Starting /dee2/code/volunteer_pipeline.sh SRR7169933 current disk space = 3048975790080 free memory = 1495262188 SRR7169933 SRAfilesize 473fe549ae1df4af05879e59c58f4d2c SRR7169933.sra SRR7169933.sra file validated SRR7169933 is paired end SRR7169933 is conventional basespace SRR7169933 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169933_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1935 34.0 33.0 34.0 33.0 34.0 2 33.52375 34.0 34.0 34.0 33.0 34.0 3 33.48375 34.0 34.0 34.0 33.0 34.0 4 33.50925 34.0 34.0 34.0 33.0 34.0 5 33.50525 34.0 34.0 34.0 33.0 34.0 6 37.31125 38.0 38.0 38.0 36.0 38.0 7 37.517 38.0 38.0 38.0 37.0 38.0 8 37.5485 38.0 38.0 38.0 38.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.5776 38.0 38.0 38.0 38.0 38.0 15-19 37.60555 38.0 38.0 38.0 38.0 38.0 20-24 37.5318 38.0 38.0 38.0 38.0 38.0 25-29 37.5661 38.0 38.0 38.0 38.0 38.0 30-34 37.5556 38.0 38.0 38.0 38.0 38.0 35-39 37.52725 38.0 38.0 38.0 38.0 38.0 40-44 37.405 38.0 38.0 38.0 37.0 38.0 45-49 37.2839 38.0 38.0 38.0 37.0 38.0 50-54 37.3274 38.0 38.0 38.0 37.0 38.0 55-59 37.2553 38.0 38.0 38.0 37.0 38.0 60-64 37.2296 38.0 38.0 38.0 37.0 38.0 65-69 37.153749999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.12705 38.0 38.0 38.0 36.2 38.0 75-79 37.03605 38.0 38.0 38.0 36.0 38.0 80-84 36.8941 38.0 38.0 38.0 35.8 38.0 85-89 36.88785 38.0 38.0 38.0 35.6 38.0 90-94 36.7291 38.0 38.0 38.0 35.4 38.0 95-99 36.513099999999994 38.0 38.0 38.0 34.8 38.0 100-104 36.492599999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.55 38.0 38.0 38.0 34.0 38.0 110-114 36.3843 38.0 38.0 38.0 34.0 38.0 115-119 36.2322 38.0 38.0 38.0 34.0 38.0 120-124 36.088499999999996 38.0 37.8 38.0 33.4 38.0 125-129 35.8646 38.0 37.2 38.0 32.2 38.0 130-134 35.20105 38.0 36.2 38.0 29.4 38.0 135-139 34.8316 38.0 36.0 38.0 28.0 38.0 140-144 34.83175 38.0 35.8 38.0 28.0 38.0 145-149 33.89565 38.0 35.0 38.0 22.6 38.0 150-151 30.0895 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 3.0 18 4.0 19 4.0 20 2.0 21 2.0 22 2.0 23 10.0 24 10.0 25 12.0 26 19.0 27 22.0 28 25.0 29 27.0 30 38.0 31 49.0 32 62.0 33 82.0 34 133.0 35 243.0 36 522.0 37 2724.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.73617773289573 11.890936632163596 8.608937137086595 34.763948497854074 2 23.125 14.025000000000002 32.75 30.099999999999998 3 19.575 19.55 25.900000000000002 34.975 4 23.0 25.85 22.275 28.875 5 22.05 32.324999999999996 24.474999999999998 21.15 6 19.175 34.8 25.275 20.75 7 14.325 29.25 39.300000000000004 17.125 8 17.525 26.525 31.15 24.8 9 16.975 24.425 33.925 24.675 10-14 19.580000000000002 30.270000000000003 26.995 23.155 15-19 19.835 29.04 27.555000000000003 23.57 20-24 19.945 29.38 27.29 23.385 25-29 20.265 28.95 26.455000000000002 24.33 30-34 20.435 28.694999999999997 27.334999999999997 23.535 35-39 20.080000000000002 28.499999999999996 27.205000000000002 24.215 40-44 20.0 28.77 27.415 23.815 45-49 20.44749224146561 29.147061767944738 26.844528981880067 23.56091700870958 50-54 20.005 28.595 27.85 23.549999999999997 55-59 20.080000000000002 28.939999999999998 27.005000000000003 23.974999999999998 60-64 20.385 29.21 26.605 23.799999999999997 65-69 20.745 28.405 27.26 23.59 70-74 19.919999999999998 28.535 27.115000000000002 24.43 75-79 20.630000000000003 28.175 27.455000000000002 23.74 80-84 20.28 28.865000000000002 27.22 23.635 85-89 20.32109632889867 28.063419025707713 27.968390517155147 23.64709412823847 90-94 20.709198515397734 28.4180960979035 26.446985655532153 24.425719731166616 95-99 20.248641030803302 27.98973223273606 27.843768874572177 23.917857861888464 100-104 20.988829334268395 28.182136953363724 27.375644943144817 23.453388769223064 105-109 20.46602330116506 27.796389819490976 27.43637181859093 24.301215060753037 110-114 20.78201662160809 