Starting /dee2/code/volunteer_pipeline.sh SRR7169934 current disk space = 3048976793600 free memory = 1520111756 SRR7169934 SRAfilesize 78c7a7f08605ef17125a1837fdf7289c SRR7169934.sra SRR7169934.sra file validated SRR7169934 is paired end SRR7169934 is conventional basespace SRR7169934 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169934_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26675 34.0 33.0 34.0 33.0 34.0 2 33.5125 34.0 34.0 34.0 33.0 34.0 3 33.514 34.0 34.0 34.0 33.0 34.0 4 33.539 34.0 34.0 34.0 33.0 34.0 5 33.49875 34.0 34.0 34.0 33.0 34.0 6 37.29775 38.0 38.0 38.0 36.0 38.0 7 37.502 38.0 38.0 38.0 37.0 38.0 8 37.61275 38.0 38.0 38.0 38.0 38.0 9 37.57875 38.0 38.0 38.0 38.0 38.0 10-14 37.584649999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.585249999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.55625 38.0 38.0 38.0 38.0 38.0 25-29 37.54025 38.0 38.0 38.0 38.0 38.0 30-34 37.506099999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.46295 38.0 38.0 38.0 37.4 38.0 40-44 37.312400000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.197050000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.24125 38.0 38.0 38.0 36.6 38.0 55-59 37.1552 38.0 38.0 38.0 36.2 38.0 60-64 37.1434 38.0 38.0 38.0 36.0 38.0 65-69 37.08535 38.0 38.0 38.0 36.0 38.0 70-74 37.05695 38.0 38.0 38.0 36.0 38.0 75-79 36.9465 38.0 38.0 38.0 36.0 38.0 80-84 36.90794999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.79925 38.0 38.0 38.0 35.0 38.0 90-94 36.6357 38.0 38.0 38.0 34.6 38.0 95-99 36.466300000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.40525 38.0 38.0 38.0 34.0 38.0 105-109 36.35 38.0 38.0 38.0 34.0 38.0 110-114 36.16054999999999 38.0 37.4 38.0 33.4 38.0 115-119 36.050399999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.8346 38.0 36.8 38.0 32.4 38.0 125-129 35.64575 38.0 36.6 38.0 31.4 38.0 130-134 35.1942 38.0 36.0 38.0 29.4 38.0 135-139 34.73630000000001 38.0 35.4 38.0 27.6 38.0 140-144 34.6738 38.0 35.4 38.0 27.6 38.0 145-149 33.77974999999999 38.0 34.8 38.0 21.6 38.0 150-151 29.941249999999997 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 1.0 17 1.0 18 2.0 19 2.0 20 5.0 21 6.0 22 3.0 23 7.0 24 6.0 25 8.0 26 20.0 27 24.0 28 22.0 29 35.0 30 44.0 31 52.0 32 67.0 33 82.0 34 159.0 35 253.0 36 588.0 37 2605.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.70528967254408 12.418136020151135 10.025188916876575 36.85138539042821 2 23.25 14.799999999999999 33.15 28.799999999999997 3 18.975 19.275000000000002 26.474999999999998 35.275 4 22.05 28.1 23.05 26.8 5 23.0 31.324999999999996 24.0 21.675 6 19.950000000000003 34.825 24.275 20.95 7 15.475 26.025 40.725 17.775 8 18.175 26.35 29.925 25.55 9 17.5 25.324999999999996 33.4 23.775 10-14 20.405 29.415000000000003 26.855 23.325000000000003 15-19 19.97 28.22 28.175 23.635 20-24 20.09 28.035 27.939999999999998 23.935000000000002 25-29 20.075000000000003 28.854999999999997 27.744999999999997 23.325000000000003 30-34 20.080000000000002 28.389999999999997 27.065 24.465 35-39 19.66 28.194999999999997 27.689999999999998 24.455 40-44 19.545 29.205 27.639999999999997 23.61 45-49 21.014710297208044 28.404883418392874 27.108976283398377 23.4714300010007 50-54 20.62 28.285 27.51 23.585 55-59 20.19 28.075 27.175 24.560000000000002 60-64 19.905 28.26 27.765 24.07 65-69 20.57 28.244999999999997 27.175 24.01 70-74 20.62 27.639999999999997 28.015 23.724999999999998 75-79 20.68 28.055000000000003 27.339999999999996 23.925 80-84 20.375 28.749999999999996 26.82 24.055 85-89 21.48537134283571 27.926981745436358 26.71167791947987 23.875968992248062 90-94 20.38577154308617 28.34669338677355 27.259519038076153 24.008016032064127 95-99 20.456029330520817 