Starting /dee2/code/volunteer_pipeline.sh SRR7169937 current disk space = 3049138184192 free memory = 1300151840 SRR7169937 SRAfilesize 3358487c89ded804cd56d4444ede4640 SRR7169937.sra SRR7169937.sra file validated SRR7169937 is paired end SRR7169937 is conventional basespace SRR7169937 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169937_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.187 34.0 34.0 34.0 33.0 34.0 2 33.537 34.0 34.0 34.0 33.0 34.0 3 33.58175 34.0 34.0 34.0 33.0 34.0 4 33.6075 34.0 34.0 34.0 33.0 34.0 5 33.6545 34.0 34.0 34.0 33.0 34.0 6 37.34675 38.0 38.0 38.0 37.0 38.0 7 37.63375 38.0 38.0 38.0 38.0 38.0 8 37.65475 38.0 38.0 38.0 38.0 38.0 9 37.6905 38.0 38.0 38.0 38.0 38.0 10-14 37.6632 38.0 38.0 38.0 38.0 38.0 15-19 37.67999999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.6315 38.0 38.0 38.0 38.0 38.0 25-29 37.587 38.0 38.0 38.0 38.0 38.0 30-34 37.5929 38.0 38.0 38.0 38.0 38.0 35-39 37.55485 38.0 38.0 38.0 38.0 38.0 40-44 37.4276 38.0 38.0 38.0 37.8 38.0 45-49 37.40255 38.0 38.0 38.0 37.2 38.0 50-54 37.372299999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.33985 38.0 38.0 38.0 37.0 38.0 60-64 37.31075 38.0 38.0 38.0 37.0 38.0 65-69 37.29645 38.0 38.0 38.0 37.0 38.0 70-74 37.21505 38.0 38.0 38.0 37.0 38.0 75-79 37.02460000000001 38.0 38.0 38.0 36.4 38.0 80-84 36.968849999999996 38.0 38.0 38.0 36.2 38.0 85-89 36.8932 38.0 38.0 38.0 36.0 38.0 90-94 36.82795 38.0 38.0 38.0 36.0 38.0 95-99 36.700399999999995 38.0 38.0 38.0 35.8 38.0 100-104 36.6934 38.0 38.0 38.0 35.8 38.0 105-109 36.595150000000004 38.0 38.0 38.0 35.0 38.0 110-114 36.428450000000005 38.0 38.0 38.0 34.0 38.0 115-119 36.150549999999996 38.0 38.0 38.0 34.0 38.0 120-124 36.044200000000004 38.0 38.0 38.0 33.6 38.0 125-129 35.72595 38.0 37.0 38.0 32.6 38.0 130-134 35.48885 38.0 36.6 38.0 31.6 38.0 135-139 35.236399999999996 38.0 36.0 38.0 31.0 38.0 140-144 34.947050000000004 38.0 36.0 38.0 29.4 38.0 145-149 34.4723 38.0 35.8 38.0 27.4 38.0 150-151 31.330750000000002 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 2.0 14 0.0 15 1.0 16 2.0 17 4.0 18 8.0 19 11.0 20 4.0 21 5.0 22 3.0 23 7.0 24 9.0 25 7.0 26 21.0 27 17.0 28 25.0 29 21.0 30 33.0 31 38.0 32 52.0 33 61.0 34 106.0 35 176.0 36 439.0 37 2946.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.58240647118301 14.534883720930234 10.085945399393328 33.79676440849343 2 24.4 14.6 30.375000000000004 30.625000000000004 3 19.950000000000003 19.35 25.85 34.849999999999994 4 21.349999999999998 26.0 24.474999999999998 28.175 5 21.775 29.9 24.325 24.0 6 21.875 32.65 25.324999999999996 20.150000000000002 7 14.299999999999999 29.675 38.324999999999996 17.7 8 17.75 27.474999999999998 30.9 23.875 9 16.6 27.975 32.550000000000004 22.875 10-14 19.28 31.5 26.965 22.255 15-19 19.03 30.475 27.275 23.22 20-24 19.64 30.605 26.584999999999997 23.169999999999998 25-29 19.189999999999998 30.605 27.42 22.785 30-34 19.17 29.98 26.99 23.86 35-39 19.165 30.29 26.83 23.715 40-44 19.345000000000002 29.73 27.05 23.875 45-49 19.876987698769877 29.47794779477948 26.972697269726975 23.672367236723673 50-54 19.7 29.86 26.845000000000002 23.595 55-59 19.82 29.845 26.584999999999997 23.75 60-64 20.03 29.630000000000003 27.029999999999998 23.31 65-69 19.515 29.830000000000002 26.985 23.669999999999998 70-74 19.43 29.794999999999998 27.415 23.36 75-79 