Starting /dee2/code/volunteer_pipeline.sh SRR7169936 current disk space = 3048971042816 free memory = 916330612 SRR7169936 SRAfilesize c8d4da40951a5a885ad3fc73ae43829d SRR7169936.sra SRR7169936.sra file validated SRR7169936 is paired end SRR7169936 is conventional basespace SRR7169936 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169936_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.168 34.0 33.0 34.0 33.0 34.0 2 33.4495 34.0 34.0 34.0 33.0 34.0 3 33.47025 34.0 34.0 34.0 33.0 34.0 4 33.4835 34.0 34.0 34.0 33.0 34.0 5 33.49025 34.0 34.0 34.0 33.0 34.0 6 37.20925 38.0 38.0 38.0 36.0 38.0 7 37.425 38.0 38.0 38.0 37.0 38.0 8 37.5205 38.0 38.0 38.0 37.0 38.0 9 37.53475 38.0 38.0 38.0 38.0 38.0 10-14 37.54085 38.0 38.0 38.0 38.0 38.0 15-19 37.5713 38.0 38.0 38.0 38.0 38.0 20-24 37.514799999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.5099 38.0 38.0 38.0 38.0 38.0 30-34 37.5267 38.0 38.0 38.0 38.0 38.0 35-39 37.439800000000005 38.0 38.0 38.0 37.4 38.0 40-44 37.34865 38.0 38.0 38.0 37.0 38.0 45-49 37.2564 38.0 38.0 38.0 37.0 38.0 50-54 37.2471 38.0 38.0 38.0 37.0 38.0 55-59 37.21275 38.0 38.0 38.0 36.6 38.0 60-64 37.14655 38.0 38.0 38.0 36.2 38.0 65-69 37.12835 38.0 38.0 38.0 36.2 38.0 70-74 37.0958 38.0 38.0 38.0 36.0 38.0 75-79 37.0222 38.0 38.0 38.0 36.0 38.0 80-84 36.8646 38.0 38.0 38.0 35.4 38.0 85-89 36.807300000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.7359 38.0 38.0 38.0 35.0 38.0 95-99 36.47769999999999 38.0 38.0 38.0 34.4 38.0 100-104 36.39445 38.0 38.0 38.0 34.0 38.0 105-109 36.41375 38.0 38.0 38.0 34.0 38.0 110-114 36.27485 38.0 38.0 38.0 34.0 38.0 115-119 36.11645 38.0 37.8 38.0 33.4 38.0 120-124 36.00535 38.0 37.2 38.0 33.0 38.0 125-129 35.737700000000004 38.0 36.6 38.0 32.2 38.0 130-134 35.16445 38.0 36.0 38.0 29.8 38.0 135-139 34.795 38.0 35.8 38.0 27.6 38.0 140-144 34.764799999999994 38.0 35.6 38.0 28.0 38.0 145-149 33.77675000000001 38.0 35.0 38.0 21.0 38.0 150-151 30.14175 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 3.0 17 1.0 18 2.0 19 6.0 20 1.0 21 3.0 22 4.0 23 5.0 24 13.0 25 15.0 26 19.0 27 17.0 28 31.0 29 32.0 30 46.0 31 54.0 32 62.0 33 88.0 34 120.0 35 231.0 36 535.0 37 2705.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.03277861825517 11.850731215330308 7.438224911749875 35.67826525466465 2 24.224999999999998 14.35 31.724999999999998 29.7 3 19.475 19.0 26.900000000000002 34.625 4 22.525000000000002 27.0 23.1 27.375 5 22.95 30.599999999999998 23.400000000000002 23.05 6 19.3 35.025 24.65 21.025 7 15.299999999999999 27.500000000000004 39.275 17.925 8 17.125 25.275 31.775 25.825 9 17.0 26.05 32.175 24.775 10-14 19.865 29.585 27.384999999999998 23.165 15-19 19.900000000000002 28.63 27.950000000000003 23.52 20-24 20.294999999999998 28.585 27.689999999999998 23.43 25-29 20.405 28.455000000000002 27.325 23.815 30-34 19.84 29.020000000000003 27.544999999999998 23.595 35-39 20.044999999999998 28.835 26.484999999999996 24.635 40-44 20.36 28.910000000000004 27.089999999999996 23.64 45-49 20.35730370815193 27.843667117049492 27.398288545263473 24.400740629535107 50-54 19.68 28.815 27.045 24.46 55-59 20.455000000000002 28.610000000000003 27.08 23.855 60-64 20.165 28.7 27.125 24.01 65-69 20.11 28.28 27.49 24.12 70-74 20.330000000000002 28.54 27.57 23.56 75-79 20.665 28.285 27.41 23.64 80-84 20.615 28.465 27.450000000000003 23.47 85-89 20.885221305326333 28.18704676169042 27.266816704176044 23.6609152288072 90-94 20.66960705693665 27.636327185244586 27.265437048917402 24.42862870890136 95-99 20.485500326682416 28.03437704176509 27.491581645474195 23.988540986078302 100-104 20.656853910083107 28.07649944928407 27.265445078602184 24.001201562030637 105-109 20.39601980099005 28.801440072003597 27.251362568128407 23.551177558877946 