Starting /dee2/code/volunteer_pipeline.sh SRR7169930 current disk space = 3049009090560 free memory = 1579162704 SRR7169930 SRAfilesize 8500c2c2e476f9f5f170aa7357f129cb SRR7169930.sra SRR7169930.sra file validated SRR7169930 is paired end SRR7169930 is conventional basespace SRR7169930 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7775 34.0 33.0 34.0 33.0 34.0 2 33.39525 34.0 34.0 34.0 33.0 34.0 3 33.51875 34.0 34.0 34.0 33.0 34.0 4 33.55225 34.0 34.0 34.0 33.0 34.0 5 33.44525 34.0 34.0 34.0 33.0 34.0 6 37.19025 38.0 38.0 38.0 36.0 38.0 7 37.4935 38.0 38.0 38.0 37.0 38.0 8 37.56175 38.0 38.0 38.0 38.0 38.0 9 37.59425 38.0 38.0 38.0 38.0 38.0 10-14 37.575149999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.60965 38.0 38.0 38.0 38.0 38.0 20-24 37.52505 38.0 38.0 38.0 38.0 38.0 25-29 37.4445 38.0 38.0 38.0 38.0 38.0 30-34 37.4683 38.0 38.0 38.0 38.0 38.0 35-39 37.3117 38.0 38.0 38.0 37.4 38.0 40-44 37.06825 38.0 38.0 38.0 36.4 38.0 45-49 37.02455 38.0 38.0 38.0 36.0 38.0 50-54 37.08085 38.0 38.0 38.0 36.0 38.0 55-59 36.98355 38.0 38.0 38.0 36.0 38.0 60-64 36.9221 38.0 38.0 38.0 36.0 38.0 65-69 36.8663 38.0 38.0 38.0 35.8 38.0 70-74 36.63244999999999 38.0 38.0 38.0 35.2 38.0 75-79 35.7602 38.0 38.0 38.0 33.0 38.0 80-84 35.51135 38.0 38.0 38.0 32.0 38.0 85-89 35.46005 38.0 38.0 38.0 32.0 38.0 90-94 35.193799999999996 38.0 37.8 38.0 30.4 38.0 95-99 35.112700000000004 38.0 37.6 38.0 30.0 38.0 100-104 34.86245 38.0 37.0 38.0 27.4 38.0 105-109 34.7039 38.0 36.8 38.0 26.8 38.0 110-114 34.49025 38.0 36.2 38.0 25.6 38.0 115-119 34.2649 38.0 36.2 38.0 23.2 38.0 120-124 34.303700000000006 38.0 36.0 38.0 24.0 38.0 125-129 33.9637 38.0 35.6 38.0 20.0 38.0 130-134 33.403949999999995 38.0 35.0 38.0 15.0 38.0 135-139 32.540549999999996 38.0 33.8 38.0 14.0 38.0 140-144 32.394200000000005 38.0 34.0 38.0 13.8 38.0 145-149 31.65845 38.0 33.4 38.0 6.4 38.0 150-151 26.948500000000003 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 3.0 12 6.0 13 2.0 14 2.0 15 5.0 16 4.0 17 8.0 18 38.0 19 67.0 20 20.0 21 15.0 22 10.0 23 21.0 24 16.0 25 17.0 26 33.0 27 25.0 28 36.0 29 46.0 30 50.0 31 49.0 32 58.0 33 102.0 34 138.0 35 217.0 36 653.0 37 2357.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.4359171143515 14.607316449219748 9.951394218470197 31.005372217958556 2 23.799999999999997 17.125 30.175 28.9 3 19.375 19.75 28.425 32.45 4 21.025 25.624999999999996 23.7 29.65 5 24.6 30.85 22.625 21.925 6 22.125 32.550000000000004 25.924999999999997 19.400000000000002 7 15.2 29.95 38.074999999999996 16.775000000000002 8 16.1 31.324999999999996 29.475 23.1 9 17.825 26.125 33.725 22.325 10-14 18.825 31.7 26.06 23.415 15-19 19.009999999999998 29.995 27.08 23.915 20-24 19.18 30.764999999999997 26.790000000000003 23.265 25-29 19.435 29.895 27.134999999999998 23.535 30-34 18.78 29.975 27.315 23.93 35-39 19.29 29.895 27.18 23.635 40-44 19.470000000000002 29.43 27.455000000000002 23.645 45-49 20.599269671352108 29.258166174778648 27.55239857936071 22.59016557450853 50-54 19.96 28.345 27.11 24.585 55-59 19.455 28.62 27.82 24.104999999999997 60-64 19.865 28.84 27.474999999999998 23.82 65-69 19.645000000000003 30.755 26.32 23.28 70-74 19.335 31.615 26.455000000000002 22.595000000000002 75-79 19.255 30.880000000000003 25.85 24.015 80-84 20.03 29.785 26.765 23.419999999999998 85-89 20.855240098142307 28.84682790045566 26.573531620850233 23.7244003805518 90-94 19.99094521857236 29.317370089038686 26.23371396951557 