Starting /dee2/code/volunteer_pipeline.sh SRR7169941 current disk space = 3049049272320 free memory = 1484130488 SRR7169941 SRAfilesize 97c76c27a0f3f0dbc6b4e87446e92ed4 SRR7169941.sra SRR7169941.sra file validated SRR7169941 is paired end SRR7169941 is conventional basespace SRR7169941 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169941_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7915 34.0 33.0 34.0 33.0 34.0 2 33.3755 34.0 34.0 34.0 33.0 34.0 3 33.37975 34.0 34.0 34.0 33.0 34.0 4 33.509 34.0 34.0 34.0 33.0 34.0 5 33.5015 34.0 34.0 34.0 33.0 34.0 6 37.24775 38.0 38.0 38.0 36.0 38.0 7 37.51025 38.0 38.0 38.0 37.0 38.0 8 37.568 38.0 38.0 38.0 38.0 38.0 9 37.615 38.0 38.0 38.0 38.0 38.0 10-14 37.5921 38.0 38.0 38.0 38.0 38.0 15-19 37.5727 38.0 38.0 38.0 38.0 38.0 20-24 37.53555 38.0 38.0 38.0 38.0 38.0 25-29 37.50145 38.0 38.0 38.0 38.0 38.0 30-34 37.4837 38.0 38.0 38.0 38.0 38.0 35-39 37.408 38.0 38.0 38.0 37.6 38.0 40-44 37.2069 38.0 38.0 38.0 37.0 38.0 45-49 37.141299999999994 38.0 38.0 38.0 36.4 38.0 50-54 37.1185 38.0 38.0 38.0 36.2 38.0 55-59 37.0486 38.0 38.0 38.0 36.0 38.0 60-64 36.95575 38.0 38.0 38.0 36.0 38.0 65-69 36.91525 38.0 38.0 38.0 35.8 38.0 70-74 36.85785 38.0 38.0 38.0 35.8 38.0 75-79 36.7659 38.0 38.0 38.0 35.0 38.0 80-84 36.716300000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.5843 38.0 38.0 38.0 34.4 38.0 90-94 36.4069 38.0 38.0 38.0 34.0 38.0 95-99 36.22695 38.0 38.0 38.0 34.0 38.0 100-104 36.14465 38.0 37.2 38.0 33.4 38.0 105-109 36.01565000000001 38.0 37.0 38.0 33.2 38.0 110-114 35.83775000000001 38.0 37.0 38.0 32.0 38.0 115-119 35.658899999999996 38.0 37.0 38.0 31.0 38.0 120-124 35.39489999999999 38.0 36.0 38.0 30.6 38.0 125-129 34.9517 38.0 36.0 38.0 28.2 38.0 130-134 34.554199999999994 38.0 35.0 38.0 26.2 38.0 135-139 34.2679 38.0 35.0 38.0 24.2 38.0 140-144 33.97795 38.0 35.0 38.0 23.2 38.0 145-149 33.241949999999996 38.0 33.4 38.0 19.0 38.0 150-151 29.060625 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 2.0 12 3.0 13 3.0 14 0.0 15 2.0 16 1.0 17 2.0 18 10.0 19 7.0 20 4.0 21 12.0 22 12.0 23 6.0 24 15.0 25 13.0 26 23.0 27 22.0 28 22.0 29 35.0 30 47.0 31 53.0 32 58.0 33 101.0 34 129.0 35 264.0 36 726.0 37 2425.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.146216768916155 12.065439672801636 9.074642126789366 34.713701431492844 2 23.125 14.000000000000002 32.324999999999996 30.55 3 20.325 21.349999999999998 25.474999999999998 32.85 4 22.45 27.725 23.599999999999998 26.224999999999998 5 22.05 33.225 23.549999999999997 21.175 6 19.375 35.725 24.4 20.5 7 15.325 25.724999999999998 41.475 17.474999999999998 8 18.075 27.275 30.225 24.425 9 17.25 25.074999999999996 32.4 25.275 10-14 19.56 30.270000000000003 