110-114 20.866693354683747 28.502802241793436 26.791433146517214 23.839071257005603 115-119 20.77 28.23 26.705000000000002 24.295 120-124 20.77 28.34 26.695 24.195 125-129 21.240000000000002 27.725 27.189999999999998 23.845 130-134 21.2763824133955 27.768586754900486 27.12187296335288 23.83315786835113 135-139 21.43611404435058 27.96299089857696 26.84668376326243 23.754211293810027 140-144 21.318626222110804 27.380295813487088 27.269992479318123 24.03108548508398 145-149 21.307287753568747 27.858752817430503 26.351114450288005 24.48284497871275 150-151 20.863039399624768 26.216385240775487 28.13008130081301 24.79049405878674 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 3.0 25 3.5 26 1.5 27 2.5 28 6.5 29 9.5 30 10.5 31 17.0 32 29.0 33 39.0 34 48.0 35 64.0 36 78.0 37 90.0 38 108.5 39 152.0 40 176.5 41 192.0 42 233.5 43 281.5 44 299.0 45 279.5 46 279.0 47 270.0 48 240.5 49 214.5 50 184.0 51 150.0 52 124.0 53 97.5 54 80.0 55 59.5 56 38.0 57 32.5 58 30.5 59 21.0 60 11.0 61 7.5 62 5.5 63 5.0 64 5.0 65 5.0 66 3.0 67 2.0 68 1.5 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.08499999999999999 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.24 95-99 0.515 100-104 0.13 105-109 0.005 110-114 0.08 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.265 135-139 0.565 140-144 0.27499999999999997 145-149 0.17500000000000002 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.2374999999999998 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.2625 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 2.7125000000000004 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.5250000000000004 0.0 0.0 0.0 0.0 120-121 3.7874999999999996 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.1625 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.387499999999999 0.0 0.0 0.0 0.0 138-139 7.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169936 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169936_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1185 33.0 33.0 34.0 32.0 34.0 2 32.16625 33.0 33.0 34.0 31.0 34.0 3 32.168 34.0 33.0 34.0 31.0 34.0 4 31.8 34.0 33.0 34.0 31.0 34.0 5 31.79375 34.0 33.0 34.0 31.0 34.0 6 35.861 38.0 38.0 38.0 34.0 38.0 7 35.893 38.0 38.0 38.0 34.0 38.0 8 35.81 38.0 38.0 38.0 34.0 38.0 9 35.93625 38.0 38.0 38.0 35.0 38.0 10-14 35.8748 38.0 38.0 38.0 34.0 38.0 15-19 35.64 38.0 38.0 38.0 33.8 38.0 20-24 35.80915 38.0 38.0 38.0 34.2 38.0 25-29 35.8951 38.0 38.0 38.0 34.8 38.0 30-34 35.942600000000006 38.0 38.0 38.0 35.2 38.0 35-39 35.865300000000005 38.0 38.0 38.0 34.6 38.0 40-44 35.6466 38.0 38.0 38.0 34.0 38.0 45-49 35.57475 38.0 38.0 38.0 33.4 38.0 50-54 35.85165 38.0 38.0 38.0 34.2 38.0 55-59 35.77974999999999 38.0 38.0 38.0 34.0 38.0 60-64 35.70095 38.0 38.0 38.0 33.8 38.0 65-69 35.635149999999996 38.0 38.0 38.0 33.6 38.0 70-74 35.58385 38.0 38.0 38.0 33.0 38.0 75-79 35.573750000000004 38.0 38.0 38.0 33.4 38.0 80-84 35.4563 38.0 38.0 38.0 33.0 38.0 85-89 35.055749999999996 38.0 38.0 38.0 29.8 38.0 90-94 34.6194 38.0 38.0 38.0 26.8 38.0 95-99 35.0564 38.0 38.0 38.0 28.8 38.0 100-104 35.087 38.0 38.0 38.0 29.0 38.0 105-109 34.93145 38.0 37.4 38.0 28.8 38.0 110-114 34.8405 38.0 37.2 38.0 28.0 38.0 115-119 34.4262 38.0 36.6 38.0 24.2 38.0 120-124 34.3343 38.0 36.0 38.0 24.0 38.0 125-129 33.92985 38.0 35.8 38.0 19.8 38.0 130-134 32.869350000000004 38.0 35.0 38.0 11.6 38.0 135-139 31.674149999999997 38.0 33.8 38.0 2.0 38.0 140-144 30.76245 38.0 32.2 38.0 2.0 38.0 145-149 30.190199999999997 38.0 31.4 38.0 2.0 38.0 150-151 26.637875 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 123.0 3 3.0 4 3.0 5 2.0 6 1.0 7 0.0 8 1.0 9 4.0 10 1.0 11 1.0 12 7.0 13 2.0 14 4.0 15 3.0 16 5.0 17 8.0 18 9.0 19 7.0 20 12.0 21 9.0 22 13.0 23 18.0 24 19.0 25 29.0 26 33.0 27 26.0 28 42.0 29 35.0 30 65.0 31 82.0 32 128.0 33 152.0 34 146.0 35 175.0 36 444.0 37 2388.