Starting /dee2/code/volunteer_pipeline.sh SRR7169935 current disk space = 3048884690944 free memory = 1579240608 SRR7169935 SRAfilesize 6ba0312b513cb706c1b93a41e1e119f8 SRR7169935.sra SRR7169935.sra file validated SRR7169935 is paired end SRR7169935 is conventional basespace SRR7169935 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169935_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.171 34.0 33.0 34.0 33.0 34.0 2 33.4255 34.0 34.0 34.0 33.0 34.0 3 33.4685 34.0 34.0 34.0 33.0 34.0 4 33.50375 34.0 34.0 34.0 33.0 34.0 5 33.49725 34.0 34.0 34.0 33.0 34.0 6 37.2715 38.0 38.0 38.0 36.0 38.0 7 37.481 38.0 38.0 38.0 37.0 38.0 8 37.61775 38.0 38.0 38.0 38.0 38.0 9 37.56675 38.0 38.0 38.0 38.0 38.0 10-14 37.53705 38.0 38.0 38.0 38.0 38.0 15-19 37.5555 38.0 38.0 38.0 38.0 38.0 20-24 37.511849999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.51915 38.0 38.0 38.0 38.0 38.0 30-34 37.4856 38.0 38.0 38.0 38.0 38.0 35-39 37.410599999999995 38.0 38.0 38.0 37.2 38.0 40-44 37.3022 38.0 38.0 38.0 37.0 38.0 45-49 37.2116 38.0 38.0 38.0 37.0 38.0 50-54 37.21105000000001 38.0 38.0 38.0 36.8 38.0 55-59 37.17935 38.0 38.0 38.0 36.8 38.0 60-64 37.1671 38.0 38.0 38.0 36.6 38.0 65-69 37.1288 38.0 38.0 38.0 36.0 38.0 70-74 37.0642 38.0 38.0 38.0 36.0 38.0 75-79 36.95675 38.0 38.0 38.0 36.0 38.0 80-84 36.853899999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.833000000000006 38.0 38.0 38.0 35.2 38.0 90-94 36.668 38.0 38.0 38.0 35.0 38.0 95-99 36.4471 38.0 38.0 38.0 34.0 38.0 100-104 36.354099999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.388099999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.27165 38.0 38.0 38.0 34.0 38.0 115-119 36.10795 38.0 37.8 38.0 33.4 38.0 120-124 35.92255 38.0 37.4 38.0 32.6 38.0 125-129 35.757450000000006 38.0 36.6 38.0 31.8 38.0 130-134 35.18335 38.0 36.0 38.0 29.6 38.0 135-139 34.7603 38.0 35.6 38.0 27.6 38.0 140-144 34.765499999999996 38.0 35.8 38.0 28.0 38.0 145-149 33.77525 38.0 35.0 38.0 22.4 38.0 150-151 30.1775 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 1.0 17 2.0 18 5.0 19 3.0 20 4.0 21 6.0 22 7.0 23 8.0 24 15.0 25 9.0 26 30.0 27 23.0 28 22.0 29 29.0 30 44.0 31 48.0 32 57.0 33 88.0 34 120.0 35 233.0 36 498.0 37 2743.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.81391830559758 12.43066061522945 8.900655572365103 35.854765506807865 2 23.799999999999997 13.350000000000001 31.95 30.9 3 19.15 18.975 26.8 35.075 4 23.175 25.174999999999997 23.674999999999997 27.975 5 22.45 31.95 23.599999999999998 22.0 6 20.05 34.975 24.375 20.599999999999998 7 15.55 27.55 38.925 17.974999999999998 8 18.65 26.474999999999998 29.775000000000002 25.1 9 17.7 25.75 32.175 24.375 10-14 19.74 30.125 26.919999999999998 23.215 15-19 20.435 28.410000000000004 27.46 23.695 20-24 19.965 28.485 27.61 23.94 25-29 19.72 28.675 27.860000000000003 23.745 30-34 19.97 28.79 27.255000000000003 23.985 35-39 19.96 28.27 27.345000000000002 24.425 40-44 20.435 28.42 26.919999999999998 24.224999999999998 45-49 20.26519889917438 27.350512884663498 28.04103077307981 24.34325744308231 50-54 20.1 28.555000000000003 27.384999999999998 23.96 55-59 20.22 27.544999999999998 