Starting /dee2/code/volunteer_pipeline.sh SRR7169931 current disk space = 3048888844288 free memory = 873179240 SRR7169931 SRAfilesize 33534ad7a316c12b26f33b5e8cc69be5 SRR7169931.sra SRR7169931.sra file validated SRR7169931 is paired end SRR7169931 is conventional basespace SRR7169931 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169931_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26675 34.0 34.0 34.0 33.0 34.0 2 33.51325 34.0 34.0 34.0 33.0 34.0 3 33.57825 34.0 34.0 34.0 33.0 34.0 4 33.54825 34.0 34.0 34.0 33.0 34.0 5 33.51175 34.0 34.0 34.0 33.0 34.0 6 37.20975 38.0 38.0 38.0 36.0 38.0 7 37.4975 38.0 38.0 38.0 37.0 38.0 8 37.57925 38.0 38.0 38.0 38.0 38.0 9 37.65525 38.0 38.0 38.0 38.0 38.0 10-14 37.5659 38.0 38.0 38.0 38.0 38.0 15-19 37.58835 38.0 38.0 38.0 38.0 38.0 20-24 37.542500000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.500350000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.48535 38.0 38.0 38.0 38.0 38.0 35-39 37.39835000000001 38.0 38.0 38.0 37.6 38.0 40-44 37.2547 38.0 38.0 38.0 37.0 38.0 45-49 37.236650000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.212199999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.156000000000006 38.0 38.0 38.0 36.6 38.0 60-64 37.14765 38.0 38.0 38.0 36.8 38.0 65-69 37.1004 38.0 38.0 38.0 36.4 38.0 70-74 36.98795 38.0 38.0 38.0 36.0 38.0 75-79 36.62155 38.0 38.0 38.0 35.6 38.0 80-84 36.576 38.0 38.0 38.0 35.6 38.0 85-89 36.48864999999999 38.0 38.0 38.0 35.2 38.0 90-94 36.385149999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.217600000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.2161 38.0 38.0 38.0 34.0 38.0 105-109 36.0663 38.0 38.0 38.0 34.0 38.0 110-114 35.81945 38.0 38.0 38.0 33.2 38.0 115-119 35.642 38.0 37.4 38.0 32.0 38.0 120-124 35.5031 38.0 37.0 38.0 31.6 38.0 125-129 35.1954 38.0 36.4 38.0 29.2 38.0 130-134 34.901199999999996 38.0 36.0 38.0 28.2 38.0 135-139 34.64135 38.0 35.8 38.0 27.4 38.0 140-144 34.27935 38.0 35.0 38.0 25.4 38.0 145-149 33.679649999999995 38.0 35.0 38.0 21.4 38.0 150-151 30.424625 36.5 29.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 9.0 14 3.0 15 5.0 16 3.0 17 5.0 18 15.0 19 20.0 20 1.0 21 5.0 22 9.0 23 7.0 24 10.0 25 15.0 26 13.0 27 18.0 28 32.0 29 29.0 30 45.0 31 36.0 32 53.0 33 83.0 34 132.0 35 205.0 36 501.0 37 2742.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.38444051528163 14.195503915130084 11.214953271028037 32.20510229856024 2 22.425 16.325 30.4 30.85 3 19.900000000000002 20.05 26.6 33.45 4 21.975 25.174999999999997 23.425 29.425 5 22.25 29.975 24.725 23.05 6 19.650000000000002 33.725 26.174999999999997 20.45 7 15.15 30.4 37.65 16.8 8 17.424999999999997 28.499999999999996 31.1 22.975 9 17.075000000000003 27.900000000000002 33.125 21.9 10-14 18.545 31.645 27.38 22.43 15-19 18.66 30.185000000000002 28.365000000000002 22.79 20-24 19.08 31.035 27.24 22.645 25-29 18.86 29.92 27.589999999999996 23.630000000000003 30-34 18.525 31.385 26.99 23.1 35-39 19.115 30.695 26.915 23.275000000000002 40-44 19.16 30.73 26.740000000000002 23.369999999999997 45-49 19.32886577315463 29.590918183636727 27.835567113422684 23.244648929785956 50-54 19.025 29.48 27.725 23.77 55-59 19.355 30.42 26.915 23.31 60-64 18.955 30.294999999999998 27.36 23.39 65-69 18.805 