Starting /dee2/code/volunteer_pipeline.sh SRR7169932 current disk space = 3048978305024 free memory = 1485873508 SRR7169932 SRAfilesize 8d659d9fd2e465a9fdb265063b36f986 SRR7169932.sra SRR7169932.sra file validated SRR7169932 is paired end SRR7169932 is conventional basespace SRR7169932 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169932_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79925 34.0 33.0 34.0 33.0 34.0 2 33.41025 34.0 34.0 34.0 33.0 34.0 3 33.5105 34.0 34.0 34.0 33.0 34.0 4 33.57725 34.0 34.0 34.0 33.0 34.0 5 33.44975 34.0 34.0 34.0 33.0 34.0 6 37.25725 38.0 38.0 38.0 36.0 38.0 7 37.51375 38.0 38.0 38.0 37.0 38.0 8 37.5965 38.0 38.0 38.0 38.0 38.0 9 37.6515 38.0 38.0 38.0 38.0 38.0 10-14 37.605000000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.5935 38.0 38.0 38.0 38.0 38.0 20-24 37.4691 38.0 38.0 38.0 38.0 38.0 25-29 37.41915 38.0 38.0 38.0 38.0 38.0 30-34 37.4401 38.0 38.0 38.0 38.0 38.0 35-39 37.31585 38.0 38.0 38.0 37.4 38.0 40-44 37.212450000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.0033 38.0 38.0 38.0 36.4 38.0 50-54 36.9927 38.0 38.0 38.0 36.0 38.0 55-59 36.944449999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.92659999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.90065 38.0 38.0 38.0 35.8 38.0 70-74 36.811099999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.57505 38.0 38.0 38.0 34.6 38.0 80-84 36.4358 38.0 38.0 38.0 34.0 38.0 85-89 36.2798 38.0 38.0 38.0 33.8 38.0 90-94 36.17100000000001 38.0 38.0 38.0 34.0 38.0 95-99 35.871050000000004 38.0 38.0 38.0 32.8 38.0 100-104 35.720349999999996 38.0 37.0 38.0 31.4 38.0 105-109 35.539 38.0 37.0 38.0 29.8 38.0 110-114 35.3894 38.0 37.0 38.0 29.2 38.0 115-119 35.22075 38.0 36.8 38.0 28.8 38.0 120-124 35.23855 38.0 36.2 38.0 29.8 38.0 125-129 34.9752 38.0 36.0 38.0 28.4 38.0 130-134 34.286 38.0 35.2 38.0 24.0 38.0 135-139 33.56065 38.0 34.6 38.0 19.8 38.0 140-144 33.46235 38.0 34.8 38.0 19.8 38.0 145-149 32.8535 38.0 34.0 38.0 14.2 38.0 150-151 28.456125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 2.0 13 2.0 14 1.0 15 3.0 16 4.0 17 4.0 18 5.0 19 13.0 20 11.0 21 11.0 22 8.0 23 15.0 24 24.0 25 35.0 26 31.0 27 20.0 28 34.0 29 32.0 30 47.0 31 66.0 32 60.0 33 106.0 34 152.0 35 241.0 36 587.0 37 2480.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.09582372533948 12.91314373558801 11.042787599282603 33.94824493978991 2 23.825 15.575 31.025000000000002 29.575000000000003 3 19.025 22.400000000000002 26.125 32.45 4 21.625 27.675 23.425 27.275 5 22.650000000000002 31.825 24.099999999999998 21.425 6 19.925 33.35 25.575 21.15 7 15.375 27.075 38.6 18.95 8 17.65 27.224999999999998 30.825000000000003 24.3 9 17.299999999999997 26.150000000000002 33.125 23.425 10-14 19.89 29.459999999999997 27.08 23.57 15-19 20.19 28.689999999999998 27.82 23.3 20-24 19.98 29.64 27.139999999999997 23.24 25-29 19.67 28.625 27.165 24.54 30-34 19.744999999999997 28.62 28.115000000000002 23.52 35-39 20.21 28.705000000000002 27.07 24.015 40-44 19.794999999999998 28.999999999999996 27.115000000000002 24.09 45-49 20.665332666333168 28.034017008504254 27.55877938969485 23.741870935467734 50-54 20.05 28.735 27.605 23.61 55-59 