24.457970722873384 95-99 20.073451728127985 29.078834834230516 26.860190169542687 23.987523268098805 100-104 20.39937941043992 29.763275111355785 26.284970722186074 23.552374756018217 105-109 20.366018300915044 30.641532076603827 25.52127606380319 23.471173558677936 110-114 20.335 29.87 25.945 23.849999999999998 115-119 21.171058552927647 30.16150807540377 25.37626881344067 23.291164558227912 120-124 21.015 29.21 25.955000000000002 23.82 125-129 20.354070814162835 29.000800160032007 26.205241048209643 24.43988797759552 130-134 20.473544576262704 29.39880862992441 26.07999199078941 24.047654803023477 135-139 20.611568588069893 29.45370556336614 25.51717212291625 24.41755372564772 140-144 20.694659926930584 29.583103948751315 25.46419098143236 24.25804514288574 145-149 20.875050060072088 29.685622747296758 25.740889066880257 23.6984381257509 150-151 20.2875 29.4 25.95 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.0 18 1.5 19 1.5 20 0.5 21 0.0 22 2.0 23 2.5 24 0.5 25 2.0 26 4.5 27 6.5 28 16.5 29 20.5 30 24.0 31 37.0 32 44.5 33 55.5 34 77.5 35 91.0 36 106.5 37 124.5 38 143.5 39 178.0 40 192.0 41 203.5 42 235.0 43 238.0 44 230.5 45 244.0 46 243.5 47 236.5 48 228.5 49 198.0 50 162.0 51 135.0 52 114.0 53 97.0 54 76.5 55 58.5 56 37.5 57 24.5 58 23.5 59 24.0 60 19.5 61 10.5 62 7.5 63 4.0 64 2.5 65 2.0 66 2.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.145 90-94 0.605 95-99 0.615 100-104 0.095 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.02 130-134 0.11499999999999999 135-139 0.42 140-144 0.095 145-149 0.12 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80643487285937 95.19999999999999 2 1.1157239231966787 2.15 3 0.02594706798131811 0.075 4 0.02594706798131811 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02594706798131811 2.475 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATCGATCTCGTATGC 99 2.475 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.275 0.0 0.0 0.0 0.0 30-31 0.275 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.2875 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.325 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.7999999999999998 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.4 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.2125000000000004 0.0 0.0 0.0 0.0 110-111 3.7375 0.0 0.0 0.0 0.0 112-113 4.199999999999999 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.175 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 8.0125 0.0 0.0 0.0 0.0 128-129 8.575 0.0 0.0 0.0 0.0 130-131 9.087499999999999 0.0 0.0 0.0 0.0 132-133 9.625 0.0 0.0 0.0 0.0 134-135 10.3125 0.0 0.0 0.0 0.0 136-137 10.9125 0.0 0.0 0.0 0.0 138-139 11.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAGA 10 0.006832588 144.9875 5 >>END_MODULE SRR7169930 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7915 33.0 33.0 34.0 32.0 34.0 2 32.13575 34.0 33.0 34.0 31.0 34.0 3 32.14375 34.0 33.0 34.0 32.0 34.0 4 32.02725 34.0 33.0 34.0 32.0 34.0 5 31.90825 34.0 33.0 34.0 32.0 34.0 6 36.0095 38.0 38.0 38.0 35.0 38.0 7 36.059 38.0 38.0 38.0 35.0 38.0 8 36.0845 38.0 38.0 38.0 36.0 38.0 9 36.09175 38.0 38.0 38.0 36.0 38.0 10-14 36.04430000000001 38.0 38.0 38.0 35.8 38.0 15-19 35.9141 38.0 38.0 38.0 36.0 38.0 20-24 35.9731 38.0 38.0 38.0 35.8 38.0 25-29 36.13625 38.0 38.0 38.0 36.0 38.0 30-34 36.158699999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.001050000000006 38.0 38.0 38.0 36.0 38.0 40-44 35.888600000000004 38.0 38.0 38.0 35.6 