30.520000000000003 27.195000000000004 23.48 70-74 19.634999999999998 30.049999999999997 27.634999999999998 22.68 75-79 19.215 29.935000000000002 27.065 23.785 80-84 19.375 29.265 27.700000000000003 23.66 85-89 19.005906497146864 29.44739213134448 27.019721693863254 24.52697967764541 90-94 19.31162510661783 29.7827504891877 27.228939842456473 23.676684561737996 95-99 19.0648203893237 29.50531808147702 27.46337547662051 23.966486052578766 100-104 19.696893912869502 29.430300605211823 27.389586355224328 23.483219126694344 105-109 19.34 29.744999999999997 26.96 23.955000000000002 110-114 20.169999999999998 29.21 27.07 23.549999999999997 115-119 20.649129825965193 28.970794158831765 26.875375075015 23.504700940188037 120-124 20.265 29.15 26.619999999999997 23.965 125-129 20.575 29.304999999999996 26.57 23.549999999999997 130-134 20.133119807827043 29.426483835451904 26.618957061355218 23.821439295365828 135-139 20.232488225273073 29.076059725423388 26.550756588836556 24.14069546046698 140-144 19.915932746196958 29.148318654923937 26.56124899919936 24.374499599679744 145-149 20.01001001001001 29.334334334334333 26.16116116116116 24.494494494494496 150-151 19.825 29.2375 26.7125 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.5 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 2.0 19 2.5 20 1.0 21 1.0 22 2.5 23 4.5 24 3.0 25 3.5 26 7.0 27 10.0 28 14.5 29 23.5 30 35.5 31 49.0 32 64.5 33 76.0 34 82.5 35 98.5 36 124.5 37 154.0 38 157.5 39 166.5 40 199.5 41 216.5 42 219.0 43 243.0 44 259.0 45 240.0 46 237.0 47 226.5 48 201.0 49 176.5 50 140.0 51 107.0 52 89.5 53 86.5 54 70.0 55 46.5 56 37.5 57 27.0 58 24.0 59 14.5 60 8.0 61 8.5 62 8.5 63 7.0 64 2.0 65 1.5 66 1.5 67 2.0 68 2.0 69 1.5 70 2.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.11 90-94 0.345 95-99 0.33999999999999997 100-104 0.034999999999999996 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.09 135-139 0.21 140-144 0.08 145-149 0.1 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.44029659933521 96.25 2 1.4574277678343135 2.85 3 0.051137816415239075 0.15 4 0.0 0.0 5 0.025568908207619537 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAAAGCAATCTCGTATGC 25 0.625 TruSeq Adapter, Index 5 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACAAAGCAATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 5 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3125 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.875 0.0 0.0 0.0 0.0 116-117 3.2249999999999996 0.0 0.0 0.0 0.0 118-119 3.5374999999999996 0.0 0.0 0.0 0.0 120-121 3.9625000000000004 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.6375 0.0 0.0 0.0 0.0 126-127 5.05 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.8125 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.8 0.0 0.0 0.0 0.0 136-137 7.5125 0.0 0.0 0.0 0.0 138-139 8.