20.044999999999998 28.895 27.12 23.94 60-64 19.895 28.804999999999996 27.015 24.285 65-69 20.01 29.134999999999998 27.384999999999998 23.47 70-74 19.895 28.29 28.32 23.494999999999997 75-79 19.72 28.725 27.229999999999997 24.325 80-84 19.985 28.68 27.060000000000002 24.275 85-89 20.189274447949526 28.26598567923489 27.725201542236245 23.81953833057934 90-94 20.204307568438004 28.48731884057971 27.289653784219002 24.018719806763286 95-99 20.202376157873537 28.65988723318566 26.99355618203786 24.14418042690294 100-104 20.541568647079433 28.925371640222235 26.257570448971418 24.27548926372691 105-109 20.24101205060253 28.691434571728585 26.936346817340866 24.131206560328017 110-114 20.935000000000002 28.38 26.56 24.125 115-119 20.511025551277566 28.41642082104105 27.2013600680034 23.871193559677984 120-124 20.86 28.16 26.919999999999998 24.060000000000002 125-129 20.841252375712713 28.233470041012303 26.788036410923276 24.137241172351708 130-134 21.14142678347935 28.52565707133917 26.90863579474343 23.42428035043805 135-139 21.869975884244372 28.064710610932476 26.99959807073955 23.0657154340836 140-144 21.270206696361544 27.906511185626343 26.57024172964316 24.25304038836895 145-149 20.795994993742177 27.97997496871089 26.763454317897374 24.46057571964956 150-151 21.525 28.3375 25.0125 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 3.0 22 1.0 23 1.0 24 4.0 25 6.5 26 6.0 27 6.0 28 9.5 29 14.0 30 16.5 31 23.5 32 31.0 33 45.0 34 61.0 35 64.5 36 72.0 37 92.5 38 115.0 39 149.5 40 184.5 41 211.0 42 248.5 43 264.0 44 269.0 45 281.5 46 273.0 47 255.5 48 230.5 49 210.0 50 189.0 51 144.5 52 117.0 53 107.5 54 81.5 55 58.5 56 41.5 57 30.0 58 25.5 59 16.0 60 8.0 61 6.5 62 6.5 63 3.5 64 3.5 65 3.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.05 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.145 90-94 0.64 95-99 0.6799999999999999 100-104 0.105 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.03 130-134 0.125 135-139 0.48 140-144 0.095 145-149 0.125 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83485309017223 97.55 2 1.089159067882472 2.15 3 0.050658561296859174 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTATATCTCGTATGC 6 0.15 TruSeq Adapter, Index 15 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.4625000000000004 0.0 0.0 0.0 0.0 122-123 3.75 0.0 0.0 0.0 0.0 124-125 4.199999999999999 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.0875 0.0 0.0 0.0 0.0 130-131 5.625 0.0 0.0 0.0 0.0 132-133 5.9625 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.9375 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGGT 10 0.0068343505 144.975 7 >>END_MODULE SRR7169932 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169932_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6135 33.0 33.0 34.0 31.0 34.0 2 31.93175 34.0 33.0 34.0 31.0 34.0 3 31.9335 34.0 33.0 34.0 31.0 34.0 4 31.79125 34.0 33.0 34.0 32.0 34.0 5 31.655 34.0 33.0 34.0 31.0 34.0 6 35.72475 38.0 38.0 38.0 34.0 38.0 7 35.77675 38.0 38.0 38.0 34.0 38.0 8 35.82975 38.0 38.0 38.0 35.0 38.0 9 35.92825 38.0 38.0 38.0 35.0 38.0 10-14 35.804199999999994 38.0 38.0 38.0 35.0 38.0 15-19 35.6573 38.0 38.0 38.0 34.6 38.0 20-24 