27.889999999999997 24.345 60-64 20.59 27.985 27.134999999999998 24.29 65-69 20.53 28.825 26.669999999999998 23.974999999999998 70-74 21.09 28.1 27.46 23.35 75-79 20.165 27.785 27.485 24.565 80-84 20.724999999999998 28.255000000000003 26.640000000000004 24.38 85-89 21.370342585646412 27.711927981995498 27.22680670167542 23.69092273068267 90-94 21.173699508870403 27.443119174100435 27.052220106244363 24.330961210784803 95-99 20.906851656361532 27.66802392801488 27.155280752023327 24.26984366360026 100-104 21.546242050973913 28.185869510790646 26.318161333934203 23.949727104301235 105-109 21.16211621162116 28.28782878287829 27.15271527152715 23.397339733973396 110-114 21.318120402341993 27.9737777110544 26.977931241555318 23.73017064504829 115-119 20.880000000000003 27.975 26.325 24.82 120-124 21.17 27.744999999999997 26.905 24.18 125-129 21.365000000000002 27.634999999999998 26.86 24.14 130-134 20.83730258210078 27.275006267234897 27.600902481825017 24.286788668839307 135-139 21.398742138364778 27.68301886792453 27.079245283018867 23.838993710691824 140-144 21.18006817726088 27.802285943452976 26.544014437537598 24.473631441748548 145-149 21.383490282508514 27.51953516329393 26.713083550390703 24.383891003806852 150-151 21.635817908954476 27.463731865932967 26.900950475237618 23.999499749874936 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 1.0 25 2.0 26 4.5 27 7.0 28 11.0 29 12.5 30 15.0 31 18.0 32 30.0 33 39.5 34 45.5 35 64.5 36 77.0 37 88.0 38 109.5 39 134.5 40 166.5 41 207.5 42 228.0 43 246.5 44 267.5 45 262.5 46 251.5 47 248.5 48 239.5 49 215.0 50 191.0 51 167.0 52 143.0 53 127.0 54 99.0 55 62.0 56 45.0 57 41.0 58 33.0 59 24.0 60 18.0 61 12.0 62 8.0 63 7.5 64 5.0 65 2.5 66 3.5 67 4.0 68 2.0 69 2.0 70 3.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.075 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.22999999999999998 95-99 0.5349999999999999 100-104 0.145 105-109 0.01 110-114 0.08499999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.27499999999999997 135-139 0.625 140-144 0.26 145-149 0.18 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0125 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.9375 0.0 0.0 0.0 0.0 106-107 2.2750000000000004 0.0 0.0 0.0 0.0 108-109 2.575 0.0 0.0 0.0 0.0 110-111 2.7375 0.0 0.0 0.0 0.0 112-113 3.05 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.975 0.0 0.0 0.0 0.0 124-125 5.300000000000001 0.0 0.0 0.0 0.0 126-127 5.7625 0.0 0.0 0.0 0.0 128-129 6.325 0.0 0.0 0.0 0.0 130-131 6.725 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.037500000000001 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGAAAG 10 0.006830828 145.0 2 ATTTCCA 10 0.006830828 145.0 5 GGAAAGA 10 0.006830828 145.0 3 >>END_MODULE SRR7169935 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169935_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.18175 33.0 33.0 34.0 32.0 34.0 2 32.22825 34.0 33.0 34.0 32.0 34.0 3 32.25975 34.0 33.0 34.0 32.0 34.0 4 31.8265 34.0 33.0 34.0 31.0 34.0 5 31.882 34.0 33.0 34.0 32.0 34.0 6 35.88825 38.0 38.0 38.0 34.0 38.0 7 35.99125 38.0 38.0 38.0 35.0 38.0 8 35.892 38.0 38.0 38.0 34.0 38.0 9 35.96275 38.0 38.0 