19.645000000000003 29.354999999999997 26.939999999999998 24.060000000000002 80-84 19.445 29.2 27.395000000000003 23.96 85-89 20.0070024508578 28.97514129945481 27.229530335617465 23.788325914069926 90-94 20.42320613749185 28.661685804542948 26.961841247555533 23.95326681040967 95-99 19.826505540791256 28.807100235671662 27.212555783984353 24.153838439552725 100-104 20.587058705870586 28.28782878287829 27.337733773377337 23.787378737873787 105-109 20.335 29.060000000000002 26.58 24.025 110-114 20.105 29.134999999999998 26.905 23.855 115-119 20.547054705470547 28.89288928892889 26.6026602660266 23.957395739573958 120-124 20.544999999999998 29.020000000000003 26.32 24.115000000000002 125-129 20.335 29.404999999999998 26.05 24.21 130-134 20.29217530518311 28.6972183309986 26.340804482689613 24.669801881128677 135-139 20.753205128205128 28.725961538461537 26.647636217948715 23.873197115384613 140-144 20.844379970986946 28.71792306537942 25.871642239007553 24.56605472462608 145-149 21.012860931792023 28.77445828954611 25.64179552619727 24.570885252464596 150-151 21.2625 28.775000000000002 26.137500000000003 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.5 20 1.5 21 1.5 22 0.5 23 1.5 24 2.5 25 4.0 26 6.0 27 10.5 28 16.0 29 19.5 30 25.5 31 40.0 32 53.0 33 60.5 34 75.5 35 91.0 36 106.5 37 136.5 38 151.0 39 150.0 40 175.0 41 215.0 42 235.5 43 244.5 44 243.0 45 228.5 46 240.0 47 232.0 48 202.0 49 190.5 50 178.0 51 146.0 52 110.5 53 96.0 54 77.5 55 55.0 56 46.0 57 35.0 58 24.0 59 16.5 60 9.0 61 9.5 62 7.5 63 4.0 64 3.5 65 3.5 66 3.0 67 2.5 68 3.5 69 2.0 70 0.0 71 1.5 72 1.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.034999999999999996 90-94 0.28500000000000003 95-99 0.28500000000000003 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.06 135-139 0.16 140-144 0.045 145-149 0.08499999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34183673469387 96.375 2 1.530612244897959 3.0 3 0.07653061224489796 0.22499999999999998 4 0.025510204081632654 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025510204081632654 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCAAGGATCTCGTATGC 12 0.3 TruSeq Adapter, Index 6 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.75 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 3.0 0.0 0.0 0.0 0.0 112-113 3.4 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.575 0.0 0.0 0.0 0.0 118-119 5.175000000000001 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 6.25 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.300000000000001 0.0 0.0 0.0 0.0 128-129 7.9125 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.3 0.0 0.0 0.0 0.0 134-135 9.9 0.0 0.0 0.0 0.0 136-137 10.4125 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169937 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169937_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39525 33.0 33.0 34.0 32.0 34.0 2 32.50275 34.0 33.0 34.0 32.0 34.0 3 32.51075 34.0 33.0 34.0 32.0 34.0 4 32.32375 34.0 33.0 34.0 32.0 34.0 5 32.25175 34.0 33.0 34.0 32.0 34.0 6 36.27575 38.0 38.0 38.0 36.0 38.0 7 36.37575 38.0 38.0 38.0 37.0 38.0 8 36.30925 38.0 38.0 38.0 37.0 38.0 9 36.32075 38.0 38.0 38.0 37.0 38.0 10-14 36.196149999999996 38.0 38.0 38.0 36.2 38.0 15-19 36.055099999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.12715 38.0 38.0 38.0 36.0 38.0 25-29 36.2384 38.0 