35.69865 38.0 38.0 38.0 34.6 38.0 25-29 35.8586 38.0 38.0 38.0 35.6 38.0 30-34 35.88175 38.0 38.0 38.0 36.0 38.0 35-39 35.7848 38.0 38.0 38.0 35.2 38.0 40-44 35.64465 38.0 38.0 38.0 34.6 38.0 45-49 35.5297 38.0 38.0 38.0 34.0 38.0 50-54 35.7662 38.0 38.0 38.0 34.8 38.0 55-59 35.69565 38.0 38.0 38.0 34.8 38.0 60-64 35.637449999999994 38.0 38.0 38.0 34.0 38.0 65-69 35.6596 38.0 38.0 38.0 34.4 38.0 70-74 35.57455 38.0 38.0 38.0 34.0 38.0 75-79 35.540400000000005 38.0 38.0 38.0 34.0 38.0 80-84 35.480149999999995 38.0 38.0 38.0 33.8 38.0 85-89 35.09355 38.0 38.0 38.0 31.4 38.0 90-94 34.77419999999999 38.0 38.0 38.0 28.4 38.0 95-99 35.0717 38.0 38.0 38.0 29.8 38.0 100-104 35.2022 38.0 38.0 38.0 32.0 38.0 105-109 35.1013 38.0 38.0 38.0 31.0 38.0 110-114 34.952549999999995 38.0 38.0 38.0 29.8 38.0 115-119 34.709649999999996 38.0 37.6 38.0 27.8 38.0 120-124 34.583549999999995 38.0 37.0 38.0 27.2 38.0 125-129 34.2752 38.0 36.6 38.0 23.8 38.0 130-134 33.07565 38.0 35.8 38.0 11.4 38.0 135-139 32.179649999999995 38.0 35.0 38.0 2.0 38.0 140-144 31.40045 38.0 34.0 38.0 2.0 38.0 145-149 30.741449999999997 38.0 32.4 38.0 2.0 38.0 150-151 27.1895 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 137.0 3 7.0 4 4.0 5 2.0 6 5.0 7 1.0 8 6.0 9 3.0 10 1.0 11 0.0 12 1.0 13 4.0 14 4.0 15 8.0 16 8.0 17 11.0 18 6.0 19 10.0 20 14.0 21 11.0 22 12.0 23 12.0 24 15.0 25 24.0 26 15.0 27 24.0 28 28.0 29 23.0 30 51.0 31 67.0 32 69.0 33 115.0 34 133.0 35 158.0 36 379.0 37 2632.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.469547110879745 20.9005726184279 15.851119208745445 24.778761061946902 2 28.14569536423841 27.66174223127866 26.974019358125318 17.218543046357617 3 22.492946909463964 30.033341882533982 28.725314183123878 18.748397024878173 4 22.86380113930606 34.256861729673744 23.355774210253756 19.523562920766445 5 25.0130005200208 34.08736349453978 22.80291211648466 18.096723868954758 6 21.82806835836354 35.706887622993264 24.80580010357328 17.65924391506991 7 21.275497030725536 22.798863929770206 36.48334624322231 19.44229279628195 8 24.683707720113606 24.45132971856442 25.7423186160599 25.12264394526207 9 23.43709801903782 25.392333419089276 28.505273990223824 22.665294571649085 10-14 23.525455298013245 28.53890728476821 26.355546357615893 21.580091059602648 15-19 23.482411538860642 27.871744318771402 27.59676247794957 21.049081664418388 20-24 23.471288153129848 28.406621831350233 26.694257630625973 21.427832384893946 25-29 24.080370942812984 28.052550231839255 27.068521380731582 20.79855744461618 30-34 24.07102418939784 27.52444673185795 27.68399382398353 20.72053525476068 35-39 24.2770088824623 28.150175583557118 26.35302623424912 21.21978929973146 40-44 24.357976653696497 27.865110246433204 26.93644617380026 20.84046692607004 45-49 23.648157758173326 27.618059159314996 27.223663725998964 21.510119356512714 50-54 23.813209494324045 27.982456140350877 27.39938080495356 20.804953560371516 55-59 24.08152734778122 27.56449948400413 27.569659442724458 20.784313725490197 60-64 23.643971484657506 27.353032338051452 27.998760202500257 21.004235974790785 65-69 24.065300236893602 27.67020290452158 27.65990318261407 20.604593675970747 