28.49681080809603 27.427050374165034 23.620109487218123 100-104 20.64183438470011 28.21167517773105 27.821167517773105 23.325322919795735 105-109 21.013151972795917 28.69930489573436 26.483972595889384 23.803570535580338 110-114 20.6986287658893 28.36552897607847 27.05935341807627 23.87648883995596 115-119 21.255 28.18 26.71 23.855 120-124 21.27 27.860000000000003 27.060000000000002 23.810000000000002 125-129 21.14 28.475 26.99 23.395 130-134 21.16155542192824 28.126879134095006 26.753858488675085 23.957706955301663 135-139 20.74267624742475 27.96844379679413 27.038842269232706 24.250037686548414 140-144 20.766068384638526 28.271332598014638 27.08813797252582 23.874461044821015 145-149 21.19815668202765 28.616509717491486 26.552795031055897 23.632538569424966 150-151 20.537836147592245 27.717323327079423 27.292057535959973 24.452782989368355 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 3.0 24 3.0 25 1.5 26 3.0 27 4.0 28 8.5 29 12.5 30 16.5 31 18.0 32 20.0 33 32.5 34 53.0 35 64.5 36 76.5 37 96.5 38 127.0 39 148.5 40 170.5 41 210.0 42 223.5 43 254.5 44 287.5 45 262.5 46 263.0 47 270.0 48 249.5 49 227.5 50 189.5 51 149.0 52 126.0 53 115.0 54 81.0 55 55.5 56 46.0 57 34.0 58 24.0 59 15.5 60 12.0 61 10.0 62 7.5 63 5.5 64 3.5 65 4.0 66 3.0 67 1.5 68 2.0 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.06999999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.2 95-99 0.445 100-104 0.13 105-109 0.015 110-114 0.09 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.22 135-139 0.49500000000000005 140-144 0.27 145-149 0.18 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1375000000000002 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 3.0625 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.175 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 4.9 0.0 0.0 0.0 0.0 128-129 5.1375 0.0 0.0 0.0 0.0 130-131 5.449999999999999 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.574999999999999 0.0 0.0 0.0 0.0 138-139 7.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169934 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169934_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27075 33.0 33.0 34.0 32.0 34.0 2 32.337 34.0 33.0 34.0 32.0 34.0 3 32.305 34.0 33.0 34.0 32.0 34.0 4 32.086 34.0 33.0 34.0 32.0 34.0 5 32.07275 34.0 33.0 34.0 32.0 34.0 6 36.223 38.0 38.0 38.0 35.0 38.0 7 36.2095 38.0 38.0 38.0 35.0 38.0 8 36.28 38.0 38.0 38.0 36.0 38.0 9 36.21225 38.0 38.0 38.0 36.0 38.0 10-14 36.2057 38.0 38.0 38.0 35.8 38.0 15-19 35.96975 38.0 38.0 38.0 35.6 38.0 20-24 36.1443 38.0 38.0 38.0 35.8 38.0 25-29 36.277499999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.24115 38.0 38.0 38.0 36.0 38.0 35-39 36.2134 38.0 38.0 38.0 36.0 38.0 40-44 36.007000000000005 38.0 38.0 38.0 35.8 38.0 45-49 35.8754 38.0 38.0 38.0 34.6 38.0 50-54 36.16015 38.0 38.0 38.0 35.8 38.0 55-59 36.1212 38.0 38.0 38.0 35.6 38.0 60-64 36.10515 38.0 38.0 38.0 35.0 38.0 65-69 36.0503 38.0 38.0 38.0 35.0 38.0 70-74 35.950450000000004 38.0 38.0 38.0 34.4 38.0 75-79 35.9166 38.0 38.0 38.0 34.0 38.0 80-84 35.79344999999999 38.0 38.0 38.0 34.0 38.0 85-89 35.4157 38.0 38.0 38.0 32.6 38.0 90-94 35.011100000000006 38.0 38.0 38.0 29.4 38.0 95-99 35.36135 38.0 38.0 38.0 30.4 38.0 100-104 35.4719 38.0 38.0 38.0 32.8 38.0 105-109 35.26235 38.0 38.0 38.0 31.0 38.0 110-114 35.13905 38.0 37.8 38.0 30.2 38.0 115-119 34.823350000000005 38.0 37.0 38.0 27.8 38.0 120-124 34.83545 38.0 37.0 38.0 28.0 38.0 125-129 34.367399999999996 38.0 36.4 38.0 24.8 38.0 130-134 33.26685 38.0 35.6 38.0 15.4 38.0 135-139 31.968999999999994 38.0 34.2 38.0 2.0 38.0 140-144 31.111399999999996 38.0 33.2 38.0 2.0 38.0 145-149 30.5062 38.0 32.2 38.0 2.0 38.0 150-151 26.87725 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 99.0 3 8.0 4 0.0 5 0.0 6 2.0 7 2.0 8 2.0 9 0.0 10 2.0 11 2.0 12 5.0 13 1.0 14 4.0 15 6.0 16 4.0 17 4.0 18 6.0 19 4.0 20 8.0 21 10.0 22 14.0 23 18.0 24 11.0 25 22.0 26 30.0 27 34.0 28 37.0 29 49.0 30 53.0 31 69.0 32 102.0 33 132.0 34 149.0 35 198.0 36 454.0 37 2459.