28.25673375388004 27.04515870631821 23.916090918193653 115-119 20.78 28.549999999999997 27.02 23.65 120-124 20.705000000000002 28.405 26.595000000000002 24.295 125-129 21.224999999999998 27.900000000000002 26.724999999999998 24.15 130-134 20.6401766004415 27.844671884406985 27.528597230583983 23.98655428456753 135-139 20.823256751309955 28.567110036275693 26.320032245062475 24.289600967351873 140-144 20.53584867793889 28.252471025036375 27.038282073152374 24.173398223872358 145-149 21.047356552242547 27.787521924329745 27.29140566274117 23.873715860686545 150-151 20.65298974230673 28.621466099574683 26.53239929947461 24.193144858643983 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.5 26 3.5 27 4.0 28 10.0 29 17.5 30 21.5 31 27.5 32 31.0 33 35.5 34 51.5 35 57.0 36 72.0 37 102.5 38 129.5 39 146.5 40 177.0 41 232.0 42 250.5 43 253.5 44 268.0 45 260.0 46 266.0 47 277.0 48 244.0 49 207.5 50 180.5 51 139.5 52 113.5 53 104.0 54 82.5 55 55.5 56 39.0 57 39.5 58 29.0 59 16.0 60 13.5 61 13.5 62 10.5 63 4.0 64 2.5 65 2.5 66 3.0 67 2.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.11 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.03 90-94 0.31 95-99 0.66 100-104 0.185 105-109 0.005 110-114 0.13 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.33999999999999997 135-139 0.76 140-144 0.345 145-149 0.22499999999999998 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.42767295597484273 0.8500000000000001 3 0.10062893081761005 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.425 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.2875 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.2 0.0 0.0 0.0 0.0 120-121 4.675 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.5875 0.0 0.0 0.0 0.0 126-127 6.0125 0.0 0.0 0.0 0.0 128-129 6.5 0.0 0.0 0.0 0.0 130-131 7.2375 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.149999999999999 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 8.837499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCATT 10 0.00686971 144.72499 9 >>END_MODULE SRR7169933 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169933_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1235 33.0 33.0 34.0 32.0 34.0 2 32.2345 33.0 33.0 34.0 32.0 34.0 3 32.2335 34.0 33.0 34.0 32.0 34.0 4 31.8915 34.0 33.0 34.0 31.0 34.0 5 31.81025 34.0 33.0 34.0 31.0 34.0 6 36.01925 38.0 38.0 38.0 35.0 38.0 7 36.0745 38.0 38.0 38.0 35.0 38.0 8 35.99225 38.0 38.0 38.0 35.0 38.0 9 36.06775 38.0 38.0 38.0 36.0 38.0 10-14 35.976 38.0 38.0 38.0 35.0 38.0 15-19 35.7034 38.0 38.0 38.0 34.4 38.0 20-24 35.96235 38.0 38.0 38.0 34.8 38.0 25-29 36.0739 38.0 38.0 38.0 35.6 38.0 30-34 36.0783 38.0 38.0 38.0 35.6 38.0 35-39 35.970800000000004 38.0 38.0 38.0 35.2 38.0 40-44 35.81125 38.0 38.0 38.0 34.6 38.0 45-49 35.713049999999996 38.0 38.0 38.0 34.0 38.0 50-54 35.981100000000005 38.0 38.0 38.0 34.8 38.0 55-59 35.966150000000006 38.0 38.0 38.0 34.8 38.0 60-64 35.9471 38.0 38.0 38.0 34.6 38.0 65-69 35.93745 38.0 38.0 38.0 34.4 38.0 70-74 35.818200000000004 38.0 38.0 38.0 34.2 38.0 75-79 35.788799999999995 38.0 38.0 38.0 34.0 38.0 80-84 35.65305 38.0 38.0 38.0 33.6 38.0 85-89 35.27445 38.0 38.0 38.0 32.0 38.0 90-94 34.9043 38.0 38.0 38.0 28.6 38.0 95-99 35.2561 38.0 38.0 38.0 29.8 38.0 100-104 35.337450000000004 38.0 38.0 38.0 31.0 38.0 105-109 35.135600000000004 38.0 38.0 38.0 30.6 38.0 110-114 35.0508 38.0 38.0 38.0 29.2 38.0 115-119 34.77034999999999 38.0 37.0 38.0 27.4 38.0 120-124 34.6645 38.0 36.8 38.0 27.4 38.0 125-129 34.21640000000001 38.0 36.0 38.0 23.6 38.0 130-134 33.24205 38.0 35.6 38.0 15.2 38.0 135-139 31.929450000000003 38.0 34.0 38.0 2.0 38.0 140-144 31.153699999999997 38.0 33.2 38.0 2.0 38.0 145-149 30.650599999999997 38.0 32.2 38.0 2.0 38.0 150-151 26.729875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 116.0 3 2.0 4 2.0 5 0.0 6 0.0 7 1.0 8 4.0 9 1.0 10 1.0 11 1.0 12 3.0 13 0.0 14 3.0 15 4.0 16 6.0 17 5.0 18 6.0 19 17.0 20 12.0 21 11.0 22 11.0 23 16.0 24 21.0 25 27.0 26 33.0 27 29.0 28 29.0 29 42.0 30 53.0 31 68.0 32 85.0 33 139.0 34 142.0 35 217.0 36 431.0 37 2462.