Starting /dee2/code/volunteer_pipeline.sh SRR7169938 current disk space = 3049147625472 free memory = 1300628464 SRR7169938 SRAfilesize 00c73f05cf522ad12e51ea1b6fec1523 SRR7169938.sra SRR7169938.sra file validated SRR7169938 is paired end SRR7169938 is conventional basespace SRR7169938 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99025 34.0 33.0 34.0 33.0 34.0 2 33.4465 34.0 34.0 34.0 33.0 34.0 3 33.456 34.0 34.0 34.0 33.0 34.0 4 33.5515 34.0 34.0 34.0 33.0 34.0 5 33.60975 34.0 34.0 34.0 33.0 34.0 6 37.32625 38.0 38.0 38.0 37.0 38.0 7 37.52375 38.0 38.0 38.0 37.0 38.0 8 37.58525 38.0 38.0 38.0 38.0 38.0 9 37.63975 38.0 38.0 38.0 38.0 38.0 10-14 37.62935 38.0 38.0 38.0 38.0 38.0 15-19 37.58485 38.0 38.0 38.0 38.0 38.0 20-24 37.5711 38.0 38.0 38.0 38.0 38.0 25-29 37.55 38.0 38.0 38.0 38.0 38.0 30-34 37.526050000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.45115 38.0 38.0 38.0 37.6 38.0 40-44 37.28165 38.0 38.0 38.0 37.0 38.0 45-49 37.234 38.0 38.0 38.0 36.6 38.0 50-54 37.22765 38.0 38.0 38.0 36.4 38.0 55-59 37.09685 38.0 38.0 38.0 36.0 38.0 60-64 37.051300000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.99335 38.0 38.0 38.0 36.0 38.0 70-74 36.927299999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.768899999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.665800000000004 38.0 38.0 38.0 34.6 38.0 85-89 36.488749999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.2417 38.0 37.2 38.0 33.8 38.0 95-99 35.960699999999996 38.0 37.0 38.0 32.6 38.0 100-104 35.78835 38.0 37.0 38.0 31.4 38.0 105-109 35.5544 38.0 36.2 38.0 30.2 38.0 110-114 35.3282 38.0 36.0 38.0 29.4 38.0 115-119 34.7216 38.0 35.2 38.0 27.0 38.0 120-124 34.25615 38.0 34.6 38.0 24.0 38.0 125-129 33.6505 37.8 34.0 38.0 19.4 38.0 130-134 32.7559 36.8 32.4 38.0 15.0 38.0 135-139 31.933250000000005 36.2 31.4 38.0 14.4 38.0 140-144 31.2736 36.0 31.0 38.0 14.0 38.0 145-149 29.35365 34.6 26.8 38.0 6.4 38.0 150-151 23.422125 29.5 8.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 3.0 15 2.0 16 0.0 17 4.0 18 4.0 19 11.0 20 8.0 21 10.0 22 12.0 23 11.0 24 15.0 25 15.0 26 20.0 27 25.0 28 28.0 29 46.0 30 67.0 31 72.0 32 95.0 33 153.0 34 253.0 35 525.0 36 1160.0 37 1458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.372299872935194 12.223634053367217 9.504447268106734 36.89961880559085 2 21.425 15.825 34.575 28.175 3 19.3 22.275 25.85 32.574999999999996 4 21.9 29.475 23.474999999999998 25.15 5 21.925 31.874999999999996 24.925 21.275 6 20.125 34.849999999999994 24.875 20.150000000000002 7 15.8 26.075 40.875 17.25 8 17.95 26.05 30.95 25.05 9 17.599999999999998 24.375 33.300000000000004 24.725 10-14 20.07 29.470000000000002 26.645000000000003 23.815 15-19 20.085 28.615000000000002 27.465 23.835 20-24 19.645000000000003 29.404999999999998 27.145000000000003 23.805 25-29 20.09 28.985 27.224999999999998 23.7 30-34 20.235 28.685 27.644999999999996 23.435 35-39 20.375 28.105000000000004 27.325 24.195 40-44 20.035 28.610000000000003 27.279999999999998 24.075 45-49 20.565 28.804999999999996 27.169999999999998 23.46 50-54 20.125 28.175 27.744999999999997 23.955000000000002 55-59 20.86 28.605000000000004 