70-74 23.84078785391875 27.267131719327043 27.636438243742305 21.2556421830119 75-79 23.60790351552476 27.91377983063895 27.441621760328456 21.036694893507825 80-84 23.966305408598284 27.756946941291282 27.525810262468543 20.750937387641894 85-89 24.38261956861519 26.86256121704699 27.826404084609774 20.92841512972804 90-94 24.436169096821565 27.20549669568866 27.651316479597188 20.707017727892584 95-99 24.42184596324592 27.575882717323974 27.575882717323974 20.426388602106133 100-104 24.274542086849145 27.18666392261782 27.67030253138506 20.86849145914797 105-109 24.32599618537038 27.027166348780867 27.78493736790556 20.86190009794319 110-114 23.856715185299887 27.573036027665943 27.588520697842466 20.9817280891917 115-119 24.757605294208176 27.7176422305443 27.240547888985787 20.284204586261733 120-124 24.76993865030675 27.56646216768916 27.505112474437627 20.15848670756646 125-129 24.96630378434422 28.004147226542248 26.951788491446344 20.077760497667185 130-134 24.92681109277692 27.646777026667372 27.141108213126095 20.285303667429606 135-139 24.659467086340694 28.024095077874854 27.07982851250882 20.23660932327563 140-144 25.818181818181817 27.47658402203857 27.01928374655647 19.68595041322314 145-149 25.729499467518636 28.226837060702874 26.421725239616613 19.621938232161877 150-151 26.38961038961039 29.09090909090909 25.116883116883116 19.4025974025974 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 84.0 1 45.5 2 6.0 3 5.0 4 3.5 5 2.5 6 2.5 7 2.5 8 1.5 9 1.0 10 1.5 11 0.5 12 1.0 13 1.5 14 1.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.0 21 0.5 22 3.0 23 3.5 24 3.5 25 5.0 26 4.5 27 4.0 28 6.0 29 7.5 30 8.5 31 13.0 32 20.0 33 25.0 34 33.0 35 41.5 36 51.0 37 67.5 38 103.5 39 132.0 40 164.0 41 212.0 42 245.5 43 266.5 44 278.0 45 279.0 46 284.5 47 275.0 48 247.5 49 224.0 50 194.5 51 160.0 52 133.0 53 105.0 54 72.5 55 56.0 56 41.0 57 27.5 58 20.5 59 16.5 60 10.5 61 8.0 62 6.5 63 5.0 64 3.5 65 1.5 66 1.5 67 1.0 68 1.5 69 1.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.95 2 1.8499999999999999 3 2.5250000000000004 4 3.45 5 3.85 6 3.45 7 3.175 8 3.175 9 2.825 10-14 3.36 15-19 3.63 20-24 3.35 25-29 2.9499999999999997 30-34 2.85 35-39 3.18 40-44 3.6249999999999996 45-49 3.65 50-54 3.1 55-59 3.1 60-64 3.2099999999999995 65-69 2.91 70-74 2.52 75-79 2.5749999999999997 80-84 2.6550000000000002 85-89 4.03 90-94 4.67 95-99 3.1399999999999997 100-104 2.82 105-109 3.005 110-114 3.1300000000000003 115-119 2.535 120-124 2.1999999999999997 125-129 3.55 130-134 6.065 135-139 7.865 140-144 9.25 145-149 6.1 150-151 3.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83359253499222 95.325 2 0.9590461378952826 1.8499999999999999 3 0.07776049766718507 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.05184033177812338 0.3 7 0.0 0.0 8 0.02592016588906169 0.2 9 0.0 0.0 >10 0.02592016588906169 0.25 >50 0.02592016588906169 1.8499999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 74 1.8499999999999999 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.1125 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 3.0875000000000004 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.825 0.0 0.0 0.0 0.0 124-125 4.175 0.0 0.0 0.0 0.0 126-127 4.6625 0.0 0.0 0.0 0.0 128-129 5.0375 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 5.875 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.824999999999999 0.0 0.0 0.0 0.0 138-139 7.