38.0 45-49 35.6995 38.0 38.0 38.0 34.4 38.0 50-54 35.9168 38.0 38.0 38.0 34.8 38.0 55-59 35.9111 38.0 38.0 38.0 35.2 38.0 60-64 35.888 38.0 38.0 38.0 35.0 38.0 65-69 35.60245 38.0 38.0 38.0 33.8 38.0 70-74 35.07725000000001 38.0 38.0 38.0 31.4 38.0 75-79 34.91485 38.0 38.0 38.0 29.4 38.0 80-84 34.82619999999999 38.0 38.0 38.0 28.8 38.0 85-89 34.4421 38.0 38.0 38.0 24.0 38.0 90-94 34.05105 38.0 38.0 38.0 16.6 38.0 95-99 34.432649999999995 38.0 38.0 38.0 24.0 38.0 100-104 34.584 38.0 38.0 38.0 27.4 38.0 105-109 34.4907 38.0 38.0 38.0 26.4 38.0 110-114 34.2762 38.0 38.0 38.0 23.0 38.0 115-119 34.142250000000004 38.0 37.0 38.0 22.2 38.0 120-124 33.98479999999999 38.0 36.8 38.0 18.2 38.0 125-129 33.540150000000004 38.0 36.2 38.0 16.8 38.0 130-134 32.2966 38.0 35.0 38.0 2.0 38.0 135-139 31.363849999999996 38.0 34.0 38.0 2.0 38.0 140-144 30.57525 38.0 32.8 38.0 2.0 38.0 145-149 29.770249999999997 38.0 30.6 38.0 2.0 38.0 150-151 26.169 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 120.0 3 3.0 4 0.0 5 0.0 6 1.0 7 2.0 8 0.0 9 3.0 10 1.0 11 4.0 12 5.0 13 5.0 14 5.0 15 12.0 16 15.0 17 72.0 18 14.0 19 22.0 20 12.0 21 13.0 22 19.0 23 16.0 24 11.0 25 17.0 26 28.0 27 25.0 28 27.0 29 34.0 30 46.0 31 54.0 32 88.0 33 118.0 34 138.0 35 139.0 36 392.0 37 2539.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.29670044167316 21.070407898155366 13.535983372304495 23.09690828786698 2 26.477301547045396 29.495308141009385 26.274410347451177 17.75297996449404 3 21.016343207354442 28.728294177732376 32.20122574055158 18.054136874361593 4 23.929860752965446 31.691593604951006 23.41413099535843 20.964414646725118 5 26.945020746887966 34.88070539419087 21.550829875518673 16.62344398340249 6 24.374516378643282 36.23936033015218 23.18803198349239 16.198091307712147 7 21.536879979439732 23.95271138524801 37.05988177846312 17.450526856849137 8 23.310203032639425 28.218966846569003 25.49473143150861 22.97609868928296 9 24.34648898001025 26.65299846232701 27.678113787801127 21.322398769861607 10-14 24.914974750077295 28.022261156343397 25.754921158404613 21.30784293517469 15-19 24.729848508350134 27.159919342329765 27.780362959516054 20.329869189804043 20-24 24.98969497114592 28.02967848309975 26.246908491343774 20.733718054410552 25-29 24.56500538931376 28.624955089051994 26.535954421803627 20.27408509983062 30-34 24.211498025539772 28.057849120467715 27.786040309759475 19.94461254423304 35-39 24.125694301584037 27.08290475210862 27.525200576013166 21.26620037029418 40-44 25.768773580029976 26.93162437335263 27.200372112253863 20.09922993436353 45-49 24.25888561229241 26.778415851828857 27.306120337316987 21.656578198561746 50-54 23.732908399300914 27.104965559782052 28.69846818135088 20.463657859566155 55-59 23.45228301110654 27.92575071986837 28.321678321678323 20.30028794734677 60-64 23.66133429350342 29.51494264698318 26.814464276528987 20.009258782984414 65-69 23.105730262145386 29.487508336325863 27.122556815267018 20.284204586261733 70-74 23.50988303794882 29.592931201797846 26.707186271004645 20.189999489248684 75-79 24.03334697217676 28.590425531914892 27.00490998363339 20.37131751227496 80-84 24.48582830246598 28.650363245676864 27.14110303898496 19.722705412872198 85-89 24.26730409478279 28.35169403450426 27.400748285179798 19.980253585533152 90-94 24.327865415858707 27.881138305120277 27.81824851946963 19.97274775955139 95-99 24.305555555555554 28.636831275720166 27.762345679012345 19.295267489711936 