9 37.71775 38.0 38.0 38.0 38.0 38.0 10-14 37.67895 38.0 38.0 38.0 38.0 38.0 15-19 37.64905 38.0 38.0 38.0 38.0 38.0 20-24 37.60895000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.55024999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.510149999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.3844 38.0 38.0 38.0 37.6 38.0 40-44 37.06105 38.0 38.0 38.0 36.2 38.0 45-49 36.86535 38.0 38.0 38.0 35.6 38.0 50-54 36.8011 38.0 38.0 38.0 35.2 38.0 55-59 36.819750000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.75085 38.0 38.0 38.0 35.0 38.0 65-69 36.6605 38.0 38.0 38.0 34.4 38.0 70-74 36.5614 38.0 38.0 38.0 34.4 38.0 75-79 36.13305 38.0 38.0 38.0 34.0 38.0 80-84 36.0176 38.0 37.8 38.0 33.4 38.0 85-89 35.903600000000004 38.0 37.0 38.0 33.2 38.0 90-94 35.68025 38.0 37.0 38.0 32.2 38.0 95-99 35.5339 38.0 37.0 38.0 31.0 38.0 100-104 35.378550000000004 38.0 37.0 38.0 30.4 38.0 105-109 35.1727 38.0 36.4 38.0 29.0 38.0 110-114 34.90419999999999 38.0 36.0 38.0 28.0 38.0 115-119 34.45459999999999 38.0 35.0 38.0 26.0 38.0 120-124 34.169349999999994 38.0 34.8 38.0 24.0 38.0 125-129 33.87405 38.0 34.8 38.0 23.0 38.0 130-134 33.33255 38.0 34.0 38.0 16.2 38.0 135-139 32.6032 38.0 33.4 38.0 14.8 38.0 140-144 32.04039999999999 37.6 32.6 38.0 14.0 38.0 145-149 30.871099999999995 36.0 31.0 38.0 8.6 38.0 150-151 26.433125 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 2.0 10 1.0 11 1.0 12 4.0 13 2.0 14 3.0 15 5.0 16 7.0 17 9.0 18 14.0 19 27.0 20 8.0 21 10.0 22 11.0 23 15.0 24 15.0 25 18.0 26 20.0 27 26.0 28 31.0 29 37.0 30 40.0 31 57.0 32 90.0 33 117.0 34 219.0 35 413.0 36 1014.0 37 1780.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.27382146439318 15.546639919759278 9.804413239719159 33.37512537612838 2 22.775000000000002 16.725 28.625 31.874999999999996 3 19.425 19.400000000000002 25.874999999999996 35.3 4 21.95 25.025 24.65 28.375 5 23.925 30.25 24.2 21.625 6 21.15 33.925 24.875 20.05 7 13.725000000000001 31.7 37.625 16.950000000000003 8 16.275000000000002 30.125 30.525000000000002 23.075000000000003 9 17.25 28.7 32.4 21.65 10-14 17.785 32.865 27.33 22.02 15-19 19.025 31.41 26.950000000000003 22.615 20-24 19.13 31.69 26.924999999999997 22.255 25-29 19.045 31.355 27.095000000000002 22.505 30-34 18.285 31.745 26.784999999999997 23.185 35-39 19.345000000000002 31.16 26.31 23.185 40-44 18.825 31.064999999999998 27.01 23.1 45-49 19.3 30.595 27.205000000000002 22.900000000000002 50-54 19.38 30.605 26.840000000000003 23.175 55-59 19.045 30.080000000000002 27.29 23.585 60-64 19.055 29.65 27.744999999999997 23.549999999999997 65-69 19.384999999999998 30.654999999999998 26.665 23.294999999999998 70-74 19.545 31.3 26.705000000000002 22.45 75-79 19.27 30.69 26.505000000000003 23.535 80-84 19.814999999999998 30.06 26.35 23.775 85-89 19.395 29.86 26.815 23.93 90-94 19.691892162256792 29.775421397489122 27.21452508377932 23.318161356474768 95-99 19.908959031564205 29.753389025061278 26.792056425391426 23.54559551798309 100-104 18.93 30.935000000000002 26.325 23.810000000000002 105-109 20.044999999999998 30.769999999999996 25.77 23.415 110-114 19.285 30.835 26.424999999999997 23.455000000000002 115-119 19.26096304815241 30.241512075603783 26.421321066053306 24.07620381019051 120-124 19.88997249312328 29.37234308577144 26.736684171042764 24.001000250062514 125-129 20.41 29.82 26.105 23.665 130-134 20.10902180436087 29.675935187037407 25.5251050210042 24.689937987597517 135-139 20.527052705270528 29.937993799379935 25.347534753475347 24.187418741874186 140-144 20.054010802160434 30.236047209441892 25.370074014802963 24.33986797359472 145-149 20.834166833366673 29.140828165633124 26.090218043608722 23.93478695739148 150-151 20.540067508438558 29.316164520565067 25.565695711963997 24.57807225903238 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.5 19 2.0 20 2.0 21 3.0 22 3.0 23 4.5 24 6.0 25 5.0 26 9.5 27 13.5 28 18.0 29 28.0 30 35.0 31 49.0 32 72.0 33 81.5 34 92.5 35 108.0 36 123.0 37 147.0 38 169.0 39 193.0 40 210.0 41 220.0 42 236.5 43 232.0 44 219.0 45 214.5 46 204.0 47 198.0 48 183.5 49 158.5 50 130.5 51 104.0 52 98.0 53 99.5 54 84.0 55 56.5 56 41.5 57 35.5 58 27.0 59 19.5 60 13.0 61 10.5 62 10.0 63 7.5 64 2.5 65 1.0 66 2.0 67 2.5 68 1.5 69 0.5 70 1.