38.0 38.0 36.8 38.0 30-34 36.26445 38.0 38.0 38.0 37.0 38.0 35-39 36.09065 38.0 38.0 38.0 36.4 38.0 40-44 35.9807 38.0 38.0 38.0 36.0 38.0 45-49 35.91585 38.0 38.0 38.0 35.8 38.0 50-54 36.1458 38.0 38.0 38.0 36.0 38.0 55-59 36.152300000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.046299999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.030199999999994 38.0 38.0 38.0 36.0 38.0 70-74 35.9226 38.0 38.0 38.0 35.4 38.0 75-79 35.86855 38.0 38.0 38.0 35.0 38.0 80-84 35.780049999999996 38.0 38.0 38.0 34.6 38.0 85-89 35.37275 38.0 38.0 38.0 33.6 38.0 90-94 35.01700000000001 38.0 38.0 38.0 30.0 38.0 95-99 35.430499999999995 38.0 38.0 38.0 32.6 38.0 100-104 35.50195 38.0 38.0 38.0 33.4 38.0 105-109 35.35415 38.0 38.0 38.0 33.0 38.0 110-114 35.30185 38.0 38.0 38.0 32.8 38.0 115-119 35.19105 38.0 38.0 38.0 31.6 38.0 120-124 34.95795 38.0 37.8 38.0 30.0 38.0 125-129 34.497400000000006 38.0 36.8 38.0 26.6 38.0 130-134 33.56785 38.0 36.0 38.0 15.6 38.0 135-139 32.76245 38.0 35.4 38.0 6.4 38.0 140-144 31.807550000000003 38.0 34.2 38.0 2.0 38.0 145-149 31.43055 38.0 33.4 38.0 2.0 38.0 150-151 27.785375000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 114.0 3 5.0 4 1.0 5 2.0 6 3.0 7 1.0 8 0.0 9 0.0 10 1.0 11 4.0 12 2.0 13 6.0 14 2.0 15 6.0 16 4.0 17 14.0 18 7.0 19 4.0 20 9.0 21 9.0 22 14.0 23 14.0 24 14.0 25 20.0 26 18.0 27 18.0 28 33.0 29 32.0 30 50.0 31 60.0 32 69.0 33 104.0 34 122.0 35 143.0 36 369.0 37 2726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.633860275369706 22.972972972972975 13.768485466598673 25.624681285058642 2 27.18299164768413 28.043533282713234 28.372563907871424 16.40091116173121 3 20.950928044749556 31.24841088227816 28.578693109585558 19.221967963386728 4 25.2620813091281 33.08616722065968 23.11429301968806 18.537458450524163 5 25.243714725500254 34.120061570035915 22.293483837865573 18.342739866598258 6 22.980251346499102 35.804052321107974 23.236727365991282 17.97896896640164 7 21.21056681200308 22.954603744549885 36.393947165939984 19.440882277507054 8 22.980251346499102 26.26314439599897 26.391382405745063 24.36522185175686 9 21.855828220858893 27.121676891615543 28.60429447852761 22.418200408997954 10-14 24.439761513157894 28.74691611842105 26.01254111842105 20.80078125 15-19 24.175824175824175 27.993602641489968 26.941133983387505 20.889439199298355 20-24 24.531796665980654 28.16423132331756 27.41819304383618 19.88577896686561 25-29 24.77449774497745 27.916154161541616 26.865518655186555 20.443829438294383 30-34 24.018653274572102 28.38987393666086 27.375217792354206 20.216254996412832 35-39 24.482652115721198 27.751467105940492 27.0822608874704 20.68361989086791 40-44 24.432287365813377 27.781791907514453 27.079892650701897 20.706028075970274 45-49 24.501704017349997 28.24021480945988 26.928637818857794 20.329443354332337 50-54 24.087740877408777 28.14678146781468 27.35239852398524 20.41307913079131 55-59 23.584615384615386 28.05128205128205 27.866666666666667 20.4974358974359 60-64 23.665142093632767 27.776350274937045 28.177193072614216 20.381314558815973 65-69 23.918614186141863 27.977654776547766 27.76240262402624 20.34132841328413 70-74 24.25588400469699 27.977740337979274 27.42124878746107 20.345126869862664 75-79 23.68689444161142 27.990821009688933 28.30188679245283 20.020397756246812 80-84 24.64108721197568 27.573698462167272 