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.30117406840225 22.5114854517611 13.093415007656967 24.093925472179684 2 28.62235803412274 25.311942959001783 28.72421695951108 17.3414820473644 3 21.216768916155416 28.578732106339466 31.441717791411044 18.762781186094067 4 22.930100593242198 32.989424812999744 24.684034046943513 19.396440546814546 5 27.033307513555382 33.61735089078234 22.075910147172735 17.273431448489543 6 21.294631389673775 38.145389160030824 22.938607757513484 17.621371692781917 7 21.329568788501028 21.765913757700204 36.80698151950719 20.09753593429158 8 22.19662058371736 25.908858166922684 27.828981054787505 24.065540194572453 9 22.005141388174806 25.19280205655527 29.331619537275067 23.470437017994858 10-14 23.727155727155726 28.859716859716862 26.115830115830114 21.297297297297295 15-19 23.820889327037825 28.106677735692422 27.489233642920148 20.58319929434961 20-24 22.99773522750669 28.06259007617871 27.923615400452956 21.016059295861645 25-29 23.490725992909624 28.541334840466526 27.12325951805991 20.84467964856394 30-34 23.550575657894736 27.646998355263158 27.641858552631575 21.160567434210524 35-39 23.235445646573933 28.299845440494593 27.563111798042243 20.90159711488923 40-44 23.67657722987672 28.38495804413136 27.29203356469491 20.646431161297006 45-49 23.49350850876739 28.407386334247143 27.528060828634977 20.57104432835049 50-54 24.008618478428154 27.78433283742882 27.47653003642333 20.730518647719695 55-59 24.00575480423389 27.957044496968454 27.427808036173058 20.6093926626246 60-64 23.81856431833342 27.713068910667555 27.94909949202114 20.519267278977885 65-69 23.710124115293876 27.33100830854447 28.43881423735768 20.52005333880398 70-74 23.839167261965507 28.05898561077661 27.166037350750077 20.935809776507806 75-79 23.924690035205877 28.24633909893362 27.56773304760447 20.261237818256035 80-84 23.709064777743556 28.179858330766862 27.65116517811313 20.45991171337645 85-89 23.99854333576111 28.436166892102797 27.629799188429928 19.93549058370617 90-94 24.294170027761773 27.897962390655284 27.437012204703787 20.370855376879156 95-99 24.26379736408567 27.95510708401977 27.71313838550247 20.06795716639209 100-104 25.094803730654913 27.40596494824229 27.124116019268218 20.375115301834583 105-109 24.1833427645455 27.95925716343433 27.558001954833067 20.2993981171871 110-114 24.458506971240418 27.13896177393631 28.111334053609095 20.291197201214178 115-119 24.70046082949309 27.29646697388633 27.83410138248848 20.168970814132102 120-124 24.662764062102315 27.783150928989564 27.18248918299822 20.3715958259099 125-129 24.927775484936028 27.362773421378456 27.481427981840696 20.22802311184482 130-134 25.27075812274368 28.24909747292419 26.162667232958164 20.317477171373966 135-139 25.421141579894236 27.35648476257973 27.44916316851115 19.773210489014883 140-144 25.339966832504146 27.866224433388613 27.064676616915424 19.72913211719182 145-149 25.54515477076907 27.895968513987874 26.76842889054356 19.790447824699502 150-151 25.5175983436853 28.36438923395445 27.36801242236025 18.