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.034999999999999996 95-99 0.045 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.025 125-129 0.0 130-134 0.02 135-139 0.01 140-144 0.02 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6417221937468 96.22500000000001 2 1.1276268580215274 2.1999999999999997 3 0.1537672988211174 0.44999999999999996 4 0.025627883136852894 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025627883136852894 0.22499999999999998 >10 0.025627883136852894 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCATGGCATCTCGTATGC 32 0.8 TruSeq Adapter, Index 12 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCATGGCATCTCGTATGCC 9 0.22499999999999998 TruSeq Adapter, Index 12 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6749999999999998 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.4000000000000004 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.9749999999999996 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.7 0.0 0.0 0.0 0.0 122-123 5.2875 0.0 0.0 0.0 0.0 124-125 5.8375 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.175 0.0 0.0 0.0 0.0 130-131 7.75 0.0 0.0 0.0 0.0 132-133 8.375 0.0 0.0 0.0 0.0 134-135 9.1375 0.0 0.0 0.0 0.0 136-137 9.725 0.0 0.0 0.0 0.0 138-139 10.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATGC 10 0.006830828 145.0 8 GGGAATA 10 0.006830828 145.0 2 TCCAAAC 10 0.006830828 145.0 2 GGGGAAT 10 0.006830828 145.0 1 >>END_MODULE SRR7169929 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.20125 34.0 33.0 34.0 33.0 34.0 2 33.2265 34.0 33.0 34.0 33.0 34.0 3 33.1225 34.0 33.0 34.0 33.0 34.0 4 32.9955 34.0 33.0 34.0 33.0 34.0 5 33.099 34.0 33.0 34.0 33.0 34.0 6 37.20725 38.0 38.0 38.0 38.0 38.0 7 37.266 38.0 38.0 38.0 38.0 38.0 8 37.26325 38.0 38.0 38.0 38.0 38.0 9 37.248 38.0 38.0 38.0 38.0 38.0 10-14 37.1196 38.0 38.0 38.0 38.0 38.0 15-19 37.043899999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.08005 38.0 38.0 38.0 38.0 38.0 25-29 37.05195 38.0 38.0 38.0 38.0 38.0 30-34 37.0277 38.0 38.0 38.0 38.0 38.0 35-39 36.981300000000005 38.0 38.0 38.0 38.0 38.0 40-44 36.937400000000004 38.0 38.0 38.0 37.8 38.0 45-49 36.8145 38.0 38.0 38.0 37.0 38.0 50-54 36.942750000000004 38.0 38.0 38.0 37.2 38.0 55-59 36.921749999999996 38.0 38.0 38.0 37.0 38.0 60-64 36.89540000000001 38.0 38.0 38.0 37.0 38.0 65-69 36.7447 38.0 38.0 38.0 37.0 38.0 70-74 36.424350000000004 38.0 38.0 38.0 36.8 38.0 75-79 36.3394 38.0 38.0 38.0 36.0 38.0 80-84 36.2414 38.0 38.0 38.0 36.0 38.0 85-89 36.04115 38.0 38.0 38.0 35.4 38.0 90-94 35.966750000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.031600000000005 38.0 38.0 38.0 34.8 38.0 100-104 35.9795 38.0 38.0 38.0 34.6 38.0 105-109 35.8853 38.0 38.0 38.0 34.0 38.0 110-114 35.77855 38.0 38.0 38.0 34.0 38.0 115-119 35.490500000000004 38.0 38.0 38.0 32.6 38.0 120-124 35.2582 38.0 37.8 38.0 31.4 38.0 125-129 35.01845 38.0 37.0 38.0 30.6 38.0 130-134 34.2658 38.0 36.2 38.0 24.8 38.0 135-139 33.4034 38.0 35.2 38.0 15.6 38.0 140-144 32.6648 38.0 33.8 38.0 13.2 38.0 145-149 32.13445 38.0 33.0 38.0 6.4 38.0 150-151 28.270125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 22.0 3 20.0 4 6.0 5 5.0 6 1.0 7 2.0 8 1.0 9 2.0 10 0.0 11 3.0 12 5.0 13 2.0 14 5.0 15 8.0 16 8.0 17 26.0 18 9.0 19 1.0 20 3.0 21 4.0 22 6.0 23 11.0 24 9.0 25 13.0 26 10.0 27 15.0 28 22.0 29 30.0 30 31.0 31 50.0 32 72.0 33 111.0 34 101.0 35 184.0 36 454.0 37 2748.