Starting /dee2/code/volunteer_pipeline.sh SRR7169940 current disk space = 3049031368704 free memory = 1478362992 SRR7169940 SRAfilesize b5e87d555bc135356f19e4c61415b351 SRR7169940.sra SRR7169940.sra file validated SRR7169940 is paired end SRR7169940 is conventional basespace SRR7169940 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76325 34.0 33.0 34.0 33.0 34.0 2 33.39875 34.0 34.0 34.0 33.0 34.0 3 33.37 34.0 34.0 34.0 33.0 34.0 4 33.43425 34.0 34.0 34.0 33.0 34.0 5 33.452 34.0 34.0 34.0 33.0 34.0 6 37.0945 38.0 37.0 38.0 36.0 38.0 7 37.38675 38.0 38.0 38.0 37.0 38.0 8 37.543 38.0 38.0 38.0 37.0 38.0 9 37.5295 38.0 38.0 38.0 38.0 38.0 10-14 37.55925 38.0 38.0 38.0 38.0 38.0 15-19 37.510450000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.4969 38.0 38.0 38.0 37.6 38.0 25-29 37.4356 38.0 38.0 38.0 37.2 38.0 30-34 37.402 38.0 38.0 38.0 37.0 38.0 35-39 37.379599999999996 38.0 38.0 38.0 37.2 38.0 40-44 37.178250000000006 38.0 38.0 38.0 36.4 38.0 45-49 37.14155 38.0 38.0 38.0 36.0 38.0 50-54 37.0656 38.0 38.0 38.0 36.0 38.0 55-59 37.0289 38.0 38.0 38.0 36.0 38.0 60-64 36.9702 38.0 38.0 38.0 35.8 38.0 65-69 36.9239 38.0 38.0 38.0 36.0 38.0 70-74 36.8839 38.0 38.0 38.0 35.4 38.0 75-79 36.72265 38.0 38.0 38.0 34.8 38.0 80-84 36.58715 38.0 38.0 38.0 34.2 38.0 85-89 36.477650000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.4387 38.0 38.0 38.0 34.0 38.0 95-99 36.4246 38.0 38.0 38.0 34.0 38.0 100-104 36.11885 38.0 37.2 38.0 33.2 38.0 105-109 36.0232 38.0 37.0 38.0 33.0 38.0 110-114 35.6908 38.0 37.0 38.0 31.4 38.0 115-119 35.4268 38.0 36.2 38.0 30.2 38.0 120-124 35.1923 38.0 36.0 38.0 28.8 38.0 125-129 34.98205 38.0 36.0 38.0 28.0 38.0 130-134 34.412400000000005 38.0 35.0 38.0 25.0 38.0 135-139 34.0021 38.0 35.0 38.0 23.0 38.0 140-144 33.838150000000006 38.0 35.0 38.0 22.6 38.0 145-149 33.19015 38.0 34.4 38.0 17.6 38.0 150-151 29.457500000000003 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 1.0 18 4.0 19 3.0 20 8.0 21 12.0 22 10.0 23 19.0 24 16.0 25 16.0 26 17.0 27 25.0 28 25.0 29 44.0 30 52.0 31 55.0 32 65.0 33 105.0 34 156.0 35 289.0 36 646.0 37 2424.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.82510866785988 12.733316287394528 8.82127333162874 34.62030171311685 2 23.425 13.65 31.924999999999997 31.0 3 19.725 17.599999999999998 26.6 36.075 4 22.225 25.074999999999996 23.325000000000003 29.375 5 22.0 30.125 23.525 24.349999999999998 6 19.650000000000002 34.725 23.849999999999998 21.775 7 14.325 27.525 39.35 18.8 8 18.3 26.150000000000002 31.3 24.25 9 18.125 24.275 33.050000000000004 24.55 10-14 19.585 29.345 27.500000000000004 23.57 15-19 19.895 28.68 27.405 24.02 20-24 20.305 28.865000000000002 27.26 23.57 25-29 19.74 29.265 26.895000000000003 24.099999999999998 30-34 20.244999999999997 28.585 26.99 24.18 35-39 20.41 28.060000000000002 27.54 23.990000000000002 40-44 19.950000000000003 28.23 27.61 24.21 45-49 19.905 28.07 27.765 24.26 50-54 20.465 28.375 27.37 23.79 55-59 20.875 28.449999999999996 26.71 23.965 60-64 20.794999999999998 27.38 27.500000000000004 24.325 65-69 20.885 27.82 27.045 24.25 70-74 20.02 27.97 27.685 24.325 75-79 20.125 28.060000000000002 27.450000000000003 24.365000000000002 80-84 20.195 27.894999999999996 27.51 24.4 85-89 20.585 28.18 27.150000000000002 24.085 90-94 20.62 27.785 27.62 23.974999999999998 95-99 20.54 28.04 27.33 24.09 100-104 20.755000000000003 27.57 27.515 24.16 105-109 20.62 28.025 27.305 24.05 110-114 21.22 27.875 27.075 23.830000000000002 115-119 20.825 28.355000000000004 27.185 23.635 120-124 20.94 27.650000000000002 26.87 24.54 125-129 