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.60244648318042 23.623853211009173 12.257900101936798 24.515800203873596 2 28.027418126428028 27.01193196242701 27.976643818227977 16.984006092916985 3 20.82695252679939 29.88769780500255 31.368044920877995 17.917304747320063 4 24.870867768595044 33.264462809917354 22.02995867768595 19.834710743801654 5 24.735073662445075 35.254587748772295 21.969501163091238 18.040837425691393 6 21.693257848687598 37.10756562017499 23.520329387545033 17.67884714359238 7 20.890146642655 22.74247491638796 36.60921018780551 19.75816825315153 8 21.828454031843865 26.373908577298412 27.11864406779661 24.678993323061118 9 21.941797579191345 25.135204738604173 30.672160700489314 22.250836981715167 10-14 23.52577319587629 28.443298969072167 26.422680412371136 21.608247422680414 15-19 24.13220567633477 27.805738598038708 27.234991957660977 20.827063767965548 20-24 23.778098577026192 28.30996081666323 26.974633945143328 20.937306661167252 25-29 23.97672862070741 28.239715800854658 27.179117541059565 20.604438037378365 30-34 23.366122470000512 28.03213678735129 27.445022403048874 21.15671833959932 35-39 23.689911285331135 27.955436352382918 27.26944501753662 21.08520734474933 40-44 23.287387294020107 27.46916778940823 27.71789822779563 21.52554668877604 45-49 23.430377123912145 28.18586821384169 27.284500621632823 21.099254040613342 50-54 23.271119337755156 27.554115892847964 27.950023137436368 21.224741631960512 55-59 23.886743886743886 27.54182754182754 27.675675675675677 20.895752895752896 60-64 23.74659330487993 27.85005399290379 27.47467475703193 20.928677945184347 65-69 23.51369405477622 27.064385180617645 28.354144185807513 21.06777657879862 70-74 24.243813015582035 27.81342295549445 26.825542315918117 21.1172217130054 75-79 23.512935424730088 28.091260949276837 27.755143613770628 20.640660012222448 80-84 24.0702691596466 27.629956852270393 27.963838093281286 20.335935894801725 85-89 23.558818934541478 28.104983596313076 27.625891787741498 20.71030568140395 90-94 23.874488403819917 27.18018679819498 27.956763563857695 20.988561234127403 95-99 24.221328382838283 28.444719471947195 26.89253300330033 20.441419141914192 100-104 24.113147492171056 28.230401971353764 27.49114430925612 20.165306227219055 105-109 24.247732893652103 27.133140972794724 27.83903544929926 20.780090684253917 110-114 24.05813533989589 28.31520898830078 26.970056176879865 20.656599494923466 115-119 23.90503479328694 28.29512893982808 27.154113794514938 20.645722472370036 120-124 24.55980108590856 28.10676409397676 27.162937027452173 20.170497792662506 125-129 24.80508080755925 27.856663396499197 26.97371818040998 20.364537615531574 130-134 25.0492781418145 27.670342549677695 27.063022747855737 20.21735656065207 135-139 24.5850622406639 27.647958069447476 27.456868311858486 20.310111378030136 140-144 24.968096321367142 28.51911446485047 26.443988237252398 20.068800976529992 145-149 25.034644494190385 28.38716554738301 26.569662082933586 20.00852787549302 150-151 26.13930605903677 27.602278612118074 26.229932677369238 20.02848265147592 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 65.0 1 34.0 2 2.5 3 4.0 4 5.0 5 4.5 6 5.5 7 6.5 8 4.5 9 3.5 10 3.5 11 1.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 2.0 18 2.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 2.0 26 2.5 27 3.5 28 3.5 29 6.0 30 9.5 31 12.0 32 21.5 33 30.0 34 31.5 35 43.0 36 70.0 37 90.5 38 112.0 39 159.0 40 207.5 41 228.0 42 250.0 43 273.5 44 267.0 45 269.5 46 280.0 47 267.0 48 231.5 49 199.0 50 174.0 51 141.0 52 105.5 53 88.5 54 72.5 55 51.5 56 47.5 57 38.0 58 25.5 59 19.0 60 16.0 61 11.5 62 5.0 63 5.0 64 4.0 65 1.0 66 2.5 67 2.