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 74.0 1 38.5 2 2.5 3 2.0 4 2.0 5 2.0 6 2.5 7 3.5 8 3.0 9 1.0 10 1.0 11 1.5 12 2.0 13 1.5 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.5 24 2.5 25 3.5 26 3.5 27 3.5 28 5.5 29 5.0 30 9.0 31 13.0 32 17.0 33 32.0 34 44.0 35 52.5 36 69.0 37 94.5 38 120.0 39 162.0 40 197.5 41 218.5 42 254.0 43 276.5 44 282.5 45 286.0 46 274.0 47 248.0 48 225.5 49 209.5 50 186.0 51 144.5 52 114.0 53 90.5 54 54.0 55 42.0 56 43.0 57 29.5 58 22.0 59 16.0 60 9.0 61 8.5 62 7.5 63 4.0 64 2.5 65 2.5 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.0500000000000003 2 1.825 3 2.1999999999999997 4 3.075 5 3.175 6 2.675 7 2.6 8 2.35 9 2.75 10-14 2.875 15-19 3.6350000000000002 20-24 2.86 25-29 2.685 30-34 2.7199999999999998 35-39 2.9499999999999997 40-44 3.47 45-49 3.335 50-54 2.535 55-59 2.69 60-64 2.555 65-69 2.5100000000000002 70-74 2.01 75-79 2.005 80-84 2.59 85-89 3.8899999999999997 90-94 4.545 95-99 2.88 100-104 2.4299999999999997 105-109 2.8049999999999997 110-114 2.815 115-119 2.35 120-124 1.775 125-129 3.08 130-134 5.82 135-139 8.285 140-144 9.55 145-149 5.99 150-151 3.4000000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56499488229274 97.275 2 0.35823950870010235 0.7000000000000001 3 0.0255885363357216 0.075 4 0.0 0.0 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0255885363357216 1.825 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 73 1.825 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8374999999999999 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 1.9249999999999998 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.4 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.0375 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.8 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.825 0.0 0.0 0.0 0.0 124-125 5.300000000000001 0.0 0.0 0.0 0.0 126-127 5.699999999999999 0.0 0.0 0.0 0.0 128-129 6.1125 0.0 0.0 0.0 0.0 130-131 6.7875 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.612500000000001 0.0 0.0 0.0 0.0 136-137 7.875 0.0 0.0 0.0 0.0 138-139 8.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACCAA 10 0.007200583 142.44304 7 >>END_MODULE Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818393 spots for SRR7169933.sra Written 818393 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra Read 818375 spots for SRR7169933.sra Written 818375 spots for SRR7169933.sra SRR ids: ['SRR7169933.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jttr2u5n SRR7169933.sra spots: 16367518 blocks: [[1, 818375], [818376, 1636750], [1636751, 2455125], [2455126, 3273500], [3273501, 4091875], [4091876, 4910250], [4910251, 5728625], [5728626, 6547000], [6547001, 7365375], [7365376, 8183750], [8183751, 9002125], [9002126, 9820500], [9820501, 10638875], [10638876, 11457250], [11457251, 12275625], [12275626, 13094000], [13094001, 13912375], [13912376, 14730750], [14730751, 15549125], [15549126, 16367518]] SRR7169933 file size 5524714 SRR7169933 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169933 SRR7169933_1.fastq SRR7169933_2.fastq Input file: SRR7169933_1.fastq Paired file: SRR7169933_2.fastq trimmed: SRR7169933-trimmed-pair1.fastq, SRR7169933-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:22:18 2025 >> started Wed Feb 12 03:22:35 2025 >> done (17.178s) 16367518 read pairs processed; of these: 20671 ( 0.13%) short read pairs filtered out after trimming by size control 32998 ( 0.20%) empty read pairs filtered out after trimming by size control 16313849 (99.67%) read pairs available; of these: 7770187 (47.63%) trimmed read pairs available after processing 8543662 (52.