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.46446446446446 22.94794794794795 13.78878878878879 23.7987987987988 2 27.55944931163955 28.986232790988737 27.584480600750936 15.869837296620776 3 22.099447513812155 29.58312405826218 28.80462079357107 19.512807634354594 4 25.157549785732293 33.12326695235694 23.46861608268213 18.250567179228636 5 27.00803212851406 35.24096385542169 22.08835341365462 15.66265060240964 6 21.856963613550814 37.340025094102884 24.466750313676286 16.336260978670012 7 22.00200702458605 24.33517310587055 35.02257902659308 18.640240842950327 8 24.9686952166291 26.57150012521913 26.922113698973206 21.537690959178562 9 23.03638644918444 27.076537013801754 28.80803011292346 21.07904642409034 10-14 25.307088199758354 29.203584373741442 25.39770438985099 20.091623036649214 15-19 24.573877962682804 28.229954614220876 27.095310136157337 20.100857286938982 20-24 23.932742650020135 28.705195328231977 26.183044703987115 21.179017317760774 25-29 24.856423173803528 28.16624685138539 27.405541561712848 19.571788413098236 30-34 24.456412321320716 27.75317092812563 27.582041473726594 20.20837527682706 35-39 23.963900373096703 28.01754562871836 27.437733185439146 20.580820812745788 40-44 24.763924657880118 27.894763419683887 27.38978942584457 19.951522496591426 45-49 24.54306775724528 27.516914066444514 27.658285368070285 20.281732808239926 50-54 24.175436829649026 27.579435016868924 28.10816254594894 20.136965607533106 55-59 24.130292503650004 28.228364295423653 28.006846901273725 19.63449629965262 60-64 24.308250592208054 28.85943248828184 27.1004485661005 19.731868353409606 65-69 24.396135265700483 28.10487117552335 27.77777777777778 19.72121578099839 70-74 24.39903846153846 27.974759615384613 27.899639423076923 19.7265625 75-79 24.150716504659787 27.82843972341918 28.39963924240906 19.621204529511978 80-84 23.95131274519666 27.572678804949202 29.116789055427017 19.35921939442712 85-89 24.808754242869448 27.417802320279648 27.95987638684837 19.813567050002533 90-94 24.579704273850517 27.258456552562283 28.55479035851732 19.60704881506988 95-99 23.593812776215348 27.43571715548413 29.444556046605065 19.52591402169546 100-104 24.092757114892336 27.817095818902775 28.504743261556992 19.585403804647893 105-109 24.40592815875408 27.641296156744538 28.641044963576988 19.31173072092439 110-114 24.26166717064812 28.096966031650034 28.228001209555487 19.413365588146355 115-119 24.267656500802566 28.79715088282504 27.673555377207066 19.26163723916533 120-124 23.93569067414605 27.9324852248823 28.638685765801863 19.49313833516979 125-129 24.692980239551222 28.81184616162127 27.624197705564256 18.870975893263253 130-134 25.264665268756715 28.11844729708996 27.872960670996775 18.743926763156548 135-139 25.458977284514056 27.248210766517992 28.549942951975936 18.742868996992012 140-144 25.578480020893185 27.824497257769654 27.526769391486027 19.070253329851138 145-149 25.883491190548934 27.772685609532537 28.083307872492107 18.26051532742642 150-151 26.599369085173503 27.43217665615142 27.293375394321767 18.67507886435331 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 1.5 3 1.5 4 1.0 5 0.5 6 2.5 7 2.0 8 1.0 9 3.0 10 2.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.5 16 1.5 17 2.5 18 1.5 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 2.5 25 3.5 26 3.0 27 4.0 28 7.5 29 9.5 30 8.0 31 13.5 32 24.5 33 33.0 34 40.0 35 59.5 36 81.0 37 99.5 38 139.0 39 171.0 40 203.5 41 243.5 42 251.5 43 262.0 44 268.5 45 267.5 46 280.0 47 256.5 48 211.5 49 188.0 50 168.5 51 149.0 52 124.5 53 96.0 54 81.5 55 61.0 56 39.0 57 27.5 58 21.5 59 18.5 60 13.0 61 8.0 62 6.0 63 5.0 64 4.0 65 4.0 66 3.