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATCGA 10 0.006830828 145.0 4 TACTGGA 10 0.006830828 145.0 2 ATCACAT 10 0.006830828 145.0 8 >>END_MODULE SRR7169931 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169931_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3555 33.0 33.0 34.0 32.0 34.0 2 32.51825 34.0 33.0 34.0 32.0 34.0 3 32.4565 34.0 33.0 34.0 32.0 34.0 4 32.29975 34.0 33.0 34.0 32.0 34.0 5 32.252 34.0 33.0 34.0 32.0 34.0 6 36.26075 38.0 38.0 38.0 36.0 38.0 7 36.364 38.0 38.0 38.0 36.0 38.0 8 36.28125 38.0 38.0 38.0 36.0 38.0 9 36.30375 38.0 38.0 38.0 36.0 38.0 10-14 36.217400000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.07955 38.0 38.0 38.0 36.0 38.0 20-24 36.13495 38.0 38.0 38.0 36.0 38.0 25-29 36.18585 38.0 38.0 38.0 36.0 38.0 30-34 36.1674 38.0 38.0 38.0 36.0 38.0 35-39 36.08505 38.0 38.0 38.0 36.0 38.0 40-44 36.0213 38.0 38.0 38.0 35.6 38.0 45-49 35.91455 38.0 38.0 38.0 35.4 38.0 50-54 35.99544999999999 38.0 38.0 38.0 35.2 38.0 55-59 35.9803 38.0 38.0 38.0 34.8 38.0 60-64 35.9666 38.0 38.0 38.0 35.4 38.0 65-69 35.9057 38.0 38.0 38.0 34.8 38.0 70-74 35.74565 38.0 38.0 38.0 34.6 38.0 75-79 35.628 38.0 38.0 38.0 34.0 38.0 80-84 35.517900000000004 38.0 38.0 38.0 33.6 38.0 85-89 35.20934999999999 38.0 38.0 38.0 32.2 38.0 90-94 35.02565 38.0 38.0 38.0 31.0 38.0 95-99 35.150349999999996 38.0 38.0 38.0 30.4 38.0 100-104 35.24165000000001 38.0 38.0 38.0 32.4 38.0 105-109 35.09015 38.0 38.0 38.0 31.4 38.0 110-114 35.00345 38.0 38.0 38.0 30.6 38.0 115-119 34.86385 38.0 38.0 38.0 28.6 38.0 120-124 34.742399999999996 38.0 38.0 38.0 28.0 38.0 125-129 34.321450000000006 38.0 37.0 38.0 24.8 38.0 130-134 33.55135 38.0 36.0 38.0 14.2 38.0 135-139 32.72375 38.0 35.2 38.0 6.4 38.0 140-144 31.982350000000004 38.0 34.4 38.0 2.0 38.0 145-149 31.617200000000004 38.0 33.4 38.0 2.0 38.0 150-151 28.07975 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 90.0 3 6.0 4 4.0 5 4.0 6 4.0 7 8.0 8 5.0 9 3.0 10 3.0 11 7.0 12 7.0 13 8.0 14 6.0 15 10.0 16 10.0 17 17.0 18 6.0 19 9.0 20 12.0 21 11.0 22 6.0 23 13.0 24 16.0 25 16.0 26 16.0 27 30.0 28 36.0 29 24.0 30 32.0 31 49.0 32 77.0 33 110.0 34 119.0 35 157.0 36 362.0 37 2707.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.63751906456533 20.971021860701576 16.166751398068126 24.224707676664973 2 26.641414141414145 27.550505050505052 27.67676767676768 18.13131313131313 3 23.0613279270147 29.751647237709072 29.320831221490117 17.866193613786113 4 24.001018070755915 32.90913718503436 23.49198269279715 19.597862051412573 5 25.472179683511996 35.119959162838185 23.021949974476776 16.38591117917305 6 22.825809742412652 34.99107370568733 24.305024228513133 17.87809232338689 7 22.39224687579699 23.284876307064525 34.58301453710788 19.739862280030604 8 24.534557510839072 25.121142565672024 27.69701606732976 22.64728385615914 9 23.415627386103335 26.571646729447696 28.684143547976582 21.328582336472383 10-14 24.84548194309649 28.569239413597593 25.821116616437656 20.764162026868263 15-19 24.078435388081097 28.010444398935082 27.39606799098915 20.515052221994676 20-24 23.348670756646218 28.629856850715747 27.70449897750511 20.316973415132924 25-29 24.872553017944536 28.792822185970635 26.483482871125613 19.85114192495922 30-34 23.986538167355057 28.636989444699402 26.8879710366631 20.488501351282444 35-39 24.123300276045395 28.146406297924546 27.379613536448215 20.350679889581844 40-44 24.495647721454173 27.910906298003074 27.741935483870968 19.851510496671786 45-49 24.283884191647452 27.281578273123237 27.937483986676913 20.497053548552397 50-54 23.972463029066805 27.766445690973995 28.306986231514536 19.95410504844467 55-59 24.359889829643986 28.419871467917986 