100-104 24.298011887681902 27.946300471408076 27.69522443123591 20.060463209674115 105-109 24.43645699614891 28.09242618741977 27.60975609756098 19.861360718870348 110-114 24.646620406065278 28.398869185299407 27.16525314829093 19.789257260344385 115-119 24.497725065180717 28.10183528449466 27.897346761413015 19.50309288891161 120-124 24.522438999541542 28.256329275126074 27.532983546431666 19.688248178900718 125-129 24.912135621252844 28.333677899524503 27.299979326028527 19.45420715319413 130-134 24.996010426086492 28.384488536624286 27.182296930687805 19.437204106601417 135-139 25.67245119305857 27.885032537960953 27.304772234273315 19.137744034707158 140-144 26.031169117242136 27.396883088275786 27.435431466490446 19.13651632799163 145-149 26.199851016281794 27.636479727572627 26.85431520698095 19.309354049164625 150-151 25.88661661920787 28.19052549831737 26.960911208904996 18.961946673569766 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 67.0 1 41.0 2 8.5 3 2.5 4 2.5 5 3.0 6 2.5 7 1.0 8 1.5 9 1.0 10 0.5 11 1.5 12 1.5 13 0.5 14 1.5 15 1.5 16 1.0 17 1.5 18 1.0 19 1.5 20 1.0 21 0.0 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 5.0 28 9.5 29 12.5 30 10.5 31 12.5 32 18.0 33 24.0 34 39.0 35 53.5 36 74.5 37 101.0 38 117.5 39 141.5 40 171.0 41 224.0 42 263.5 43 271.5 44 267.0 45 272.0 46 277.0 47 249.5 48 230.0 49 198.5 50 169.5 51 149.5 52 128.5 53 108.0 54 76.5 55 54.5 56 40.0 57 31.5 58 20.5 59 11.5 60 12.0 61 10.0 62 5.5 63 2.5 64 2.5 65 3.0 66 2.5 67 2.0 68 2.5 69 2.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.775 2 1.425 3 2.1 4 3.05 5 3.5999999999999996 6 3.075 7 2.725 8 2.725 9 2.45 10-14 2.97 15-19 3.295 20-24 2.96 25-29 2.585 30-34 2.505 35-39 2.78 40-44 3.2550000000000003 45-49 3.3550000000000004 50-54 2.73 55-59 2.76 60-64 2.795 65-69 2.535 70-74 2.105 75-79 2.2399999999999998 80-84 2.27 85-89 3.7800000000000002 90-94 4.595 95-99 2.8000000000000003 100-104 2.42 105-109 2.625 110-114 2.725 115-119 2.1950000000000003 120-124 1.8450000000000002 125-129 3.26 130-134 6.005 135-139 7.8 140-144 9.205 145-149 6.03 150-151 3.4250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.99656720359124 93.72500000000001 2 0.7393715341959335 1.4000000000000001 3 0.1320306311064167 0.375 4 0.0 0.0 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.026406126221283337 0.2 9 0.0 0.0 >10 0.026406126221283337 0.25 >50 0.052812252442566675 3.9 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 99 2.475 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 57 1.425 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.25 0.0 0.0 0.0 0.0 7 0.25 0.0 0.0 0.0 0.0 8 0.25 0.0 0.0 0.0 0.0 9 0.25 0.0 0.0 0.0 0.0 10-11 0.25 0.0 0.0 0.0 0.0 12-13 0.275 0.0 0.0 0.0 0.0 14-15 0.275 0.0 0.0 0.0 0.0 16-17 0.275 0.0 0.0 0.0 0.0 18-19 0.275 0.0 0.0 0.0 0.0 20-21 0.275 0.0 0.0 0.0 0.0 22-23 0.275 0.0 0.0 0.0 0.0 24-25 0.275 0.0 0.0 0.0 0.0 26-27 0.275 0.0 0.0 0.0 0.0 28-29 0.275 0.0 0.0 0.0 0.0 30-31 0.275 0.0 0.0 0.0 0.0 32-33 0.275 0.0 0.0 0.0 0.0 34-35 0.275 0.0 0.0 0.0 0.0 36-37 0.275 0.0 0.0 0.0 0.0 38-39 0.275 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.2875 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.325 0.0 0.0 0.0 0.0 66-67 0.325 0.0 0.0 0.0 0.0 68-69 0.35 0.0 0.0 0.0 0.0 70-71 0.35 0.0 0.0 0.0 0.0 72-73 0.35 0.0 0.0 0.0 0.0 74-75 0.35 0.0 0.0 0.0 0.0 76-77 0.3875 0.0 0.0 0.0 0.0 78-79 0.4375 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.8250000000000002 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.7875 0.0 0.0 0.0 0.0 112-113 4.25 0.0 0.0 0.0 0.0 114-115 4.699999999999999 0.0 0.0 0.0 0.0 116-117 5.237500000000001 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.725 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.5 0.0 0.0 0.0 0.0 130-131 8.962499999999999 0.0 0.0 0.0 0.0 132-133 9.4 0.0 0.0 0.0 0.0 134-135 10.075 0.0 0.0 0.0 0.0 136-137 10.600000000000001 0.0 0.0 0.0 0.0 138-139 11.