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 9 0.00% 22 4 0.00% 23 8 0.00% 24 1 0.00% 25 8 0.00% 26 9 0.00% 27 13 0.00% 28 14 0.00% 29 10 0.00% 30 11 0.00% 31 20 0.00% 32 13 0.00% 33 15 0.00% 34 6 0.00% 35 16 0.00% 36 21 0.00% 37 20 0.00% 38 22 0.00% 39 17 0.00% 40 31 0.00% 41 39 0.00% 42 37 0.00% 43 53 0.00% 44 36 0.00% 45 57 0.00% 46 69 0.00% 47 59 0.00% 48 81 0.00% 49 85 0.00% 50 93 0.00% 51 106 0.00% 52 129 0.00% 53 149 0.00% 54 166 0.00% 55 171 0.00% 56 203 0.00% 57 210 0.00% 58 227 0.00% 59 287 0.00% 60 317 0.00% 61 404 0.00% 62 467 0.00% 63 507 0.00% 64 534 0.00% 65 593 0.00% 66 687 0.00% 67 786 0.00% 68 876 0.01% 69 1234 0.01% 70 1846 0.01% 71 1588 0.01% 72 1573 0.01% 73 1840 0.01% 74 2022 0.01% 75 2200 0.01% 76 2396 0.01% 77 2584 0.02% 78 3029 0.02% 79 3283 0.02% 80 3711 0.02% 81 4298 0.03% 82 4715 0.03% 83 5187 0.03% 84 6853 0.04% 85 7559 0.05% 86 8124 0.05% 87 8860 0.05% 88 9297 0.06% 89 9788 0.06% 90 10369 0.06% 91 11221 0.07% 92 11913 0.07% 93 13034 0.08% 94 14198 0.09% 95 15077 0.09% 96 15933 0.10% 97 16351 0.10% 98 16976 0.10% 99 18137 0.11% 100 18838 0.12% 101 19649 0.12% 102 21135 0.13% 103 22359 0.14% 104 23298 0.14% 105 24485 0.15% 106 26261 0.16% 107 26746 0.16% 108 27344 0.17% 109 28239 0.17% 110 29152 0.18% 111 30203 0.19% 112 31347 0.19% 113 32858 0.20% 114 34679 0.21% 115 35832 0.22% 116 37398 0.23% 117 38618 0.24% 118 39757 0.24% 119 40091 0.25% 120 40987 0.25% 121 42424 0.26% 122 43458 0.27% 123 45101 0.28% 124 47775 0.29% 125 49046 0.30% 126 51001 0.31% 127 53450 0.33% 128 55765 0.34% 129 56708 0.35% 130 58240 0.36% 131 59522 0.36% 132 62411 0.38% 133 64662 0.40% 134 68661 0.42% 135 72390 0.44% 136 76358 0.47% 137 80913 0.50% 138 87461 0.54% 139 94734 0.58% 140 99869 0.61% 141 107675 0.66% 142 115434 0.71% 143 124414 0.76% 144 139385 0.85% 145 157431 0.97% 146 190296 1.17% 147 244266 1.50% 148 343628 2.11% 149 639056 3.92% 150 3566476 21.86% 151 8543662 52.37% 16313849 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.15 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=245.75 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=54.96 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=12.6 sequence=TCAAGGAAGCTTTCAG SRR7169933 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:23:23 Started mapping on | Feb 12 03:23:23 Finished on | Feb 12 03:24:45 Mapping speed, Million of reads per hour | 716.22 Number of input reads | 16313849 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15540716 Uniquely mapped reads % | 95.26% Average mapped length | 292.04 Number of splices: Total | 14260969 Number of splices: Annotated (sjdb) | 14012491 Number of splices: GT/AG | 14052470 Number of splices: GC/AG | 164575 Number of splices: AT/AC | 11487 Number of splices: Non-canonical | 32437 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283020 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 37082 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 509557 509557 509557 N_multimapping 283020 283020 283020 N_noFeature 357983 15338640 461308 N_ambiguous 160130 1110 60574 UnstrandedReadsAssigned:15022603 PositiveStrandReadsAssigned:200966 NegativeStrandReadsAssigned:15018834 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169933 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169933-trimmed-pair1.fastq SRR7169933-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,313,849 reads, 14,933,708 reads pseudoaligned [quant] estimated average fragment length: 224.952 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR7169933.ke.tsv 34699 SRR7169933.se.tsv 87100 total ==> SRR7169933.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.05 317 12.0642 Potri.005G024800.1.v4.1 1035 811.048 32 2.69388 Potri.004G059700.1.v4.1 961 737.085 3 0.277894 Potri.007G009000.2.v4.1 1416 1192.05 0 0 Potri.003G141000.2.v4.1 2943 2719.05 280.101 7.03353 Potri.016G087400.1.v4.1 270 86.6201 1673.62 1319.21 Potri.015G069301.1.v4.1 564 343.725 0 0 Potri.010G195200.1.v4.1 1773 1549.05 34 1.49861 Potri.012G127500.1.v4.1 977 753.075 2696 244.431 ==> SRR7169933.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2038 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 337 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169933 completed mapping pipeline successfully