27.455880852800163 19.764357849637864 60-64 23.939703628002043 29.233520694941234 27.445068983137453 19.381706693919266 65-69 24.02080783353733 28.733170134638925 27.66217870257038 19.583843329253366 70-74 23.91149542217701 28.25534079348932 27.990844354018314 19.84231943031536 75-79 24.054493696624643 28.085603904026023 27.811102074013828 20.048800325335502 80-84 24.352252481547467 28.343089844744206 27.701705268516164 19.602952405192163 85-89 24.150341919893055 27.68265720602602 27.97058974754486 20.196411126536066 90-94 23.94344393415553 28.02002167294494 28.014861447959134 20.0216729449404 95-99 23.667823601469987 28.246222948142098 28.052266231114743 20.033687219273173 100-104 23.970056525945918 28.212048683607478 27.860671181952434 19.957223608494168 105-109 23.901841742768227 27.886332329983166 28.52915667567981 19.682669251568797 110-114 24.49469171090241 28.087995100040835 27.842997141690486 19.57431604736627 115-119 23.88295165394402 28.351145038167942 28.391857506361323 19.37404580152672 120-124 24.57859463850528 28.112307067424858 28.025995125913887 19.28310316815597 125-129 24.719791186857055 28.056707098623267 28.466144633809304 18.757357080710374 130-134 25.074331020812686 27.90673412967503 27.870220645767045 19.14871420374524 135-139 25.33114337183427 28.027974992052556 27.84783299777472 18.793048638338455 140-144 24.970528346372305 28.21776872789626 27.848033436930663 18.96366948880077 145-149 25.237796592453225 28.044319013274798 27.830040765130136 18.88784362914184 150-151 25.295326142783768 27.375449409347713 28.13302516692347 19.196199280945045 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 52.0 1 30.5 2 6.0 3 2.5 4 1.5 5 1.5 6 1.0 7 1.0 8 1.0 9 0.0 10 0.5 11 1.0 12 1.0 13 2.0 14 1.5 15 1.0 16 1.5 17 1.0 18 2.0 19 2.0 20 1.5 21 2.5 22 3.0 23 2.0 24 2.5 25 5.0 26 6.0 27 6.5 28 6.0 29 8.0 30 12.5 31 17.5 32 24.0 33 30.5 34 40.5 35 62.5 36 83.0 37 103.0 38 123.5 39 156.5 40 205.5 41 222.5 42 233.5 43 272.5 44 288.0 45 276.0 46 261.0 47 250.0 48 232.0 49 190.0 50 163.5 51 145.0 52 108.0 53 83.5 54 67.0 55 52.0 56 38.0 57 28.0 58 26.0 59 17.0 60 14.5 61 13.0 62 9.0 63 5.5 64 4.0 65 4.5 66 3.5 67 3.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.6500000000000001 2 1.0 3 1.35 4 1.775 5 2.0500000000000003 6 1.975 7 1.975 8 1.975 9 1.775 10-14 2.1149999999999998 15-19 2.34 20-24 2.1999999999999997 25-29 1.92 30-34 1.9449999999999998 35-39 2.19 40-44 2.35 45-49 2.4250000000000003 50-54 1.95 55-59 1.97 60-64 2.15 65-69 1.96 70-74 1.7000000000000002 75-79 1.6400000000000001 80-84 1.775 85-89 2.7550000000000003 90-94 3.105 95-99 2.04 100-104 1.815 105-109 1.9949999999999999 110-114 2.04 115-119 1.7500000000000002 120-124 1.52 125-129 2.305 130-134 4.1450000000000005 135-139 5.63 140-144 6.69 145-149 4.33 150-151 2.65 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.31693423096841 94.925 2 1.4759192128430865 2.85 3 0.10357327809425168 0.3 4 0.02589331952356292 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02589331952356292 0.22499999999999998 >10 0.05178663904712584 1.