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.098419173890875 21.9020907700153 14.660887302396736 26.338602753697092 2 28.30667682152831 27.545062198527543 27.062706270627064 17.085554709317087 3 20.628031656880268 29.180495276997704 30.559101353076336 19.6323717130457 4 23.444730077120823 34.37017994858611 22.339331619537276 19.845758354755784 5 23.756763720690543 35.76397835609379 23.00953362535429 17.469724297861376 6 21.82377049180328 37.3719262295082 22.515368852459016 18.28893442622951 7 20.67110655737705 21.08094262295082 38.49897540983606 19.748975409836063 8 22.364380757420676 25.511770726714435 26.688843398157623 25.435005117707266 9 21.175564681724847 26.463039014373717 29.568788501026695 22.79260780287474 10-14 23.174049171072216 29.261407380793514 25.83277729302469 21.731766155109582 15-19 22.9004082898341 27.872241459506952 27.08667114579565 22.1406791048633 20-24 22.968252337408813 28.506113223055586 27.262919963012433 21.26271447652317 25-29 23.189372178908492 28.410956093557655 27.149158801805502 21.250512925728355 30-34 23.318799692228776 28.18158502180046 27.560913054629392 20.93870223134137 35-39 23.3532011098551 28.655842153941013 27.08868564381872 20.90227109238516 40-44 24.090791849368067 27.939128191900952 27.43874129481558 20.5313386639154 45-49 23.354312835328106 28.00763516302105 27.507222451506397 21.13082955014445 50-54 23.372432515494545 27.869692157967524 27.63919479588178 21.11868053065615 55-59 23.53212655761243 27.931900928157532 27.772934721296345 20.763037792933694 60-64 24.065157258477615 27.748181538776766 27.947956152033605 20.238705050712017 65-69 23.611964761319403 26.74144642491293 28.544355664822785 21.102233148944887 70-74 23.910939012584706 27.50292963774392 27.462169460437153 21.12396188923422 75-79 23.32772937999898 28.10637322329207 27.678434968668807 20.887462428040145 80-84 23.391063742570196 27.00860832137733 28.679032588645214 20.921295347407256 85-89 24.166537045678435 26.70192357546534 27.479649504847824 21.651889874008397 90-94 24.09670008354219 26.973684210526315 27.82999164578112 21.099624060150376 95-99 23.257486260208537 27.962401766911498 27.674765011043196 21.105346961836766 100-104 23.921167135909904 27.591502431533144 27.49936012285641 20.987970309700536 105-109 24.36746215037208 27.32358224275083 27.539132666153453 20.769822940723635 110-114 24.504569257623988 26.876476024232467 27.59010165314714 21.028853064996404 115-119 23.755239750536756 28.013495552601984 27.047336673141803 21.183928023719456 120-124 24.571022438826276 26.957051477307342 27.754086709310588 20.717839374555794 125-129 24.846862613887886 27.930200236783858 27.091161785144386 20.131775364183866 130-134 24.94031513608149 26.993474454878243 27.72030346437477 20.345906944665497 135-139 24.70748299319728 27.68979591836735 27.472108843537413 20.130612244897957 140-144 25.251687133532467 28.117048346055977 26.98860493417413 19.642659586237414 145-149 25.14591955852701 28.48349782447204 26.424705507800063 19.94587710920089 150-151 25.325596389426174 27.23404255319149 27.530625402965832 19.909735654416505 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 65.0 1 35.0 2 3.0 3 3.0 4 4.5 5 4.0 6 3.0 7 3.0 8 2.5 9 1.0 10 1.0 11 1.5 12 1.