27.325 23.21 60-64 20.175 28.74 27.165 23.919999999999998 65-69 20.01 28.105000000000004 27.57 24.315 70-74 20.455000000000002 28.405 26.915 24.224999999999998 75-79 20.294999999999998 27.975 27.445000000000004 24.285 80-84 20.355 28.705000000000002 27.384999999999998 23.555 85-89 20.862086208620862 28.082808280828083 27.09270927092709 23.962396239623963 90-94 20.803924513190168 28.19742704109726 27.531661410622217 23.46698703509035 95-99 20.076156120046097 28.91928453329325 27.0003507189739 24.004208627686758 100-104 20.549999999999997 28.985 26.790000000000003 23.674999999999997 105-109 20.669999999999998 28.04 27.800000000000004 23.49 110-114 21.19 28.13 27.455000000000002 23.225 115-119 20.74 28.599999999999998 26.855 23.805 120-124 20.810000000000002 28.455000000000002 27.05 23.685000000000002 125-129 20.68 28.43 26.584999999999997 24.305 130-134 21.01 28.425 26.76 23.805 135-139 21.13028257064266 28.29707426856714 26.786696674168542 23.785946486621658 140-144 21.085 29.270000000000003 26.025 23.62 145-149 20.575 29.345 26.215 23.865 150-151 20.05 30.175 26.1625 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 0.5 24 2.0 25 2.5 26 3.0 27 4.0 28 6.0 29 13.0 30 14.0 31 19.5 32 29.0 33 45.0 34 60.0 35 64.5 36 72.5 37 91.5 38 115.0 39 150.0 40 183.0 41 215.0 42 243.0 43 256.5 44 278.5 45 273.0 46 261.0 47 252.0 48 234.0 49 225.0 50 196.5 51 154.0 52 127.5 53 106.5 54 85.5 55 66.0 56 47.5 57 32.5 58 20.0 59 12.5 60 10.5 61 8.5 62 4.5 63 4.5 64 3.0 65 1.0 66 1.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.11499999999999999 95-99 0.20500000000000002 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.025 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.3265511178095956 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025119316754584273 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGTACGATCTCGTATGC 7 0.17500000000000002 TruSeq Adapter, Index 22 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.025 0.0 0.0 0.0 88-89 0.4125 0.025 0.0 0.0 0.0 90-91 0.4625 0.025 0.0 0.0 0.0 92-93 0.525 0.025 0.0 0.0 0.0 94-95 0.6625 0.025 0.0 0.0 0.0 96-97 0.75 0.025 0.0 0.0 0.0 98-99 0.8625 0.025 0.0 0.0 0.0 100-101 1.0 0.025 0.0 0.0 0.0 102-103 1.2125 0.025 0.0 0.0 0.0 104-105 1.5375 0.025 0.0 0.0 0.0 106-107 1.8375 0.025 0.0 0.0 0.0 108-109 1.9874999999999998 0.025 0.0 0.0 0.0 110-111 2.2625 0.025 0.0 0.0 0.0 112-113 2.625 0.025 0.0 0.0 0.0 114-115 2.95 0.025 0.0 0.0 0.0 116-117 3.175 0.025 0.0 0.0 0.0 118-119 3.4749999999999996 0.025 0.0 0.0 0.0 120-121 3.7625 0.025 0.0 0.0 0.0 122-123 4.1375 0.025 0.0 0.0 0.0 124-125 4.5625 0.025 0.0 0.0 0.0 126-127 5.0375 0.025 0.0 0.0 0.0 128-129 5.4 0.025 0.0 0.0 0.0 130-131 5.825 0.025 0.0 0.0 0.0 132-133 6.5625 0.025 0.0 0.0 0.0 134-135 7.0625 0.025 0.0 0.0 0.0 136-137 7.5 0.025 0.0 0.0 0.0 138-139 7.9375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169938 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169938_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.04375 33.0 33.0 34.0 32.0 34.0 2 32.34 33.0 33.0 34.0 32.0 34.0 3 32.29175 34.0 33.0 34.0 32.0 34.0 4 32.02525 34.0 33.0 34.0 32.0 34.0 5 32.05375 