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTGC 10 0.0070274016 143.60759 1 >>END_MODULE Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778248 spots for SRR7169932.sra Written 778248 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra Read 778235 spots for SRR7169932.sra Written 778235 spots for SRR7169932.sra SRR ids: ['SRR7169932.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1kze1bm9 SRR7169932.sra spots: 15564713 blocks: [[1, 778235], [778236, 1556470], [1556471, 2334705], [2334706, 3112940], [3112941, 3891175], [3891176, 4669410], [4669411, 5447645], [5447646, 6225880], [6225881, 7004115], [7004116, 7782350], [7782351, 8560585], [8560586, 9338820], [9338821, 10117055], [10117056, 10895290], [10895291, 11673525], [11673526, 12451760], [12451761, 13229995], [13229996, 14008230], [14008231, 14786465], [14786466, 15564713]] SRR7169932 file size 5252670 SRR7169932 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169932 SRR7169932_1.fastq SRR7169932_2.fastq Input file: SRR7169932_1.fastq Paired file: SRR7169932_2.fastq trimmed: SRR7169932-trimmed-pair1.fastq, SRR7169932-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:22:40 2025 >> started Wed Feb 12 03:22:57 2025 >> done (17.654s) 15564713 read pairs processed; of these: 43000 ( 0.28%) short read pairs filtered out after trimming by size control 72595 ( 0.47%) empty read pairs filtered out after trimming by size control 15449118 (99.26%) read pairs available; of these: 7316682 (47.36%) trimmed read pairs available after processing 8132436 (52.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 10 0.00% 23 10 0.00% 24 9 0.00% 25 14 0.00% 26 10 0.00% 27 7 0.00% 28 12 0.00% 29 19 0.00% 30 11 0.00% 31 25 0.00% 32 17 0.00% 33 12 0.00% 34 17 0.00% 35 25 0.00% 36 21 0.00% 37 21 0.00% 38 22 0.00% 39 37 0.00% 40 34 0.00% 41 39 0.00% 42 57 0.00% 43 44 0.00% 44 60 0.00% 45 57 0.00% 46 86 0.00% 47 82 0.00% 48 97 0.00% 49 92 0.00% 50 111 0.00% 51 125 0.00% 52 148 0.00% 53 129 0.00% 54 160 0.00% 55 171 0.00% 56 174 0.00% 57 188 0.00% 58 230 0.00% 59 237 0.00% 60 291 0.00% 61 337 0.00% 62 362 0.00% 63 454 0.00% 64 516 0.00% 65 567 0.00% 66 712 0.00% 67 851 0.01% 68 1111 0.01% 69 1578 0.01% 70 2674 0.02% 71 2093 0.01% 72 1652 0.01% 73 1537 0.01% 74 1735 0.01% 75 1920 0.01% 76 1919 0.01% 77 2076 0.01% 78 2316 0.01% 79 2594 0.02% 80 2972 0.02% 81 3387 0.02% 82 3755 0.02% 83 4499 0.03% 84 6665 0.04% 85 7931 0.05% 86 8622 0.06% 87 9063 0.06% 88 9227 0.06% 89 9542 0.06% 90 10001 0.06% 91 10650 0.07% 92 11389 0.07% 93 12483 0.08% 94 13161 0.09% 95 14285 0.09% 96 14776 0.10% 97 15692 0.10% 98 15942 0.10% 99 16791 0.11% 100 17914 0.12% 101 18642 0.12% 102 19869 0.13% 103 21229 0.14% 104 22400 0.14% 105 24361 0.16% 106 25237 0.16% 107 25775 0.17% 108 26900 0.17% 109 27377 0.18% 110 28397 0.18% 111 29489 0.19% 112 31076 0.20% 113 33100 0.21% 114 34534 0.22% 115 36509 0.24% 116 37582 0.24% 117 37558 0.24% 118 38490 0.25% 