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.44999999999999996 4 0.8250000000000001 5 0.4 6 0.375 7 0.35000000000000003 8 0.17500000000000002 9 0.375 10-14 0.6799999999999999 15-19 0.8500000000000001 20-24 0.6799999999999999 25-29 0.75 30-34 0.66 35-39 0.83 40-44 0.985 45-49 0.97 50-54 0.705 55-59 0.685 60-64 0.795 65-69 0.64 70-74 0.16 75-79 0.21 80-84 0.59 85-89 1.3050000000000002 90-94 1.26 95-99 0.44 100-104 0.385 105-109 0.475 110-114 0.79 115-119 0.32 120-124 0.16999999999999998 125-129 1.065 130-134 2.235 135-139 3.5900000000000003 140-144 4.275 145-149 1.81 150-151 0.9375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.74712349782664 96.55 2 1.201738685758118 2.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.051137816415239075 1.0999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 31 0.775 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.725 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.4125 0.0 0.0 0.0 0.0 110-111 2.65 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.475 0.0 0.0 0.0 0.0 118-119 3.95 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.225 0.0 0.0 0.0 0.0 124-125 5.725 0.0 0.0 0.0 0.0 126-127 6.3125 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.7125 0.0 0.0 0.0 0.0 132-133 8.425 0.0 0.0 0.0 0.0 134-135 9.225 0.0 0.0 0.0 0.0 136-137 9.75 0.0 0.0 0.0 0.0 138-139 10.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACTCT 10 0.006923209 144.35 3 GAACTGA 10 0.006923209 144.35 3 TACTCTT 10 0.006923209 144.35 4 GTTGAAG 20 3.6524175E-4 108.262505 1 >>END_MODULE Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506739 spots for SRR7169929.sra Written 506739 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra Read 506733 spots for SRR7169929.sra Written 506733 spots for SRR7169929.sra SRR ids: ['SRR7169929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yfjnbkdw SRR7169929.sra spots: 10134666 blocks: [[1, 506733], [506734, 1013466], [1013467, 1520199], [1520200, 2026932], [2026933, 2533665], [2533666, 3040398], [3040399, 3547131], [3547132, 4053864], [4053865, 4560597], [4560598, 5067330], [5067331, 5574063], [5574064, 6080796], [6080797, 6587529], [6587530, 7094262], [7094263, 7600995], [7600996, 8107728], [8107729, 8614461], [8614462, 9121194], [9121195, 9627927], [9627928, 10134666]] SRR7169929 file size 3412605 SRR7169929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169929 SRR7169929_1.fastq SRR7169929_2.fastq Input file: SRR7169929_1.fastq Paired file: SRR7169929_2.fastq trimmed: SRR7169929-trimmed-pair1.fastq, SRR7169929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:48:54 2025 >> started Wed Feb 12 03:49:05 2025 >> done (10.692s) 10134666 read pairs processed; of these: 28330 ( 0.28%) short read pairs filtered out after trimming by size control 107523 ( 1.06%) empty read pairs filtered out after trimming by size control 9998813 (98.66%) read pairs available; of these: 5874282 (58.75%) trimmed read pairs available after processing 4124531 (41.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 7 0.00% 21 12 0.00% 22 11 0.00% 23 11 0.00% 24 10 0.00% 25 12 0.00% 26 14 0.00% 27 16 0.00% 28 10 0.00% 29 17 0.00% 30 24 0.00% 31 30 0.00% 32 25 0.00% 33 26 0.00% 34 30 0.00% 35 52 0.00% 36 21 0.00% 37 40 0.00% 38 33 0.00% 39 44 0.00% 40 41 0.00% 41 71 0.00% 42 74 0.00% 43 72 0.00% 44 81 0.00% 45 110 0.00% 46 116 0.00% 47 109 0.00% 48 127 0.00% 49 171 0.00% 50 162 0.00% 51 206 0.00% 52 274 0.00% 53 283 0.00% 54 244 0.00% 55 261 0.00% 56 280 0.00% 57 272 0.00% 58 354 0.00% 59 354 0.00% 60 341 0.00% 61 383 0.00% 62 475 0.00% 63 531 0.01% 64 663 0.01% 65 827 0.01% 66 1341 0.01% 67 2495 0.02% 68 3055 0.03% 69 5370 0.05% 70 8578 0.09% 71 4799 0.05% 72 3106 0.03% 73 2580 0.03% 74 2259 0.02% 75 2318 0.02% 76 2272 0.02% 77 2313 