34.0 33.0 34.0 32.0 34.0 6 36.3385 38.0 38.0 38.0 35.0 38.0 7 36.36175 38.0 38.0 38.0 35.0 38.0 8 36.4095 38.0 38.0 38.0 36.0 38.0 9 36.406 38.0 38.0 38.0 36.0 38.0 10-14 36.364200000000004 38.0 38.0 38.0 36.0 38.0 15-19 36.22 38.0 38.0 38.0 36.0 38.0 20-24 36.3126 38.0 38.0 38.0 36.0 38.0 25-29 36.31945 38.0 38.0 38.0 36.0 38.0 30-34 36.303399999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.21745 38.0 38.0 38.0 36.0 38.0 40-44 36.08235 38.0 38.0 38.0 35.6 38.0 45-49 35.99335 38.0 38.0 38.0 34.8 38.0 50-54 36.1508 38.0 38.0 38.0 35.0 38.0 55-59 36.13099999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.1262 38.0 38.0 38.0 35.0 38.0 65-69 35.936800000000005 38.0 38.0 38.0 34.2 38.0 70-74 35.93485 38.0 38.0 38.0 34.2 38.0 75-79 35.82325 38.0 38.0 38.0 33.8 38.0 80-84 35.734449999999995 38.0 38.0 38.0 33.6 38.0 85-89 35.3926 38.0 38.0 38.0 32.4 38.0 90-94 35.01305 38.0 38.0 38.0 29.0 38.0 95-99 35.2452 38.0 38.0 38.0 29.8 38.0 100-104 35.22785 38.0 38.0 38.0 30.6 38.0 105-109 35.130399999999995 38.0 37.4 38.0 31.0 38.0 110-114 34.914249999999996 38.0 37.0 38.0 28.4 38.0 115-119 34.64540000000001 38.0 37.0 38.0 26.6 38.0 120-124 34.356849999999994 38.0 36.0 38.0 24.0 38.0 125-129 33.844350000000006 38.0 35.6 38.0 18.6 38.0 130-134 32.90295 38.0 33.8 38.0 13.8 38.0 135-139 31.491499999999995 38.0 32.6 38.0 2.0 38.0 140-144 30.7231 38.0 31.4 38.0 2.0 38.0 145-149 29.81355 38.0 29.2 38.0 2.0 38.0 150-151 25.114625 33.0 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 79.0 3 20.0 4 0.0 5 2.0 6 0.0 7 0.0 8 4.0 9 3.0 10 2.0 11 2.0 12 4.0 13 6.0 14 5.0 15 5.0 16 4.0 17 6.0 18 8.0 19 12.0 20 8.0 21 7.0 22 15.0 23 21.0 24 20.0 25 26.0 26 32.0 27 34.0 28 42.0 29 40.0 30 53.0 31 71.0 32 96.0 33 135.0 34 138.0 35 259.0 36 539.0 37 2302.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.77208706786171 21.51088348271447 14.084507042253522 26.632522407170296 2 26.763064434297313 26.027397260273972 30.568239472349063 16.641298833079652 3 20.74413863404689 28.797145769622833 30.173292558613657 20.285423037716615 4 22.21936809658361 34.369380940148986 23.60647315694837 19.804777806319034 5 23.745819397993312 35.14278363776692 23.56573192693594 17.545665037303834 6 21.23217922606925 36.60896130346232 24.516293279022403 17.64256619144603 7 20.040640081280163 21.844043688087375 39.39547879095758 18.71983743967488 8 22.778059928897918 25.342813610970033 26.33316404266125 25.545962417470797 9 21.43764287528575 26.16205232410465 28.498856997713993 23.901447802895607 10-14 23.660190709295804 28.601295191474176 26.38315231247769 21.355361786752333 15-19 23.32889753301259 27.935305558399016 27.63332992117924 21.10246698740915 20-24 22.840230647548093 27.95325815175792 28.04510894524672 21.16140225544726 25-29 23.397533883623765 28.380719453785797 27.117089575053498 21.10465708753694 30-34 22.85335508872119 27.763614113807872 28.171527636141136 21.211503161329798 35-39 23.514093137254903 27.767565359477125 27.879901960784316 20.838439542483663 40-44 23.530316231869204 27.50755983804008 28.35836194966942 20.6037619804213 45-49 23.804397970167614 27.894817776410886 27.623148290532573 