38.0 35.0 38.0 10-14 35.8758 38.0 38.0 38.0 34.4 38.0 15-19 35.66865 38.0 38.0 38.0 34.0 38.0 20-24 35.7724 38.0 38.0 38.0 34.0 38.0 25-29 35.91185 38.0 38.0 38.0 34.8 38.0 30-34 35.89475 38.0 38.0 38.0 34.8 38.0 35-39 35.7855 38.0 38.0 38.0 34.4 38.0 40-44 35.6382 38.0 38.0 38.0 34.0 38.0 45-49 35.57755 38.0 38.0 38.0 34.0 38.0 50-54 35.763099999999994 38.0 38.0 38.0 34.0 38.0 55-59 35.763949999999994 38.0 38.0 38.0 34.2 38.0 60-64 35.713800000000006 38.0 38.0 38.0 34.2 38.0 65-69 35.69505 38.0 38.0 38.0 33.8 38.0 70-74 35.603899999999996 38.0 38.0 38.0 33.6 38.0 75-79 35.52445 38.0 38.0 38.0 33.0 38.0 80-84 35.43755 38.0 38.0 38.0 32.8 38.0 85-89 35.03939999999999 38.0 38.0 38.0 30.0 38.0 90-94 34.719049999999996 38.0 38.0 38.0 27.8 38.0 95-99 35.0581 38.0 38.0 38.0 28.8 38.0 100-104 35.089099999999995 38.0 38.0 38.0 30.0 38.0 105-109 34.868050000000004 38.0 38.0 38.0 28.2 38.0 110-114 34.806650000000005 38.0 37.6 38.0 28.0 38.0 115-119 34.52135 38.0 37.0 38.0 26.0 38.0 120-124 34.3117 38.0 36.6 38.0 24.2 38.0 125-129 33.84935 38.0 36.0 38.0 19.0 38.0 130-134 32.92425 38.0 35.4 38.0 11.2 38.0 135-139 31.761699999999998 38.0 34.0 38.0 2.0 38.0 140-144 31.013800000000003 38.0 33.4 38.0 2.0 38.0 145-149 30.3473 38.0 31.6 38.0 2.0 38.0 150-151 26.751375 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 116.0 3 8.0 4 5.0 5 3.0 6 2.0 7 3.0 8 2.0 9 4.0 10 6.0 11 2.0 12 5.0 13 2.0 14 1.0 15 7.0 16 8.0 17 10.0 18 9.0 19 10.0 20 13.0 21 13.0 22 15.0 23 12.0 24 20.0 25 21.0 26 31.0 27 34.0 28 36.0 29 44.0 30 54.0 31 66.0 32 91.0 33 120.0 34 131.0 35 197.0 36 424.0 37 2475.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.720101781170484 20.83969465648855 13.231552162849871 26.208651399491096 2 27.19431760527651 25.6468797564688 29.37595129375951 17.782851344495178 3 21.528662420382165 28.356687898089174 29.554140127388536 20.560509554140125 4 23.39166237776634 32.99022130725682 24.549665465774577 19.068450849202264 5 24.697086878061356 35.550399587522556 22.454240783707142 17.298272750708946 6 21.34975622273544 37.77264562483962 22.478829869130102 18.398768283294842 7 19.92818671454219 23.954860220569376 36.95819440882278 19.158758656065658 8 22.941176470588236 25.882352941176475 26.163682864450127 25.012787723785166 9 22.342064714946073 26.14278376990241 29.070364663585003 22.444786851566512 10-14 23.9812959251837 28.528852576948772 25.820872514259285 21.66897898360824 15-19 23.959842682674395 27.89277582281101 26.888842889670876 21.258538604843718 20-24 23.46078733682804 28.055298591838834 27.06855791962175 21.41535615171138 25-29 24.20712306271169 27.712203633377808 26.670430052345274 21.410243251565227 30-34 23.06783751861552 28.244235608278128 26.92959482360191 21.758332049504443 35-39 23.595967907837895 28.14750051429747 27.01604608105328 21.240485496811356 40-44 23.606303280805992 28.26143115474038 27.233273056057865 20.898992508395764 45-49 24.06461268514218 27.790679671775813 27.537802549414252 20.606905093667752 50-54 23.550520326036807 27.420925821499974 27.595222227918182 21.433331624545033 55-59 24.29964084145716 27.054899948691634 27.46023601847101 21.185223191380196 60-64 