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 2.0 23 1.5 24 2.5 25 3.5 26 4.0 27 4.0 28 3.5 29 7.0 30 9.5 31 10.5 32 16.5 33 27.0 34 39.5 35 50.0 36 77.0 37 103.0 38 115.0 39 146.5 40 180.5 41 217.0 42 254.5 43 252.5 44 267.5 45 293.0 46 285.5 47 267.5 48 240.5 49 208.5 50 179.5 51 152.5 52 112.0 53 89.0 54 78.5 55 53.0 56 37.0 57 31.0 58 26.0 59 17.5 60 7.5 61 3.5 62 2.5 63 5.0 64 3.5 65 2.0 66 2.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.95 2 1.525 3 2.075 4 2.75 5 2.9749999999999996 6 2.4 7 2.4 8 2.3 9 2.6 10-14 2.585 15-19 3.2550000000000003 20-24 2.67 25-29 2.52 30-34 2.5250000000000004 35-39 2.69 40-44 3.075 45-49 3.08 50-54 2.385 55-59 2.495 60-64 2.39 65-69 2.3800000000000003 70-74 1.865 75-79 1.855 80-84 2.42 85-89 3.565 90-94 4.24 95-99 2.6550000000000002 100-104 2.325 105-109 2.5749999999999997 110-114 2.6100000000000003 115-119 2.19 120-124 1.51 125-129 2.8649999999999998 130-134 5.755 135-139 8.125 140-144 9.610000000000001 145-149 5.7700000000000005 150-151 3.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.38587512794268 97.1 2 0.511770726714432 1.0 3 0.0255885363357216 0.075 4 0.0 0.0 5 0.0255885363357216 0.125 6 0.0 0.0 7 0.0255885363357216 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0255885363357216 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 61 1.525 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.5874999999999999 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 4.825 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.25 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGACTC 10 0.007025683 143.57143 8 GAAGGGA 10 0.007025683 143.57143 3 AAAAAAA 40 0.0059372173 18.929794 140-144 >>END_MODULE Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769896 spots for SRR7169934.sra Written 769896 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra Read 769880 spots for SRR7169934.sra Written 769880 spots for SRR7169934.sra SRR ids: ['SRR7169934.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_buw7itih SRR7169934.sra spots: 15397616 blocks: [[1, 769880], [769881, 1539760], [1539761, 2309640], [2309641, 3079520], [3079521, 3849400], [3849401, 4619280], [4619281, 5389160], [5389161, 6159040], [6159041, 6928920], [6928921, 7698800], [7698801, 8468680], [8468681, 9238560], [9238561, 10008440], [10008441, 10778320], [10778321, 11548200], [11548201, 12318080], [12318081, 13087960], [13087961, 13857840], [13857841, 14627720], [14627721, 15397616]] SRR7169934 file size 5196046 SRR7169934 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169934 SRR7169934_1.fastq SRR7169934_2.fastq Input file: SRR7169934_1.fastq Paired file: SRR7169934_2.fastq trimmed: SRR7169934-trimmed-pair1.fastq, SRR7169934-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:47:54 2025 >> started Wed Feb 12 03:48:12 2025 >> done (18.366s) 15397616 read pairs processed; of these: 18176 ( 0.12%) short read pairs filtered out after trimming by size control 28523 ( 0.19%) empty read pairs filtered out after trimming by size control 15350917 (99.70%) read pairs available; of these: 7324913 (47.72%) trimmed read pairs available after processing 8026004 (52.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 4 0.00% 22 5 0.00% 23 2 0.00% 24 9 0.00% 25 2 0.00% 26 3 0.00% 27 10 0.00% 28 8 0.00% 29 7 0.00% 30 8 0.00% 31 8 0.00% 32 12 0.00% 33 11 0.00% 34 11 0.00% 35 12 0.00% 36 17 0.00% 37 19 0.00% 38 22 0.00% 39 20 0.00% 40 20 0.00% 41 22 0.00% 42 20 0.00% 43 23 0.00% 44 30 0.00% 45 47 0.00% 46 38 0.00% 47 47 0.00% 48 56 0.00% 49 81 0.00% 50 68 0.00% 51 95 0.00% 52 121 0.00% 53 108 0.00% 54 126 0.00% 55 136 0.00% 56 134 0.00% 57 148 0.00% 58 199 0.00% 59 217 0.00% 60 192 0.00% 61 282 0.00% 62 282 0.00% 63 345 0.00% 64 387 0.00% 65 413 0.00% 66 454 0.00% 67 575 0.00% 68 665 0.00% 69 816 0.01% 70 984 0.01% 