20.677635962888925 50-54 23.37510187449063 27.28198859005705 28.163202933985332 21.179706601466993 55-59 23.643134054274636 28.086104876555808 27.815751887369927 20.455009181799632 60-64 23.77233282286881 27.559979581419093 28.080653394589078 20.58703420112302 65-69 23.86833375861189 27.66522071957132 27.655014034192394 20.811431487624393 70-74 23.780239886155723 27.41410855865013 27.922341939418583 20.883309615775563 75-79 23.408144612572357 27.196100335127447 28.19640499644562 21.199350055854573 80-84 23.475206190815598 27.89430811526321 28.001221871499848 20.629263822421343 85-89 23.64861389703235 27.979221313583295 27.0945841691097 21.277580620274648 90-94 23.711340206185564 27.809148836968344 27.684815831736 20.794695125110085 95-99 23.71160322481886 27.278293703439125 28.007959995917954 21.002143075824065 100-104 23.88241875603926 27.30509077963688 28.362915119768097 20.449575344555765 105-109 23.54141166870665 28.32517339861281 27.12158302733578 21.011831905344756 110-114 23.837268731472964 28.03843401819483 27.731779617704184 20.392517632628028 115-119 24.505203019791878 27.627014894919405 27.371964905121406 20.495817180167315 120-124 24.760504840589995 27.4316995286127 27.254295706827513 20.553499923969788 125-129 24.35588792706039 27.915791630384675 27.459919069815093 20.268401372739845 130-134 25.32865448069973 27.54412611952024 26.983711307809145 20.14350809197088 135-139 24.79418368437934 27.590078049823585 27.397626430022452 20.218111835774618 140-144 24.767063921993497 28.244853737811482 26.64680390032503 20.34127843986999 145-149 25.01047559187094 28.71883511418395 26.487534045673584 19.783155248271527 150-151 24.291757466991413 28.342520189719266 26.45814639148827 20.907575951801054 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 57.0 1 30.0 2 2.5 3 1.0 4 2.0 5 2.0 6 1.0 7 1.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 1.5 15 2.5 16 1.5 17 0.5 18 0.5 19 1.0 20 2.5 21 2.0 22 0.5 23 1.5 24 3.0 25 3.5 26 2.0 27 5.5 28 6.5 29 7.5 30 11.0 31 13.0 32 21.5 33 25.5 34 39.5 35 62.0 36 79.0 37 106.0 38 134.0 39 147.5 40 181.5 41 221.5 42 248.5 43 275.0 44 278.0 45 275.0 46 265.5 47 246.5 48 229.0 49 208.5 50 182.5 51 147.5 52 112.5 53 92.0 54 76.5 55 55.0 56 39.0 57 29.5 58 24.5 59 20.0 60 14.0 61 8.5 62 4.5 63 3.5 64 2.0 65 1.5 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.375 2 1.4500000000000002 3 1.9 4 2.675 5 2.825 6 1.7999999999999998 7 1.575 8 1.55 9 1.575 10-14 1.9449999999999998 15-19 2.31 20-24 2.015 25-29 1.87 30-34 1.94 35-39 2.08 40-44 2.445 45-49 2.455 50-54 1.8399999999999999 55-59 1.9800000000000002 60-64 2.0500000000000003 65-69 2.025 70-74 1.6199999999999999 75-79 1.53 80-84 1.79 85-89 2.785 90-94 3.485 95-99 2.01 100-104 1.685 105-109 1.96 110-114 2.17 115-119 1.9800000000000002 120-124 1.355 125-129 2.385 130-134 4.535 135-139 6.47 140-144 7.7 145-149 4.54 150-151 2.4875000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4383456727087 97.375 2 0.4850651008424815 0.95 3 0.025529742149604292 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025529742149604292 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025529742149604292 