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.9 2 1.525 3 2.0500000000000003 4 3.2 5 3.2750000000000004 6 2.85 7 2.825 8 2.65 9 2.9250000000000003 10-14 3.0 15-19 3.6350000000000002 20-24 3.02 25-29 2.8850000000000002 30-34 2.915 35-39 3.06 40-44 3.51 45-49 3.4799999999999995 50-54 2.7550000000000003 55-59 2.875 60-64 2.765 65-69 2.6950000000000003 70-74 1.81 75-79 1.82 80-84 2.6599999999999997 85-89 3.9849999999999994 90-94 4.71 95-99 3.04 100-104 2.605 105-109 2.96 110-114 2.9850000000000003 115-119 2.2800000000000002 120-124 1.465 125-129 3.1649999999999996 130-134 6.145 135-139 8.42 140-144 9.885 145-149 6.1899999999999995 150-151 3.45 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.28260312580066 96.875 2 0.5892902895208814 1.15 3 0.025621316935690495 0.075 4 0.025621316935690495 0.1 5 0.025621316935690495 0.125 6 0.025621316935690495 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025621316935690495 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 61 1.525 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4874999999999998 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9749999999999999 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7125000000000004 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.3625 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.1375 0.0 0.0 0.0 0.0 128-129 5.4875 0.0 0.0 0.0 0.0 130-131 5.9 0.0 0.0 0.0 0.0 132-133 6.275 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.075 0.0 0.0 0.0 0.0 138-139 7.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAGTT 10 0.0070566526 143.38461 3 >>END_MODULE Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831089 spots for SRR7169936.sra Written 831089 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra Read 831080 spots for SRR7169936.sra Written 831080 spots for SRR7169936.sra SRR ids: ['SRR7169936.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3xynzwvk SRR7169936.sra spots: 16621609 blocks: [[1, 831080], [831081, 1662160], [1662161, 2493240], [2493241, 3324320], [3324321, 4155400], [4155401, 4986480], [4986481, 5817560], [5817561, 6648640], [6648641, 7479720], [7479721, 8310800], [8310801, 9141880], [9141881, 9972960], [9972961, 10804040], [10804041, 11635120], [11635121, 12466200], [12466201, 13297280], [13297281, 14128360], [14128361, 14959440], [14959441, 15790520], [15790521, 16621609]] SRR7169936 file size 5610817 SRR7169936 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169936 SRR7169936_1.fastq SRR7169936_2.fastq Input file: SRR7169936_1.fastq Paired file: SRR7169936_2.fastq trimmed: SRR7169936-trimmed-pair1.fastq, SRR7169936-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:21:40 2025 >> started Wed Feb 12 03:21:58 2025 >> done (18.221s) 16621609 read pairs processed; of these: 24120 ( 0.15%) short read pairs filtered out after trimming by size control 56685 ( 0.34%) empty read pairs filtered out after trimming by size control 16540804 (99.51%) read pairs available; of these: 7844028 (47.42%) trimmed read pairs available after processing 8696776 (52.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 2 0.00% 21 6 0.00% 22 6 0.00% 23 8 0.00% 24 8 0.00% 25 2 0.00% 26 10 0.00% 27 9 0.00% 28 4 0.00% 29 13 0.00% 30 17 0.00% 31 13 0.00% 32 13 0.00% 33 16 0.00% 34 14 0.00% 35 17 0.00% 36 15 0.00% 37 18 0.00% 38 16 0.00% 39 28 0.00% 40 25 0.00% 41 35 0.00% 42 36 0.00% 43 45 0.00% 44 54 0.00% 45 48 0.00% 46 63 0.00% 47 83 0.00% 48 98 0.00% 49 83 0.00% 50 119 0.00% 51 143 0.00% 52 157 0.00% 53 165 0.00% 54 176 0.00% 55 201 0.00% 56 219 0.00% 57 232 0.00% 58 261 0.00% 59 315 0.00% 60 362 0.00% 61 446 0.00% 62 446 0.00% 63 549 0.00% 64 592 0.00% 65 624 0.00% 66 787 0.00% 67 870 0.01% 68 949 0.01% 69 1127 0.01% 70 