71 952 0.01% 72 1022 0.01% 73 1218 0.01% 74 1358 0.01% 75 1561 0.01% 76 1670 0.01% 77 1756 0.01% 78 2046 0.01% 79 2204 0.01% 80 2523 0.02% 81 2910 0.02% 82 3378 0.02% 83 3799 0.02% 84 4857 0.03% 85 5799 0.04% 86 5982 0.04% 87 6419 0.04% 88 6934 0.05% 89 7223 0.05% 90 7885 0.05% 91 8445 0.06% 92 8984 0.06% 93 9903 0.06% 94 10509 0.07% 95 11339 0.07% 96 11947 0.08% 97 12498 0.08% 98 13100 0.09% 99 13444 0.09% 100 14463 0.09% 101 15010 0.10% 102 16301 0.11% 103 17565 0.11% 104 18317 0.12% 105 19929 0.13% 106 20734 0.14% 107 21172 0.14% 108 21703 0.14% 109 22801 0.15% 110 23109 0.15% 111 24091 0.16% 112 25717 0.17% 113 26653 0.17% 114 28389 0.18% 115 29531 0.19% 116 30434 0.20% 117 31564 0.21% 118 32338 0.21% 119 32921 0.21% 120 33873 0.22% 121 34755 0.23% 122 36536 0.24% 123 38126 0.25% 124 40186 0.26% 125 42184 0.27% 126 43711 0.28% 127 45404 0.30% 128 46484 0.30% 129 48500 0.32% 130 49291 0.32% 131 51725 0.34% 132 53805 0.35% 133 57155 0.37% 134 60584 0.39% 135 64101 0.42% 136 68477 0.45% 137 73126 0.48% 138 78896 0.51% 139 85823 0.56% 140 90805 0.59% 141 98609 0.64% 142 107958 0.70% 143 116601 0.76% 144 132781 0.86% 145 153008 1.00% 146 186352 1.21% 147 244085 1.59% 148 347716 2.27% 149 656836 4.28% 150 3485675 22.71% 151 8026004 52.28% 15350917 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=253.13 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=28 prefix-density=0.33 prefix-fanout=3.3 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=235.12 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=25.7 sequence=GAAGAAGAAGAAA SRR7169934 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:49:00 Started mapping on | Feb 12 03:49:00 Finished on | Feb 12 03:50:44 Mapping speed, Million of reads per hour | 531.38 Number of input reads | 15350917 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14491708 Uniquely mapped reads % | 94.40% Average mapped length | 293.13 Number of splices: Total | 14062615 Number of splices: Annotated (sjdb) | 13837680 Number of splices: GT/AG | 13855377 Number of splices: GC/AG | 168097 Number of splices: AT/AC | 11694 Number of splices: Non-canonical | 27447 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263991 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 25101 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.68% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 611635 611635 611635 N_multimapping 263991 263991 263991 N_noFeature 288870 14329881 367400 N_ambiguous 140625 833 56714 UnstrandedReadsAssigned:14062213 PositiveStrandReadsAssigned:160994 NegativeStrandReadsAssigned:14067594 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169934 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169934-trimmed-pair1.fastq SRR7169934-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,350,917 reads, 13,999,065 reads pseudoaligned [quant] estimated average fragment length: 238.676 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR7169934.ke.tsv 34699 SRR7169934.se.tsv 87100 total ==> SRR7169934.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.32 240 9.84813 Potri.005G024800.1.v4.1 1035 797.324 42 3.84818 Potri.004G059700.1.v4.1 961 723.379 0 0 Potri.007G009000.2.v4.1 1416 1178.32 0 0 Potri.003G141000.2.v4.1 2943 2705.32 277.03 7.48081 Potri.016G087400.1.v4.1 270 84.2094 1076.55 933.932 Potri.015G069301.1.v4.1 564 332.118 0 0 Potri.010G195200.1.v4.1 1773 1535.32 9 0.428237 Potri.012G127500.1.v4.1 977 739.349 6419 634.248 ==> SRR7169934.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 906 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 198 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169934 completed mapping pipeline successfully