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726644 spots for SRR7169930.sra Written 726644 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra Read 726636 spots for SRR7169930.sra Written 726636 spots for SRR7169930.sra SRR ids: ['SRR7169930.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkpncfy0 SRR7169930.sra spots: 14532728 blocks: [[1, 726636], [726637, 1453272], [1453273, 2179908], [2179909, 2906544], [2906545, 3633180], [3633181, 4359816], [4359817, 5086452], [5086453, 5813088], [5813089, 6539724], [6539725, 7266360], [7266361, 7992996], [7992997, 8719632], [8719633, 9446268], [9446269, 10172904], [10172905, 10899540], [10899541, 11626176], [11626177, 12352812], [12352813, 13079448], [13079449, 13806084], [13806085, 14532728]] SRR7169930 file size 4902964 SRR7169930 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169930 SRR7169930_1.fastq SRR7169930_2.fastq Input file: SRR7169930_1.fastq Paired file: SRR7169930_2.fastq trimmed: SRR7169930-trimmed-pair1.fastq, SRR7169930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:41:12 2025 >> started Wed Feb 12 03:41:28 2025 >> done (15.883s) 14532728 read pairs processed; of these: 60291 ( 0.41%) short read pairs filtered out after trimming by size control 387615 ( 2.67%) empty read pairs filtered out after trimming by size control 14084822 (96.92%) read pairs available; of these: 7494248 (53.21%) trimmed read pairs available after processing 6590574 (46.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 51 0.00% 19 28 0.00% 20 14 0.00% 21 20 0.00% 22 48 0.00% 23 60 0.00% 24 35 0.00% 25 20 0.00% 26 12 0.00% 27 20 0.00% 28 35 0.00% 29 21 0.00% 30 23 0.00% 31 34 0.00% 32 24 0.00% 33 30 0.00% 34 25 0.00% 35 40 0.00% 36 38 0.00% 37 40 0.00% 38 56 0.00% 39 68 0.00% 40 79 0.00% 41 79 0.00% 42 81 0.00% 43 114 0.00% 44 128 0.00% 45 144 0.00% 46 184 0.00% 47 231 0.00% 48 193 0.00% 49 240 0.00% 50 253 0.00% 51 274 0.00% 52 353 0.00% 53 317 0.00% 54 398 0.00% 55 363 0.00% 56 394 0.00% 57 454 0.00% 58 542 0.00% 59 584 0.00% 60 660 0.00% 61 716 0.01% 62 863 0.01% 63 1419 0.01% 64 1112 0.01% 65 1124 0.01% 66 1300 0.01% 67 1487 0.01% 68 1641 0.01% 69 2779 0.02% 70 4503 0.03% 71 3426 0.02% 72 2817 0.02% 73 2920 0.02% 74 3033 0.02% 75 3213 0.02% 76 3452 0.02% 77 3699 0.03% 78 3966 0.03% 79 4377 0.03% 80 4931 0.04% 81 5630 0.04% 82 6312 0.04% 83 7023 0.05% 84 8810 0.06% 85 10086 0.07% 86 10879 0.08% 87 11714 0.08% 88 12483 0.09% 89 12916 0.09% 90 13785 0.10% 91 14264 0.10% 92 15534 0.11% 93 16471 0.12% 94 18320 0.13% 95 19027 0.14% 96 20130 0.14% 97 20630 0.15% 98 21345 0.15% 99 21869 0.16% 100 23196 0.16% 101 23357 0.17% 102 25277 0.18% 103 26804 0.19% 104 28575 0.20% 105 30344 0.22% 106 31027 0.22% 107 31573 0.22% 108 32211 0.23% 109 33095 0.23% 110 34309 0.24% 111 35190 0.25% 112 36879 0.26% 113 38916 0.28% 114 40834 0.29% 115 42096 0.30% 116 43214 0.31% 117 43973 0.31% 118 44223 0.31% 119 44158 0.31% 120 45630 0.32% 121 46655 0.33% 122 47961 0.34% 123 50262 0.36% 