27.762734378991468 20.02247994686558 85-89 24.207522697795074 27.060959792477302 28.409857328145264 20.32166018158236 90-94 24.372423151192528 27.999582485256514 27.81170085068629 19.81629351286467 95-99 24.471361116813796 27.72531307739684 27.807431738862658 19.99589406692671 100-104 24.95395006139992 27.87556283258289 27.50204666393778 19.66844044207941 105-109 24.546107293055698 27.90029746640681 27.690019489178376 19.863575751359114 110-114 24.4792201128784 28.291431503335048 27.28578758337609 19.943560800410467 115-119 24.457271287735608 27.81835827757062 28.06354395464065 19.660826480053124 120-124 24.690918341388958 28.293055202238616 27.870770796235057 19.14525566013737 125-129 25.422680412371136 28.072164948453608 26.88659793814433 19.61855670103093 130-134 25.50594451783355 27.762219286657857 27.471598414795245 19.260237780713343 135-139 25.400911772593187 27.54625905068383 27.519442209707695 19.533386967015286 140-144 25.700730723088665 27.94197840549678 27.353037408659613 19.004253462754935 145-149 26.244248162056383 27.45543978420691 27.302057439043743 18.99825461469297 150-151 26.3178344773993 27.872037300867763 27.133790959720244 18.676337262012694 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 60.0 1 36.5 2 9.5 3 3.0 4 1.5 5 2.5 6 2.5 7 2.5 8 1.5 9 0.5 10 1.0 11 1.5 12 0.5 13 0.5 14 1.5 15 2.0 16 1.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.0 22 0.5 23 1.0 24 1.5 25 2.0 26 2.5 27 4.0 28 5.0 29 6.5 30 12.5 31 24.0 32 27.5 33 25.0 34 32.0 35 50.5 36 69.5 37 90.5 38 119.0 39 156.0 40 194.5 41 215.5 42 242.0 43 276.5 44 283.0 45 285.0 46 284.5 47 258.0 48 223.5 49 193.0 50 158.0 51 143.5 52 124.5 53 88.5 54 70.5 55 54.5 56 42.5 57 37.0 58 27.0 59 14.0 60 9.5 61 8.0 62 9.0 63 7.5 64 3.0 65 1.5 66 3.0 67 3.0 68 2.0 69 2.0 70 1.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.95 2 1.225 3 1.675 4 2.225 5 2.55 6 2.5250000000000004 7 2.5250000000000004 8 2.5250000000000004 9 2.1999999999999997 10-14 2.7199999999999998 15-19 3.085 20-24 2.82 25-29 2.44 30-34 2.4299999999999997 35-39 2.87 40-44 3.1199999999999997 45-49 3.17 50-54 2.44 55-59 2.5 60-64 2.705 65-69 2.44 70-74 2.0650000000000004 75-79 1.95 80-84 2.1350000000000002 85-89 3.6249999999999996 90-94 4.195 95-99 2.58 100-104 2.2800000000000002 105-109 2.5100000000000002 110-114 2.55 115-119 2.1149999999999998 120-124 1.725 125-129 3.0 130-134 5.375 135-139 6.775 140-144 8.309999999999999 145-149 5.465 150-151 3.4875000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18370524130773 94.6 2 1.5308770108977685 2.9499999999999997 3 0.10378827192527244 0.3 4 0.02594706798131811 0.1 5 0.07784120394395433 0.375 6 0.02594706798131811 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05189413596263622 1.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 49 1.225 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit AATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGA 5 0.125 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.2625000000000002 0.0 0.0 0.0 0.0 100-101 1.425 0.0 0.0 0.0 0.0 102-103 1.725 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.85 0.0 0.0 0.0 0.0 112-113 3.225 0.0 0.0 0.0 0.0 114-115 3.7625 0.0 0.0 0.0 0.0 116-117 4.387499999999999 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.3125 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.487500000000001 0.0 0.0 0.0 0.0 126-127 6.9375 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.837499999999999 0.0 0.0 0.0 0.0 134-135 9.4 0.0 0.0 0.0 0.0 136-137 9.9375 0.0 0.0 0.0 0.0 138-139 10.