0.02% 78 2364 0.02% 79 2539 0.03% 80 2746 0.03% 81 3134 0.03% 82 3632 0.04% 83 4239 0.04% 84 5400 0.05% 85 6361 0.06% 86 6845 0.07% 87 7141 0.07% 88 7687 0.08% 89 8533 0.09% 90 8968 0.09% 91 9124 0.09% 92 9830 0.10% 93 10517 0.11% 94 11194 0.11% 95 12113 0.12% 96 12664 0.13% 97 13315 0.13% 98 13575 0.14% 99 14087 0.14% 100 15034 0.15% 101 15711 0.16% 102 16879 0.17% 103 17350 0.17% 104 18623 0.19% 105 19808 0.20% 106 20440 0.20% 107 21292 0.21% 108 22310 0.22% 109 23025 0.23% 110 23177 0.23% 111 23873 0.24% 112 24923 0.25% 113 25942 0.26% 114 26749 0.27% 115 28520 0.29% 116 29744 0.30% 117 30337 0.30% 118 31201 0.31% 119 31529 0.32% 120 32350 0.32% 121 33036 0.33% 122 34258 0.34% 123 35936 0.36% 124 37676 0.38% 125 38317 0.38% 126 40474 0.40% 127 41966 0.42% 128 43198 0.43% 129 44343 0.44% 130 45898 0.46% 131 47204 0.47% 132 49534 0.50% 133 51821 0.52% 134 53999 0.54% 135 56818 0.57% 136 59819 0.60% 137 63337 0.63% 138 66736 0.67% 139 72132 0.72% 140 75149 0.75% 141 80981 0.81% 142 87084 0.87% 143 97151 0.97% 144 109377 1.09% 145 126563 1.27% 146 155603 1.56% 147 210914 2.11% 148 308867 3.09% 149 577338 5.77% 150 2406096 24.06% 151 4124531 41.25% 9998813 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.6 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=325.18 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=24.2 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCCTGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.06 fanout-score-rank=25 prefix-density=0.47 prefix-fanout=3.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=309.90 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=25.8 sequence=AAGAAGAAGAAA SRR7169929 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:49:51 Started mapping on | Feb 12 03:49:52 Finished on | Feb 12 03:50:59 Mapping speed, Million of reads per hour | 537.25 Number of input reads | 9998813 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 9333423 Uniquely mapped reads % | 93.35% Average mapped length | 289.76 Number of splices: Total | 7012182 Number of splices: Annotated (sjdb) | 6861383 Number of splices: GT/AG | 6891831 Number of splices: GC/AG | 90575 Number of splices: AT/AC | 6533 Number of splices: Non-canonical | 23243 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.71 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 191350 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 20765 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.46% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 492742 492742 492742 N_multimapping 191350 191350 191350 N_noFeature 242962 9184853 319214 N_ambiguous 111958 887 39018 UnstrandedReadsAssigned:8978503 PositiveStrandReadsAssigned:147683 NegativeStrandReadsAssigned:8975191 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169929-trimmed-pair1.fastq SRR7169929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,998,813 reads, 8,981,437 reads pseudoaligned [quant] estimated average fragment length: 213.155 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR7169929.ke.tsv 34699 SRR7169929.se.tsv 87100 total ==> SRR7169929.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.85 147 7.66914 Potri.005G024800.1.v4.1 1035 822.845 62 7.09878 Potri.004G059700.1.v4.1 961 748.859 4 0.503234 Potri.007G009000.2.v4.1 1416 1203.85 0 0 Potri.003G141000.2.v4.1 2943 2730.85 192 6.6239 Potri.016G087400.1.v4.1 270 87.8918 1117 1197.33 Potri.015G069301.1.v4.1 564 353.246 0 0 Potri.010G195200.1.v4.1 1773 1560.85 34 2.05224 Potri.012G127500.1.v4.1 977 764.859 6726 828.487 ==> SRR7169929.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 581 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 369 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169929 completed mapping pipeline successfully