124 53030 0.38% 125 53830 0.38% 126 56086 0.40% 127 57561 0.41% 128 58847 0.42% 129 59760 0.42% 130 61639 0.44% 131 62509 0.44% 132 65393 0.46% 133 68030 0.48% 134 71578 0.51% 135 75083 0.53% 136 78298 0.56% 137 82028 0.58% 138 87665 0.62% 139 91749 0.65% 140 96581 0.69% 141 102228 0.73% 142 109930 0.78% 143 119618 0.85% 144 131967 0.94% 145 151957 1.08% 146 181774 1.29% 147 235763 1.67% 148 324398 2.30% 149 607240 4.31% 150 3143134 22.32% 151 6590574 46.79% 14084822 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=33 fanout-score=129.48 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=12.5 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=3.4 sequence=CAGCACCAGCACCTGAAAAGCCAAAGAAGAGATCCAAAGCTGCAGCGAGTCCAGAATCTCCTGCGGATACTTCTGGGGCAGTAAGCTTTACTGTTCTGAACAATGTTGTGTTCTTTGGAGTTTGCATGGTTGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=55.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=9.5 sequence=TTGAAAAATTAGCGGATGACTTGTGGCTGGGGGTGAAAGGCCAATCAAACCGGGAGATAGCTGGTTCTCCCCGAAAGCTATTTAGGTAGCGCCTCGTGAATTCATCTCCGGGGGTAGAGCACTGTTTCGGCAAGGGGGTCATCCCGACTTACCAACCCGATGCAAACTGCGAATACCGGAGAATGTTATCACGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAGAGGGAAACAACCCAGACCGCCAGCTAAGGTCCCAAAGTCATGGTTAAGTGGGAAACGATGTGGGAAGGCCCAGACAGCCAGGATGTTGGCTTAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAAACCATGCACCGAAGCTGCGGCAGCGACGCTTATGCGTTGTTGGGTAGGGGAGCGTTCTGTAAGCCTGCGAAGGTGTGCTGTGAGGCATGCTGGAGGTATCAGAAGTGCGAATG SRR7169930 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:42:10 Started mapping on | Feb 12 03:42:11 Finished on | Feb 12 03:44:08 Mapping speed, Million of reads per hour | 433.38 Number of input reads | 14084822 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12991617 Uniquely mapped reads % | 92.24% Average mapped length | 289.67 Number of splices: Total | 10886520 Number of splices: Annotated (sjdb) | 10679129 Number of splices: GT/AG | 10725179 Number of splices: GC/AG | 126184 Number of splices: AT/AC | 9262 Number of splices: Non-canonical | 25895 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 235034 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 26052 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.85% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 879691 879691 879691 N_multimapping 235034 235034 235034 N_noFeature 296699 12801631 378021 N_ambiguous 160755 727 51703 UnstrandedReadsAssigned:12534163 PositiveStrandReadsAssigned:189259 NegativeStrandReadsAssigned:12561893 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169930-trimmed-pair1.fastq SRR7169930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,084,822 reads, 12,550,571 reads pseudoaligned [quant] estimated average fragment length: 213.836 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR7169930.ke.tsv 34699 SRR7169930.se.tsv 87100 total ==> SRR7169930.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.16 217 8.47461 Potri.005G024800.1.v4.1 1035 822.164 30 2.57241 Potri.004G059700.1.v4.1 961 748.176 4 0.376906 Potri.007G009000.2.v4.1 1416 1203.16 0 0 Potri.003G141000.2.v4.1 2943 2730.16 175 4.51883 Potri.016G087400.1.v4.1 270 91.269 1510 1166.35 Potri.015G069301.1.v4.1 564 353.163 0 0 Potri.010G195200.1.v4.1 1773 1560.16 25 1.12966 Potri.012G127500.1.v4.1 977 764.176 6040 557.211 ==> SRR7169930.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1303 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169930 completed mapping pipeline successfully