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGACG 10 0.0069333897 144.2078 1 >>END_MODULE Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712352 spots for SRR7169937.sra Written 712352 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra Read 712347 spots for SRR7169937.sra Written 712347 spots for SRR7169937.sra SRR ids: ['SRR7169937.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jid8hv_m SRR7169937.sra spots: 14246945 blocks: [[1, 712347], [712348, 1424694], [1424695, 2137041], [2137042, 2849388], [2849389, 3561735], [3561736, 4274082], [4274083, 4986429], [4986430, 5698776], [5698777, 6411123], [6411124, 7123470], [7123471, 7835817], [7835818, 8548164], [8548165, 9260511], [9260512, 9972858], [9972859, 10685205], [10685206, 11397552], [11397553, 12109899], [12109900, 12822246], [12822247, 13534593], [13534594, 14246945]] SRR7169937 file size 4806121 SRR7169937 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169937 SRR7169937_1.fastq SRR7169937_2.fastq Input file: SRR7169937_1.fastq Paired file: SRR7169937_2.fastq trimmed: SRR7169937-trimmed-pair1.fastq, SRR7169937-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:14:53 2025 >> started Wed Feb 12 04:15:10 2025 >> done (16.996s) 14246945 read pairs processed; of these: 20675 ( 0.15%) short read pairs filtered out after trimming by size control 69384 ( 0.49%) empty read pairs filtered out after trimming by size control 14156886 (99.37%) read pairs available; of these: 6703414 (47.35%) trimmed read pairs available after processing 7453472 (52.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 11 0.00% 21 10 0.00% 22 14 0.00% 23 13 0.00% 24 16 0.00% 25 12 0.00% 26 14 0.00% 27 40 0.00% 28 23 0.00% 29 18 0.00% 30 32 0.00% 31 32 0.00% 32 17 0.00% 33 27 0.00% 34 25 0.00% 35 44 0.00% 36 37 0.00% 37 29 0.00% 38 38 0.00% 39 44 0.00% 40 39 0.00% 41 46 0.00% 42 63 0.00% 43 64 0.00% 44 84 0.00% 45 92 0.00% 46 96 0.00% 47 106 0.00% 48 123 0.00% 49 126 0.00% 50 195 0.00% 51 162 0.00% 52 191 0.00% 53 199 0.00% 54 202 0.00% 55 213 0.00% 56 251 0.00% 57 310 0.00% 58 289 0.00% 59 396 0.00% 60 404 0.00% 61 498 0.00% 62 543 0.00% 63 633 0.00% 64 731 0.01% 65 969 0.01% 66 1105 0.01% 67 1288 0.01% 68 1492 0.01% 69 2426 0.02% 70 4181 0.03% 71 2639 0.02% 72 2175 0.02% 73 2261 0.02% 74 2370 0.02% 75 2568 0.02% 76 2651 0.02% 77 3024 0.02% 78 3190 0.02% 79 3671 0.03% 80 4146 0.03% 81 4651 0.03% 82 5251 0.04% 83 6164 0.04% 84 7504 0.05% 85 8870 0.06% 86 9081 0.06% 87 10290 0.07% 88 11060 0.08% 89 11253 0.08% 90 12350 0.09% 91 12712 0.09% 92 13614 0.10% 93 14812 0.10% 94 16286 0.12% 95 17491 0.12% 96 18134 0.13% 97 19338 0.14% 98 19646 0.14% 99 20169 0.14% 100 21406 0.15% 101 22499 0.16% 102 23860 0.17% 103 25119 0.18% 104 26503 0.19% 105 28021 0.20% 106 29362 0.21% 107 30307 0.21% 108 30790 0.22% 109 31824 0.22% 110 32403 0.23% 111 33626 0.24% 112 35435 0.25% 113 37263 0.26% 114 39035 0.28% 115 40031 0.28% 116 41808 0.30% 117 43012 0.30% 118 43456 0.31% 119 43293 0.31% 120 44029 0.31% 121 45485 0.32% 122 46078 0.33% 123 47569 0.34% 124 50440 0.36% 125 52095 0.37% 126 54172 0.38% 127 55211 0.39% 128 56441 0.40% 129 57099 0.40% 130 58194 