21.425 28.105000000000004 26.58 23.89 130-134 21.38 28.42 26.11 24.09 135-139 21.62 28.015 26.490000000000002 23.875 140-144 21.52 27.96 26.355 24.165 145-149 21.529999999999998 27.560000000000002 26.790000000000003 24.12 150-151 20.8875 28.5625 26.387500000000003 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.5 24 1.0 25 2.5 26 5.5 27 7.5 28 8.0 29 9.0 30 10.5 31 15.0 32 26.5 33 38.0 34 47.0 35 52.5 36 72.0 37 98.0 38 116.0 39 133.0 40 158.5 41 189.0 42 215.5 43 242.5 44 263.5 45 297.0 46 307.5 47 279.0 48 243.0 49 209.0 50 187.5 51 173.0 52 149.5 53 119.0 54 90.0 55 60.0 56 47.0 57 35.0 58 24.5 59 19.0 60 9.0 61 6.5 62 6.5 63 6.5 64 4.5 65 2.5 66 2.0 67 3.5 68 3.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3250000000000002 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.575 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.5125 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.262499999999999 0.0 0.0 0.0 0.0 126-127 5.824999999999999 0.0 0.0 0.0 0.0 128-129 6.4375 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.7125 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 9.075 0.0 0.0 0.0 0.0 138-139 9.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAGTG 10 0.006832588 144.9875 3 >>END_MODULE SRR7169940 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169940_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5505 33.0 33.0 34.0 31.0 34.0 2 32.1825 33.0 33.0 34.0 31.0 34.0 3 32.19825 34.0 33.0 34.0 31.0 34.0 4 31.8545 34.0 33.0 34.0 31.0 34.0 5 31.79925 34.0 33.0 34.0 31.0 34.0 6 36.17675 38.0 38.0 38.0 34.0 38.0 7 36.23275 38.0 38.0 38.0 35.0 38.0 8 36.29425 38.0 38.0 38.0 35.0 38.0 9 36.355 38.0 38.0 38.0 36.0 38.0 10-14 36.263200000000005 38.0 38.0 38.0 35.8 38.0 15-19 36.04335 38.0 38.0 38.0 35.0 38.0 20-24 36.23435 38.0 38.0 38.0 35.8 38.0 25-29 36.2806 38.0 38.0 38.0 35.6 38.0 30-34 36.34705 38.0 38.0 38.0 36.0 38.0 35-39 36.2048 38.0 38.0 38.0 36.0 38.0 40-44 36.0433 38.0 38.0 38.0 35.4 38.0 45-49 35.90904999999999 38.0 38.0 38.0 34.6 38.0 50-54 36.18285 38.0 38.0 38.0 35.0 38.0 55-59 36.1267 38.0 38.0 38.0 35.0 38.0 60-64 36.093650000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.02835 38.0 38.0 38.0 34.6 38.0 70-74 35.951699999999995 38.0 38.0 38.0 34.0 38.0 75-79 35.81945 38.0 38.0 38.0 33.8 38.0 80-84 35.77055 38.0 38.0 38.0 33.8 38.0 85-89 35.28275000000001 38.0 38.0 38.0 31.8 38.0 90-94 34.877449999999996 38.0 38.0 38.0 29.0 38.0 95-99 35.1922 38.0 38.0 38.0 29.0 38.0 100-104 35.424800000000005 38.0 38.0 38.0 31.8 38.0 105-109 35.25 38.0 38.0 38.0 30.8 38.0 110-114 35.06615 38.0 37.8 38.0 29.2 38.0 115-119 34.7995 38.0 37.2 38.0 27.2 38.0 120-124 34.7004 38.0 36.6 38.0 27.6 38.0 125-129 34.13125 38.0 36.0 38.0 23.2 38.0 130-134 33.039 38.0 35.0 38.0 11.8 38.0 135-139 31.761400000000002 38.0 34.2 38.0 2.0 38.0 140-144 30.669900000000002 38.0 32.4 38.0 2.0 38.0 145-149 30.1779 38.0 31.2 38.0 2.0 38.0 150-151 26.481250000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 90.0 3 5.0 4 3.0 5 0.0 6 3.0 7 2.0 8 0.0 9 1.0 10 4.0 11 5.0 12 1.0 13 3.0 14 6.0 15 5.0 16 6.0 17 6.0 18 6.0 19 8.0 20 13.0 21 14.0 22 6.0 23 18.0 24 23.0 25 24.0 26 29.0 27 30.0 28 34.0 29 48.0 30 63.0 31 85.0 32 98.0 33 165.0 34 134.0 35 201.0 36 471.0 37 2390.