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 40 1.0 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 24 0.6 Illumina Single End PCR Primer 1 (100% over 50bp) NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.11249999999999999 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.3624999999999998 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2750000000000004 0.0 0.0 0.0 0.0 112-113 2.5250000000000004 0.0 0.0 0.0 0.0 114-115 2.8375000000000004 0.0 0.0 0.0 0.0 116-117 3.1875 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.825 0.0 0.0 0.0 0.0 122-123 4.175000000000001 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.925 0.0 0.0 0.0 0.0 128-129 5.1875 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.3625 0.0 0.0 0.0 0.0 138-139 7.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628491 spots for SRR7169931.sra Written 628491 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra Read 628472 spots for SRR7169931.sra Written 628472 spots for SRR7169931.sra SRR ids: ['SRR7169931.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rwtxbd0g SRR7169931.sra spots: 12569459 blocks: [[1, 628472], [628473, 1256944], [1256945, 1885416], [1885417, 2513888], [2513889, 3142360], [3142361, 3770832], [3770833, 4399304], [4399305, 5027776], [5027777, 5656248], [5656249, 6284720], [6284721, 6913192], [6913193, 7541664], [7541665, 8170136], [8170137, 8798608], [8798609, 9427080], [9427081, 10055552], [10055553, 10684024], [10684025, 11312496], [11312497, 11940968], [11940969, 12569459]] SRR7169931 file size 4237676 SRR7169931 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169931 SRR7169931_1.fastq SRR7169931_2.fastq Input file: SRR7169931_1.fastq Paired file: SRR7169931_2.fastq trimmed: SRR7169931-trimmed-pair1.fastq, SRR7169931-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:04:36 2025 >> started Wed Feb 12 03:04:50 2025 >> done (14.299s) 12569459 read pairs processed; of these: 39307 ( 0.31%) short read pairs filtered out after trimming by size control 112981 ( 0.90%) empty read pairs filtered out after trimming by size control 12417171 (98.79%) read pairs available; of these: 5858489 (47.18%) trimmed read pairs available after processing 6558682 (52.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 11 0.00% 20 13 0.00% 21 13 0.00% 22 16 0.00% 23 13 0.00% 24 25 0.00% 25 16 0.00% 26 17 0.00% 27 27 0.00% 28 29 0.00% 29 22 0.00% 30 22 0.00% 31 26 0.00% 32 15 0.00% 33 30 0.00% 34 31 0.00% 35 29 0.00% 36 29 0.00% 37 33 0.00% 38 40 0.00% 39 27 0.00% 40 52 0.00% 41 53 0.00% 42 58 0.00% 43 67 0.00% 44 78 0.00% 45 103 0.00% 46 115 0.00% 47 116 0.00% 48 109 0.00% 49 126 0.00% 50 148 0.00% 51 166 0.00% 52 191 0.00% 53 214 0.00% 54 206 0.00% 55 242 0.00% 56 236 0.00% 57 272 0.00% 58 325 0.00% 59 320 0.00% 60 343 0.00% 61 388 0.00% 62 471 0.00% 63 475 0.00% 64 592 0.00% 65 640 0.01% 66 822 0.01% 67 994 0.01% 68 1335 0.01% 69 3669 0.03% 70 7607 0.06% 71 6414 0.05% 72 4256 0.03% 73 2910 0.02% 74 2377 0.02% 75 2310 0.02% 76 2404 0.02% 77 2415 0.02% 78 2661 0.02% 79 2759 0.02% 80 3103 0.02% 81 3374 0.03% 82 3949 0.03% 83 4434 0.04% 84 6634 0.05% 85 7859 0.06% 86 8330 0.07% 87 8779 0.07% 88 9592 0.08% 89 9860 0.08% 90 10215 0.08% 91 10519 0.08% 92 11177 0.09% 93 11815 0.10% 94 12611 0.10% 95 13520 0.11% 96 14664 0.12% 97 14814 0.12% 98 15194 0.12% 99 15963 0.13% 100 16873 0.14% 101 17538 0.14% 102 18591 0.15% 103 19443 0.16% 104 20518 0.17% 105 21680 0.17% 106 22446 0.18% 107 