1442 0.01% 71 1416 0.01% 72 1713 0.01% 73 1851 0.01% 74 2011 0.01% 75 2283 0.01% 76 2494 0.02% 77 2756 0.02% 78 2946 0.02% 79 3207 0.02% 80 3735 0.02% 81 4159 0.03% 82 4775 0.03% 83 5408 0.03% 84 6860 0.04% 85 7762 0.05% 86 8313 0.05% 87 8810 0.05% 88 9317 0.06% 89 9735 0.06% 90 10134 0.06% 91 11067 0.07% 92 11997 0.07% 93 12930 0.08% 94 14205 0.09% 95 15077 0.09% 96 15793 0.10% 97 16631 0.10% 98 16952 0.10% 99 17659 0.11% 100 18668 0.11% 101 19295 0.12% 102 20320 0.12% 103 21862 0.13% 104 23252 0.14% 105 24537 0.15% 106 25631 0.15% 107 26046 0.16% 108 26988 0.16% 109 27270 0.16% 110 28184 0.17% 111 29215 0.18% 112 30846 0.19% 113 32007 0.19% 114 33557 0.20% 115 35511 0.21% 116 36264 0.22% 117 37329 0.23% 118 38334 0.23% 119 38641 0.23% 120 39954 0.24% 121 40585 0.25% 122 42018 0.25% 123 43937 0.27% 124 46170 0.28% 125 48533 0.29% 126 50169 0.30% 127 52044 0.31% 128 53029 0.32% 129 54514 0.33% 130 56496 0.34% 131 58230 0.35% 132 61320 0.37% 133 63980 0.39% 134 66829 0.40% 135 71549 0.43% 136 75117 0.45% 137 79740 0.48% 138 86904 0.53% 139 94135 0.57% 140 99305 0.60% 141 106629 0.64% 142 115545 0.70% 143 125314 0.76% 144 140653 0.85% 145 160212 0.97% 146 193070 1.17% 147 251721 1.52% 148 355794 2.15% 149 665114 4.02% 150 3628671 21.94% 151 8696776 52.58% 16540804 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=43 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=106.95 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=20.4 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=43 prefix-density=0.26 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=287.95 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=30.4 sequence=AAGAAGAAGAAA SRR7169936 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:22:51 Started mapping on | Feb 12 03:22:51 Finished on | Feb 12 03:24:16 Mapping speed, Million of reads per hour | 700.55 Number of input reads | 16540804 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15768551 Uniquely mapped reads % | 95.33% Average mapped length | 292.29 Number of splices: Total | 15373691 Number of splices: Annotated (sjdb) | 15113067 Number of splices: GT/AG | 15143242 Number of splices: GC/AG | 184970 Number of splices: AT/AC | 12805 Number of splices: Non-canonical | 32674 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292783 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 35900 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 498626 498626 498626 N_multimapping 292783 292783 292783 N_noFeature 310846 15599067 389160 N_ambiguous 151469 897 59700 UnstrandedReadsAssigned:15306236 PositiveStrandReadsAssigned:168587 NegativeStrandReadsAssigned:15319691 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169936 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169936-trimmed-pair1.fastq SRR7169936-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,540,804 reads, 15,234,709 reads pseudoaligned [quant] estimated average fragment length: 234.819 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR7169936.ke.tsv 34699 SRR7169936.se.tsv 87100 total ==> SRR7169936.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.18 324 11.8058 Potri.005G024800.1.v4.1 1035 801.181 44 3.57037 Potri.004G059700.1.v4.1 961 727.246 6 0.536366 Potri.007G009000.2.v4.1 1416 1182.18 0 0 Potri.003G141000.2.v4.1 2943 2709.18 306.073 7.34477 Potri.016G087400.1.v4.1 270 86.0898 1487 1122.92 Potri.015G069301.1.v4.1 564 335.777 0 0 Potri.010G195200.1.v4.1 1773 1539.18 23 0.97147 Potri.012G127500.1.v4.1 977 743.219 6769 592.105 ==> SRR7169936.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1039 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 352 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169936 completed mapping pipeline successfully