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.18323789692869 21.993753253513795 13.482561166059345 26.34044768349818 2 26.50632911392405 26.860759493670887 28.78481012658228 17.848101265822784 3 21.355759429153924 28.363914373088683 30.759429153924568 19.520897043832825 4 24.006195147134747 33.09241094475993 24.03200826019618 18.869385647909137 5 24.689762150982418 36.142709410548086 21.61323681489142 17.554291623578077 6 20.673813169984687 35.7069933639612 24.349157733537517 19.27003573251659 7 20.39305768249107 22.154160285860133 38.61664114344053 18.83614088820827 8 21.424936386768447 25.547073791348602 26.717557251908396 26.310432569974555 9 22.233554309026008 24.73227944926058 29.831718510963796 23.20244773074962 10-14 24.05484217526986 28.86888013505909 26.01422213127334 21.06205555839771 15-19 24.28174235403151 27.82926578107301 27.149624137575945 20.739367727319536 20-24 24.01064864588133 27.95781497977781 27.00046075871602 21.03107561562484 25-29 24.26114031953448 28.186412128017967 26.573426573426573 20.97902097902098 30-34 23.759644371774563 27.949517142711155 27.126871391344338 21.163967094169944 35-39 24.238078164216564 28.192388464887568 27.126978435691235 20.44255493520463 40-44 24.20002057824879 27.52855232019755 27.322769832287275 20.948657269266384 45-49 24.31513903192585 27.70854788877446 27.48197734294542 20.494335736354273 50-54 23.597056117755287 28.084432178268425 27.200245323520395 21.118266380455893 55-59 23.479150677922743 28.06344333589153 27.39319519058583 21.064210795599898 60-64 23.845091318360872 27.687113111986495 27.206220903463446 21.261574666189183 65-69 24.08979341378605 27.244835344651257 27.58744119451831 21.077930047044386 70-74 24.724521403544404 28.34509724267506 26.49164677804296 20.43873457573757 75-79 23.960607137418144 26.99121782831616 28.179095385552564 20.869079648713132 80-84 24.568921538618508 27.665544332211 27.29823487399245 20.46729925517804 85-89 24.540607691909518 27.382369687872043 27.80682229929085 20.270200320927582 90-94 24.53933288093125 27.73920760035496 27.316385655374013 20.40507386333977 95-99 24.6145966709347 28.199743918053777 27.067861715749043 20.117797695262485 100-104 24.001226116276694 27.602942679064064 27.633595585981404 20.76223561867784 105-109 24.267225945061128 27.02951557624431 27.331321295206916 21.371937183487645 110-114 24.433391447031074 27.5356373705261 27.607424879499536 20.423546302943286 115-119 24.65201651965533 27.77239585988885 27.07897822872585 20.496609391729976 120-124 24.502103076065474 28.840014189428874 26.19469923478437 20.46318349972128 125-129 25.494833170531077 28.219628810858055 26.492211197367745 19.793326821243124 130-134 25.58423624389208 28.011472275334608 26.391544508179308 20.01274697259401 135-139 25.88144979985743 28.124143225311183 26.561386192904536 19.433020781926853 140-144 26.326074818537133 27.671691792294805 26.51032942490229 19.491903964265774 145-149 25.93871156195231 27.569175208455043 26.549471559827925 19.942641669764726 150-151 26.35848570692763 27.55601339170744 26.461498841102237 19.624002060262683 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 52.0 1 26.5 2 2.0 3 4.0 4 4.5 5 5.0 6 5.0 7 3.5 8 3.0 9 2.0 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 0.5 16 0.5 17 1.0 18 1.5 19 2.5 20 1.5 21 0.0 22 1.0 23 1.5 24 2.0 25 3.0 26 3.5 27 3.0 28 1.0 29 4.0 30 6.5 31 11.5 32 20.0 33 22.5 34 33.5 35 40.5 36 52.0 37 87.5 38 114.0 39 146.5 40 174.5 41 200.0 42 232.0 43 273.0 44 279.0 45 277.5 46 298.0 47 284.0 48 275.0 49 240.0 50 185.5 51 148.5 52 122.5 53 99.5 54 70.5 55 50.0 56 39.0 57 28.0 58 19.0 59 13.5 60 10.0 61 8.0 62 8.5 63 7.0 64 2.5 65 1.5 66 2.5 67 1.