119 39000 0.25% 120 40343 0.26% 121 41539 0.27% 122 43304 0.28% 123 45582 0.30% 124 47268 0.31% 125 49538 0.32% 126 51585 0.33% 127 53037 0.34% 128 54014 0.35% 129 55326 0.36% 130 57072 0.37% 131 58881 0.38% 132 61472 0.40% 133 64407 0.42% 134 67261 0.44% 135 71512 0.46% 136 74862 0.48% 137 78869 0.51% 138 84501 0.55% 139 88850 0.58% 140 93805 0.61% 141 99293 0.64% 142 107283 0.69% 143 116156 0.75% 144 129379 0.84% 145 146568 0.95% 146 176267 1.14% 147 224782 1.45% 148 311190 2.01% 149 584526 3.78% 150 3332012 21.57% 151 8132436 52.64% 15449118 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.28 prefix-fanout=2.0 sequence=GTTTATAAGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=79.35 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.6 sequence=CCTCCACATTACACCCAAGTGCCAAGCGCACTCATAATATTCTATGAAACCAAGTATGAGAAATGCACAACTACTGTAATAGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.20 prefix-fanout=2.0 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=32.62 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=7.7 sequence=ATCTTTGTGGTTGATAGCAATGATCGTGACCGTGTGGTTGA SRR7169932 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:23:45 Started mapping on | Feb 12 03:23:46 Finished on | Feb 12 03:25:52 Mapping speed, Million of reads per hour | 441.40 Number of input reads | 15449118 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14268664 Uniquely mapped reads % | 92.36% Average mapped length | 291.99 Number of splices: Total | 12700977 Number of splices: Annotated (sjdb) | 12483902 Number of splices: GT/AG | 12526382 Number of splices: GC/AG | 139589 Number of splices: AT/AC | 10878 Number of splices: Non-canonical | 24128 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240780 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 20665 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.91% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 974928 974928 974928 N_multimapping 240780 240780 240780 N_noFeature 258281 14071375 324887 N_ambiguous 189816 794 58614 UnstrandedReadsAssigned:13820567 PositiveStrandReadsAssigned:196495 NegativeStrandReadsAssigned:13885163 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169932 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169932-trimmed-pair1.fastq SRR7169932-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,449,118 reads, 13,865,928 reads pseudoaligned [quant] estimated average fragment length: 225.962 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7169932.ke.tsv 34699 SRR7169932.se.tsv 87100 total ==> SRR7169932.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.04 257 9.50254 Potri.005G024800.1.v4.1 1035 810.038 43 3.51932 Potri.004G059700.1.v4.1 961 736.056 11 0.990781 Potri.007G009000.2.v4.1 1416 1191.04 0 0 Potri.003G141000.2.v4.1 2943 2718.04 218.032 5.31815 Potri.016G087400.1.v4.1 270 86.6248 1363.91 1043.85 Potri.015G069301.1.v4.1 564 342.454 0 0 Potri.010G195200.1.v4.1 1773 1548.04 10 0.428267 Potri.012G127500.1.v4.1 977 752.051 4430 390.529 ==> SRR7169932.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1272 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169932 completed mapping pipeline successfully