23.42596390484003 27.737899917965546 27.59946677604594 21.236669401148482 65-69 24.170081967213115 27.8125 27.16188524590164 20.855532786885245 70-74 24.385652505723733 26.817603663190027 27.34164334774866 21.45510048333757 75-79 24.086885746261064 27.332383762335944 27.388340624682062 21.19238986672093 80-84 24.20189597745324 27.14834742505765 27.9221111965155 20.72764540097361 85-89 24.097510373443985 27.62966804979253 26.91908713692946 21.353734439834025 90-94 24.313602672512786 27.690781918780665 26.939137697045624 21.056477711660925 95-99 23.9372911847854 27.20123361603701 27.674119763556927 21.187355435620663 100-104 24.457411957411956 28.117321867321866 26.668714168714168 20.756552006552006 105-109 24.114021571648692 27.43708269131998 27.380585516178733 21.06831022085259 110-114 24.73792394655704 27.60534429599178 26.69064748201439 20.966084275436796 115-119 24.68726065866735 27.949961705386777 27.13811590502936 20.22466173091652 120-124 25.086276898091757 27.639058059277303 27.197523345513602 20.077141697117337 125-129 25.31521795069734 28.670680870773506 26.40625804127425 19.607843137254903 130-134 25.53191489361702 27.791891605800785 26.225256695247168 20.450936805335026 135-139 25.876054510058406 27.7038719446247 26.481721825654336 19.938351719662556 140-144 25.545529122231336 27.470604320481268 26.852611430133987 20.131255127153405 145-149 25.76086381199386 27.698089239400836 26.40660562112952 20.134441327475784 150-151 25.561580170410537 28.091918409501677 26.452362509682416 19.89413891040537 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 63.0 1 33.5 2 2.5 3 0.5 4 0.5 5 3.0 6 6.0 7 6.5 8 4.0 9 1.5 10 1.5 11 1.5 12 1.5 13 2.0 14 2.5 15 3.0 16 2.0 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 1.5 23 2.0 24 1.5 25 2.0 26 3.0 27 5.0 28 4.5 29 4.5 30 7.5 31 7.5 32 11.5 33 19.5 34 22.0 35 32.0 36 56.5 37 76.5 38 104.0 39 135.0 40 164.5 41 213.5 42 252.0 43 267.0 44 275.5 45 287.5 46 292.5 47 273.0 48 265.5 49 239.0 50 195.0 51 153.5 52 113.0 53 99.0 54 77.5 55 55.5 56 41.5 57 35.5 58 30.0 59 17.5 60 10.5 61 11.5 62 9.0 63 4.0 64 4.0 65 2.5 66 1.5 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.7500000000000002 2 1.4500000000000002 3 1.875 4 2.85 5 3.025 6 2.5749999999999997 7 2.5250000000000004 8 2.25 9 2.65 10-14 2.6950000000000003 15-19 3.38 20-24 2.71 25-29 2.5700000000000003 30-34 2.635 35-39 2.78 40-44 3.225 45-49 3.115 50-54 2.465 55-59 2.55 60-64 2.48 65-69 2.4 70-74 1.725 75-79 1.71 80-84 2.4250000000000003 85-89 3.5999999999999996 90-94 4.21 95-99 2.725 100-104 2.32 105-109 2.65 110-114 2.7 115-119 2.075 120-124 1.48 125-129 2.8449999999999998 130-134 5.53 135-139 7.539999999999999 140-144 8.575000000000001 145-149 5.535 150-151 3.