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.95 2 1.25 3 1.9 4 3.15 5 3.3000000000000003 6 2.0500000000000003 7 2.0500000000000003 8 1.7500000000000002 9 1.95 10-14 2.265 15-19 2.8899999999999997 20-24 2.335 25-29 2.045 30-34 2.145 35-39 2.385 40-44 2.81 45-49 2.9000000000000004 50-54 2.17 55-59 2.275 60-64 2.265 65-69 2.22 70-74 1.5350000000000001 75-79 1.505 80-84 1.9900000000000002 85-89 3.405 90-94 4.215 95-99 2.375 100-104 2.13 105-109 2.255 110-114 2.4899999999999998 115-119 1.9349999999999998 120-124 1.335 125-129 2.7449999999999997 130-134 5.86 135-139 8.815000000000001 140-144 10.45 145-149 5.8549999999999995 150-151 2.9250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.43848902501277 97.39999999999999 2 0.45941807044410415 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.025523226135783564 0.125 6 0.025523226135783564 0.15 7 0.025523226135783564 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025523226135783564 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 50 1.25 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.6375 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 4.175 0.0 0.0 0.0 0.0 120-121 4.5875 0.0 0.0 0.0 0.0 122-123 4.9625 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.475 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.637499999999999 0.0 0.0 0.0 0.0 134-135 8.0125 0.0 0.0 0.0 0.0 136-137 8.825 0.0 0.0 0.0 0.0 138-139 9.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGGG 10 0.0069984905 143.78206 5 >>END_MODULE Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924462 spots for SRR7169940.sra Written 924462 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra Read 924460 spots for SRR7169940.sra Written 924460 spots for SRR7169940.sra SRR ids: ['SRR7169940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_db7w71ez SRR7169940.sra spots: 18489202 blocks: [[1, 924460], [924461, 1848920], [1848921, 2773380], [2773381, 3697840], [3697841, 4622300], [4622301, 5546760], [5546761, 6471220], [6471221, 7395680], [7395681, 8320140], [8320141, 9244600], [9244601, 10169060], [10169061, 11093520], [11093521, 12017980], [12017981, 12942440], [12942441, 13866900], [13866901, 14791360], [14791361, 15715820], [15715821, 16640280], [16640281, 17564740], [17564741, 18489202]] SRR7169940 file size 6243683 SRR7169940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169940 SRR7169940_1.fastq SRR7169940_2.fastq Input file: SRR7169940_1.fastq Paired file: SRR7169940_2.fastq trimmed: SRR7169940-trimmed-pair1.fastq, SRR7169940-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:56:10 2025 >> started Wed Feb 12 03:56:30 2025 >> done (19.251s) 18489202 read pairs processed; of these: 32952 ( 0.18%) short read pairs filtered out after trimming by size control 47940 ( 0.26%) empty read pairs filtered out after trimming by size control 18408310 (99.56%) read pairs available; of these: 8999110 (48.89%) trimmed read pairs available after processing 9409200 (51.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 11 0.00% 22 0 0.00% 23 6 0.00% 24 8 0.00% 25 8 0.00% 26 10 0.00% 27 9 0.00% 28 10 0.00% 29 12 0.00% 30 16 0.00% 31 17 0.00% 32 14 0.00% 33 10 0.00% 34 22 0.00% 35 13 0.00% 36 22 0.00% 37 19 0.00% 38 20 0.00% 39 22 0.00% 40 43 0.00% 41 32 0.00% 42 32 0.00% 43 52 0.00% 44 51 0.00% 45 58 0.00% 46 63 0.00% 47 73 0.00% 48 98 0.00% 49 113 0.00% 50 120 0.00% 51 163 0.00% 52 155 0.00% 53 167 0.00% 54 170 0.00% 55 197 0.00% 56 206 0.00% 57 225 0.00% 58 332 0.00% 59 358 0.00% 60 385 0.00% 61 462 0.00% 62 528 0.00% 63 588 0.00% 64 688 0.00% 65 772 0.00% 66 865 0.00% 67 985 0.01% 68 1245 0.01% 69 1533 0.01% 70 1959 0.01% 71 1823 0.01% 72 1980 0.01% 73 2162 0.01% 74 2486 0.01% 75 2731 0.01% 76 3009 0.02% 77 3251 0.02% 78 3615 0.02% 79 4145 0.02% 80 4579 0.02% 81 5261 0.03% 82 5915 