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 58 1.4500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.875 0.0 0.0 0.0 0.0 110-111 2.1500000000000004 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.375 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.125 0.0 0.0 0.0 0.0 130-131 5.487500000000001 0.0 0.0 0.0 0.0 132-133 6.15 0.0 0.0 0.0 0.0 134-135 6.65 0.0 0.0 0.0 0.0 136-137 7.075 0.0 0.0 0.0 0.0 138-139 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716421 spots for SRR7169938.sra Written 716421 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra Read 716411 spots for SRR7169938.sra Written 716411 spots for SRR7169938.sra SRR ids: ['SRR7169938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gnt3_ct0 SRR7169938.sra spots: 14328230 blocks: [[1, 716411], [716412, 1432822], [1432823, 2149233], [2149234, 2865644], [2865645, 3582055], [3582056, 4298466], [4298467, 5014877], [5014878, 5731288], [5731289, 6447699], [6447700, 7164110], [7164111, 7880521], [7880522, 8596932], [8596933, 9313343], [9313344, 10029754], [10029755, 10746165], [10746166, 11462576], [11462577, 12178987], [12178988, 12895398], [12895399, 13611809], [13611810, 14328230]] SRR7169938 file size 4833666 SRR7169938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169938 SRR7169938_1.fastq SRR7169938_2.fastq Input file: SRR7169938_1.fastq Paired file: SRR7169938_2.fastq trimmed: SRR7169938-trimmed-pair1.fastq, SRR7169938-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:21:45 2025 >> started Wed Feb 12 04:22:00 2025 >> done (15.332s) 14328230 read pairs processed; of these: 22739 ( 0.16%) short read pairs filtered out after trimming by size control 62822 ( 0.44%) empty read pairs filtered out after trimming by size control 14242669 (99.40%) read pairs available; of these: 8124785 (57.05%) trimmed read pairs available after processing 6117884 (42.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 9 0.00% 23 5 0.00% 24 7 0.00% 25 11 0.00% 26 11 0.00% 27 6 0.00% 28 11 0.00% 29 12 0.00% 30 15 0.00% 31 9 0.00% 32 7 0.00% 33 11 0.00% 34 22 0.00% 35 15 0.00% 36 20 0.00% 37 18 0.00% 38 27 0.00% 39 37 0.00% 40 43 0.00% 41 43 0.00% 42 45 0.00% 43 43 0.00% 44 49 0.00% 45 48 0.00% 46 67 0.00% 47 90 0.00% 48 82 0.00% 49 108 0.00% 50 109 0.00% 51 148 0.00% 52 156 0.00% 53 142 0.00% 54 164 0.00% 55 182 0.00% 56 189 0.00% 57 217 0.00% 58 253 0.00% 59 272 0.00% 60 331 0.00% 61 408 0.00% 62 470 0.00% 63 521 0.00% 64 550 0.00% 65 636 0.00% 66 711 0.00% 67 767 0.01% 68 858 0.01% 69 986 0.01% 70 1244 0.01% 71 1414 0.01% 72 1559 0.01% 73 1793 0.01% 74 1934 0.01% 75 2138 0.02% 76 2188 0.02% 77 2438 0.02% 78 2564 0.02% 79 2961 0.02% 80 3357 0.02% 81 3916 0.03% 82 4343 0.03% 83 5090 0.04% 84 6258 0.04% 85 7190 0.05% 86 7222 0.05% 87 7595 0.05% 88 8154 0.06% 89 8403 0.06% 90 9067 0.06% 91 9873 0.07% 92 10681 0.07% 93 11917 0.08% 94 12545 0.09% 95 13488 0.09% 96 13857 0.10% 97 14396 0.10% 98 14775 0.10% 99 15292 0.11% 100 16195 0.11% 101 16818 0.12% 102 18163 0.13% 103 19425 0.14% 104 20551 0.14% 105 21646 0.15% 106 22427 0.16% 107 22990 0.16% 108 23194 0.16% 109 23802 0.17% 110 24652 0.17% 111 25791 