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.30963947839427 97.1 2 0.5625159805676297 1.0999999999999999 3 0.0767067246228586 0.22499999999999998 4 0.0 0.0 5 0.025568908207619537 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025568908207619537 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 58 1.4500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.0125 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.5999999999999996 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.1625 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.7125 0.0 0.0 0.0 0.0 118-119 4.1625 0.0 0.0 0.0 0.0 120-121 4.625 0.0 0.0 0.0 0.0 122-123 5.0375 0.0 0.0 0.0 0.0 124-125 5.387499999999999 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 6.8 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.5 0.0 0.0 0.0 0.0 136-137 7.887499999999999 0.0 0.0 0.0 0.0 138-139 8.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767194 spots for SRR7169935.sra Written 767194 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra Read 767183 spots for SRR7169935.sra Written 767183 spots for SRR7169935.sra SRR ids: ['SRR7169935.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sat0dzxk SRR7169935.sra spots: 15343671 blocks: [[1, 767183], [767184, 1534366], [1534367, 2301549], [2301550, 3068732], [3068733, 3835915], [3835916, 4603098], [4603099, 5370281], [5370282, 6137464], [6137465, 6904647], [6904648, 7671830], [7671831, 8439013], [8439014, 9206196], [9206197, 9973379], [9973380, 10740562], [10740563, 11507745], [11507746, 12274928], [12274929, 13042111], [13042112, 13809294], [13809295, 14576477], [14576478, 15343671]] SRR7169935 file size 5177766 SRR7169935 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169935 SRR7169935_1.fastq SRR7169935_2.fastq Input file: SRR7169935_1.fastq Paired file: SRR7169935_2.fastq trimmed: SRR7169935-trimmed-pair1.fastq, SRR7169935-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:34:47 2025 >> started Wed Feb 12 03:35:03 2025 >> done (16.321s) 15343671 read pairs processed; of these: 32525 ( 0.21%) short read pairs filtered out after trimming by size control 60716 ( 0.40%) empty read pairs filtered out after trimming by size control 15250430 (99.39%) read pairs available; of these: 7356693 (48.24%) trimmed read pairs available after processing 7893737 (51.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 2 0.00% 20 0 0.00% 21 9 0.00% 22 6 0.00% 23 5 0.00% 24 12 0.00% 25 12 0.00% 26 5 0.00% 27 10 0.00% 28 12 0.00% 29 13 0.00% 30 17 0.00% 31 9 0.00% 32 11 0.00% 33 15 0.00% 34 19 0.00% 35 22 0.00% 36 28 0.00% 37 24 0.00% 38 33 0.00% 39 31 0.00% 40 34 0.00% 41 40 0.00% 42 37 0.00% 43 50 0.00% 44 61 0.00% 45 66 0.00% 46 62 0.00% 47 71 0.00% 48 92 0.00% 49 98 0.00% 50 111 0.00% 51 146 0.00% 52 149 0.00% 53 149 0.00% 54 178 0.00% 55 198 0.00% 56 199 0.00% 57 219 0.00% 58 264 0.00% 59 293 0.00% 60 349 0.00% 61 413 0.00% 62 498 0.00% 63 496 0.00% 64 589 0.00% 65 630 0.00% 66 777 0.01% 67 1027 0.01% 68 1085 0.01% 69 1591 0.01% 70 2366 0.02% 71 1916 0.01% 72 1796 0.01% 73 1817 0.01% 74 1958 0.01% 75 2107 0.01% 76 2228 0.01% 77 2496 0.02% 78 2752 0.02% 79 3075 0.02% 80 3346 0.02% 81 3833 0.03% 82 4533 0.03% 83 5093 0.03% 84 6945 0.05% 85 8178 0.05% 86 8575 0.06% 87 9111 0.06% 88 9465 0.06% 89 10275 0.07% 90 10767 0.07% 91 11221 0.07% 92 11972 0.08% 93 13159 0.09% 94 14060 0.09% 95 14949 0.10% 96 15981 0.10% 97 16647 0.11% 98 16994 0.11% 99 17651 0.12% 100 18728 0.12% 101 19539 0.13% 102 20808 0.14% 103 21822 0.14% 104 23393 0.15% 105 24827 0.16% 106 26169 0.17% 107 26692 0.18% 108 