0.03% 83 6708 0.04% 84 8860 0.05% 85 10213 0.06% 86 10820 0.06% 87 11598 0.06% 88 12369 0.07% 89 12726 0.07% 90 13636 0.07% 91 14742 0.08% 92 15500 0.08% 93 16948 0.09% 94 18363 0.10% 95 19827 0.11% 96 20935 0.11% 97 21735 0.12% 98 22929 0.12% 99 23876 0.13% 100 24971 0.14% 101 25803 0.14% 102 27683 0.15% 103 29152 0.16% 104 31030 0.17% 105 32847 0.18% 106 34655 0.19% 107 35106 0.19% 108 36154 0.20% 109 37084 0.20% 110 38731 0.21% 111 39914 0.22% 112 41613 0.23% 113 43803 0.24% 114 45908 0.25% 115 48408 0.26% 116 50218 0.27% 117 51101 0.28% 118 52874 0.29% 119 53572 0.29% 120 54589 0.30% 121 56070 0.30% 122 58106 0.32% 123 60102 0.33% 124 63052 0.34% 125 64760 0.35% 126 67404 0.37% 127 70040 0.38% 128 71909 0.39% 129 73655 0.40% 130 76564 0.42% 131 78115 0.42% 132 80695 0.44% 133 84531 0.46% 134 87710 0.48% 135 92232 0.50% 136 96666 0.53% 137 101352 0.55% 138 109175 0.59% 139 115199 0.63% 140 121286 0.66% 141 130536 0.71% 142 138780 0.75% 143 148769 0.81% 144 164187 0.89% 145 184984 1.00% 146 217518 1.18% 147 282943 1.54% 148 384534 2.09% 149 723548 3.93% 150 3843754 20.88% 151 9409200 51.11% 18408310 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=98.76 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.2 sequence=CATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=46 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=46 fanout-score=156.61 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.6 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169940 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:57:12 Started mapping on | Feb 12 03:57:13 Finished on | Feb 12 03:58:49 Mapping speed, Million of reads per hour | 690.31 Number of input reads | 18408310 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17489665 Uniquely mapped reads % | 95.01% Average mapped length | 290.87 Number of splices: Total | 16158138 Number of splices: Annotated (sjdb) | 15891440 Number of splices: GT/AG | 15932288 Number of splices: GC/AG | 180309 Number of splices: AT/AC | 13404 Number of splices: Non-canonical | 32137 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306048 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 26130 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637957 637957 637957 N_multimapping 306048 306048 306048 N_noFeature 341127 17258221 447700 N_ambiguous 191511 899 66060 UnstrandedReadsAssigned:16957027 PositiveStrandReadsAssigned:230545 NegativeStrandReadsAssigned:16975905 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169940 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169940-trimmed-pair1.fastq SRR7169940-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,408,310 reads, 16,887,368 reads pseudoaligned [quant] estimated average fragment length: 217.107 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,020 rounds 52401 SRR7169940.ke.tsv 34699 SRR7169940.se.tsv 87100 total ==> SRR7169940.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.89 301 9.55107 Potri.005G024800.1.v4.1 1035 818.893 42 2.93249 Potri.004G059700.1.v4.1 961 744.911 2 0.153511 Potri.007G009000.2.v4.1 1416 1199.89 0 0 Potri.003G141000.2.v4.1 2943 2726.89 298 6.24831 Potri.016G087400.1.v4.1 270 89.411 1469.46 939.684 Potri.015G069301.1.v4.1 564 350.203 0 0 Potri.010G195200.1.v4.1 1773 1556.89 21 0.771215 Potri.012G127500.1.v4.1 977 760.899 6891 517.809 ==> SRR7169940.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1251 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 31 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169940 completed mapping pipeline successfully