0.41% 131 59320 0.42% 132 61138 0.43% 133 63804 0.45% 134 66285 0.47% 135 69926 0.49% 136 72404 0.51% 137 75860 0.54% 138 79559 0.56% 139 83442 0.59% 140 87083 0.62% 141 91794 0.65% 142 97300 0.69% 143 104683 0.74% 144 117510 0.83% 145 127713 0.90% 146 147994 1.05% 147 190412 1.35% 148 280654 1.98% 149 499290 3.53% 150 2815976 19.89% 151 7453472 52.65% 14156886 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.31 fanout-score-rank=20 prefix-density=0.26 prefix-fanout=5.5 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATA criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=814.04 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=26.9 sequence=AAAAGAAAACAAAGATGCATCAATCTCACATTTAGAAAAGGAGCTGCCCAAATGCAAGAGCAACGAGAGAAGCAAGAACAGCCGGCACAAAAGTGGTGGCATCGGAGGTAGGGCTAGGTGCTGGGGCCTCCGCTGCTGCTACATTTTGGACGGCTGAAACAGCCATGAGCACAACCACGATAGCCAAAAACACTCTCATCTTCAATGCCTCCATTGTGAAAAACTTTCTTGCTGGAAAAAACAGAGGCGTGGAGGGAGAAGAGAAAATGCAAGAT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=19.70 fanout-score-rank=14 prefix-density=0.41 prefix-fanout=7.7 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=6 fanout-score=241.03 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=25.9 sequence=AAGAAGAAGAAG SRR7169937 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:15:57 Started mapping on | Feb 12 04:15:57 Finished on | Feb 12 04:18:28 Mapping speed, Million of reads per hour | 337.52 Number of input reads | 14156886 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12917116 Uniquely mapped reads % | 91.24% Average mapped length | 290.16 Number of splices: Total | 10888496 Number of splices: Annotated (sjdb) | 10673292 Number of splices: GT/AG | 10714564 Number of splices: GC/AG | 133793 Number of splices: AT/AC | 9601 Number of splices: Non-canonical | 30538 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263406 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 26556 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.65% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 993103 993103 993103 N_multimapping 263406 263406 263406 N_noFeature 296872 12747907 376200 N_ambiguous 142361 970 51815 UnstrandedReadsAssigned:12477883 PositiveStrandReadsAssigned:168239 NegativeStrandReadsAssigned:12489101 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169937 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169937-trimmed-pair1.fastq SRR7169937-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,156,886 reads, 12,472,888 reads pseudoaligned [quant] estimated average fragment length: 214.527 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7169937.ke.tsv 34699 SRR7169937.se.tsv 87100 total ==> SRR7169937.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.47 242 9.26198 Potri.005G024800.1.v4.1 1035 821.473 73 6.13717 Potri.004G059700.1.v4.1 961 747.478 7 0.646752 Potri.007G009000.2.v4.1 1416 1202.47 0 0 Potri.003G141000.2.v4.1 2943 2729.47 209 5.28818 Potri.016G087400.1.v4.1 270 90.2008 1428 1093.34 Potri.015G069301.1.v4.1 564 352.195 0 0 Potri.010G195200.1.v4.1 1773 1559.47 17 0.752852 Potri.012G127500.1.v4.1 977 763.478 8806 796.564 ==> SRR7169937.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 877 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 422 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169937 completed mapping pipeline successfully