27529 0.18% 109 28156 0.18% 110 29228 0.19% 111 30313 0.20% 112 31474 0.21% 113 32617 0.21% 114 34280 0.22% 115 36132 0.24% 116 37435 0.25% 117 39036 0.26% 118 39561 0.26% 119 40065 0.26% 120 41068 0.27% 121 41816 0.27% 122 43476 0.29% 123 44775 0.29% 124 47058 0.31% 125 49123 0.32% 126 51641 0.34% 127 52621 0.35% 128 53834 0.35% 129 55745 0.37% 130 57574 0.38% 131 58473 0.38% 132 61263 0.40% 133 64214 0.42% 134 67243 0.44% 135 70540 0.46% 136 74858 0.49% 137 78636 0.52% 138 84490 0.55% 139 91558 0.60% 140 96404 0.63% 141 103122 0.68% 142 109887 0.72% 143 118461 0.78% 144 132354 0.87% 145 149902 0.98% 146 179143 1.17% 147 229891 1.51% 148 321927 2.11% 149 594423 3.90% 150 3297829 21.62% 151 7893737 51.76% 15250430 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=229.85 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=26.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=44 prefix-density=0.19 prefix-fanout=2.3 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=49.90 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=12.3 sequence=TGTTGGTGGTGG SRR7169935 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:35:51 Started mapping on | Feb 12 03:35:52 Finished on | Feb 12 03:37:36 Mapping speed, Million of reads per hour | 527.90 Number of input reads | 15250430 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14289650 Uniquely mapped reads % | 93.70% Average mapped length | 291.71 Number of splices: Total | 13298054 Number of splices: Annotated (sjdb) | 13072154 Number of splices: GT/AG | 13107109 Number of splices: GC/AG | 151933 Number of splices: AT/AC | 11582 Number of splices: Non-canonical | 27430 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 271404 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 41956 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.20% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 714496 714496 714496 N_multimapping 271404 271404 271404 N_noFeature 264121 14105280 344807 N_ambiguous 156799 753 52624 UnstrandedReadsAssigned:13868730 PositiveStrandReadsAssigned:183617 NegativeStrandReadsAssigned:13892219 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169935 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169935-trimmed-pair1.fastq SRR7169935-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,250,430 reads, 13,863,195 reads pseudoaligned [quant] estimated average fragment length: 224.069 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR7169935.ke.tsv 34699 SRR7169935.se.tsv 87100 total ==> SRR7169935.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.93 232 8.58756 Potri.005G024800.1.v4.1 1035 811.931 31 2.53672 Potri.004G059700.1.v4.1 961 737.975 7 0.630211 Potri.007G009000.2.v4.1 1416 1192.93 0 0 Potri.003G141000.2.v4.1 2943 2719.93 253.035 6.18092 Potri.016G087400.1.v4.1 270 87.4549 1658 1259.59 Potri.015G069301.1.v4.1 564 344.164 0 0 Potri.010G195200.1.v4.1 1773 1549.93 33 1.41459 Potri.012G127500.1.v4.1 977 753.96 3880 341.911 ==> SRR7169935.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 876 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169935 completed mapping pipeline successfully