23287 0.19% 108 24177 0.19% 109 24794 0.20% 110 25701 0.21% 111 26012 0.21% 112 27630 0.22% 113 28959 0.23% 114 29760 0.24% 115 31312 0.25% 116 32098 0.26% 117 33016 0.27% 118 33714 0.27% 119 34236 0.28% 120 35036 0.28% 121 35339 0.28% 122 36684 0.30% 123 38224 0.31% 124 39430 0.32% 125 40983 0.33% 126 42885 0.35% 127 44128 0.36% 128 45149 0.36% 129 46326 0.37% 130 47119 0.38% 131 48584 0.39% 132 50521 0.41% 133 52291 0.42% 134 55221 0.44% 135 57881 0.47% 136 60236 0.49% 137 63447 0.51% 138 66792 0.54% 139 71225 0.57% 140 74496 0.60% 141 79222 0.64% 142 84414 0.68% 143 90911 0.73% 144 103637 0.83% 145 113096 0.91% 146 132206 1.06% 147 173340 1.40% 148 257702 2.08% 149 459212 3.70% 150 2555034 20.58% 151 6558682 52.82% 12417171 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=3.0 sequence=GGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=306.38 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=22.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.95 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.09 sequence-density-rank=20 fanout-score=303.77 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=28.2 sequence=AAGAAGAAGAAG SRR7169931 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:05:35 Started mapping on | Feb 12 03:05:35 Finished on | Feb 12 03:07:00 Mapping speed, Million of reads per hour | 525.90 Number of input reads | 12417171 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11571135 Uniquely mapped reads % | 93.19% Average mapped length | 291.11 Number of splices: Total | 8954774 Number of splices: Annotated (sjdb) | 8750944 Number of splices: GT/AG | 8804976 Number of splices: GC/AG | 114204 Number of splices: AT/AC | 8507 Number of splices: Non-canonical | 27087 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.04% Deletion average length | 2.81 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253712 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 30262 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 627986 627986 627986 N_multimapping 253712 253712 253712 N_noFeature 370949 11385911 459549 N_ambiguous 151550 1068 54335 UnstrandedReadsAssigned:11048636 PositiveStrandReadsAssigned:184156 NegativeStrandReadsAssigned:11057251 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169931 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169931-trimmed-pair1.fastq SRR7169931-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,417,171 reads, 11,086,340 reads pseudoaligned [quant] estimated average fragment length: 219.993 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7169931.ke.tsv 34699 SRR7169931.se.tsv 87100 total ==> SRR7169931.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.01 298 14.7495 Potri.005G024800.1.v4.1 1035 816.007 48 5.2377 Potri.004G059700.1.v4.1 961 742.022 3 0.359996 Potri.007G009000.2.v4.1 1416 1197.01 0 0 Potri.003G141000.2.v4.1 2943 2724.01 203 6.63561 Potri.016G087400.1.v4.1 270 86.7 1539 1580.57 Potri.015G069301.1.v4.1 564 347.135 0 0 Potri.010G195200.1.v4.1 1773 1554.01 97 5.55791 Potri.012G127500.1.v4.1 977 758.017 4826 566.894 ==> SRR7169931.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2272 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7169931 completed mapping pipeline successfully