0.18% 112 27814 0.20% 113 29000 0.20% 114 30191 0.21% 115 32151 0.23% 116 32766 0.23% 117 33913 0.24% 118 34064 0.24% 119 35249 0.25% 120 36187 0.25% 121 37022 0.26% 122 39345 0.28% 123 41521 0.29% 124 43809 0.31% 125 46451 0.33% 126 48132 0.34% 127 50081 0.35% 128 51214 0.36% 129 53219 0.37% 130 55443 0.39% 131 58172 0.41% 132 61743 0.43% 133 65582 0.46% 134 70041 0.49% 135 75162 0.53% 136 80902 0.57% 137 86113 0.60% 138 94262 0.66% 139 101898 0.72% 140 109087 0.77% 141 118907 0.83% 142 129576 0.91% 143 144771 1.02% 144 164515 1.16% 145 192992 1.36% 146 237059 1.66% 147 311684 2.19% 148 444177 3.12% 149 817157 5.74% 150 3531148 24.79% 151 6117884 42.95% 14242669 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=38 prefix-density=0.17 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.14 sequence-density-rank=5 fanout-score=100.17 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=19.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=38 prefix-density=0.32 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=280.85 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=30.2 sequence=AAGAAGAAGAAA SRR7169938 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:22:44 Started mapping on | Feb 12 04:22:44 Finished on | Feb 12 04:23:58 Mapping speed, Million of reads per hour | 692.89 Number of input reads | 14242669 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13589345 Uniquely mapped reads % | 95.41% Average mapped length | 291.23 Number of splices: Total | 12902467 Number of splices: Annotated (sjdb) | 12687501 Number of splices: GT/AG | 12716655 Number of splices: GC/AG | 148833 Number of splices: AT/AC | 10072 Number of splices: Non-canonical | 26907 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242350 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 51142 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 428333 428333 428333 N_multimapping 242350 242350 242350 N_noFeature 276503 13435004 350353 N_ambiguous 133822 1008 52528 UnstrandedReadsAssigned:13179020 PositiveStrandReadsAssigned:153333 NegativeStrandReadsAssigned:13186464 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7169938 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169938-trimmed-pair1.fastq SRR7169938-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,242,669 reads, 13,121,666 reads pseudoaligned [quant] estimated average fragment length: 235.343 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169938.ke.tsv 34699 SRR7169938.se.tsv 87100 total ==> SRR7169938.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.66 297 13.1018 Potri.005G024800.1.v4.1 1035 800.657 35 3.43958 Potri.004G059700.1.v4.1 961 726.779 9 0.974371 Potri.007G009000.2.v4.1 1416 1181.66 0 0 Potri.003G141000.2.v4.1 2943 2708.66 234 6.79745 Potri.016G087400.1.v4.1 270 86.3337 1421 1295.08 Potri.015G069301.1.v4.1 564 336.13 0 0 Potri.010G195200.1.v4.1 1773 1538.66 33 1.68755 Potri.012G127500.1.v4.1 977 742.739 3240 343.236 ==> SRR7169938.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1042 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR7169938 completed mapping pipeline successfully