27.375 22.795 15-19 19.865 28.33 28.384999999999998 23.419999999999998 20-24 20.674999999999997 29.110000000000003 26.93 23.285 25-29 19.965 28.79 27.544999999999998 23.7 30-34 19.27 29.205 28.075 23.45 35-39 20.205000000000002 29.09 27.355 23.35 40-44 20.105 28.975 27.439999999999998 23.48 45-49 20.035 28.449999999999996 27.87 23.645 50-54 19.68 29.39 27.455000000000002 23.474999999999998 55-59 19.86 27.955000000000002 27.505000000000003 24.68 60-64 20.335 28.71 27.13 23.825 65-69 20.285 28.27 27.825 23.62 70-74 20.175 29.59 26.655 23.580000000000002 75-79 20.24 29.110000000000003 26.39 24.26 80-84 20.97 28.560000000000002 26.72 23.75 85-89 20.173025953893085 28.21423213482022 27.964194629194377 23.648547282092313 90-94 20.475713570355534 28.187280921382076 27.250876314471707 24.086129193790686 95-99 20.076213397513037 28.770557561171277 27.291415964701166 23.86181307661452 100-104 20.4 29.060000000000002 27.255000000000003 23.285 105-109 20.200000000000003 28.63 27.3 23.87 110-114 20.36 29.165000000000003 26.695 23.78 115-119 20.355 28.915000000000003 27.175 23.555 120-124 20.335 28.499999999999996 27.089999999999996 24.075 125-129 21.035 28.384999999999998 26.950000000000003 23.630000000000003 130-134 20.645 28.075 27.255000000000003 24.025 135-139 20.88626587976393 28.093428028408525 27.13313994198259 23.887166149844955 140-144 20.95 27.915 27.229999999999997 23.905 145-149 20.169999999999998 28.77 26.31 24.75 150-151 20.849999999999998 28.249999999999996 26.137500000000003 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 4.0 24 4.0 25 2.5 26 6.0 27 7.5 28 6.5 29 15.0 30 20.5 31 21.0 32 29.5 33 46.5 34 54.0 35 67.0 36 94.0 37 113.5 38 130.0 39 155.5 40 184.0 41 197.0 42 223.0 43 267.0 44 278.0 45 254.5 46 250.0 47 267.0 48 244.0 49 204.0 50 177.0 51 145.0 52 127.0 53 105.0 54 76.5 55 64.0 56 44.0 57 22.5 58 17.0 59 17.5 60 13.0 61 8.5 62 8.0 63 4.0 64 2.5 65 2.5 66 2.5 67 3.5 68 3.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.15 95-99 0.27999999999999997 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.03 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0125 0.0 0.0 0.0 86-87 0.175 0.025 0.0 0.0 0.0 88-89 0.175 0.025 0.0 0.0 0.0 90-91 0.2 0.025 0.0 0.0 0.0 92-93 0.30000000000000004 0.025 0.0 0.0 0.0 94-95 0.3875 0.025 0.0 0.0 0.0 96-97 0.48750000000000004 0.025 0.0 0.0 0.0 98-99 0.625 0.025 0.0 0.0 0.0 100-101 0.7875 0.025 0.0 0.0 0.0 102-103 0.8875 0.025 0.0 0.0 0.0 104-105 1.0125000000000002 0.025 0.0 0.0 0.0 106-107 1.2875 0.025 0.0 0.0 0.0 108-109 1.5875 0.025 0.0 0.0 0.0 110-111 1.8 0.025 0.0 0.0 0.0 112-113 1.95 0.025 0.0 0.0 0.0 114-115 2.25 0.025 0.0 0.0 0.0 116-117 2.5125 0.025 0.0 0.0 0.0 118-119 2.8 0.025 0.0 0.0 0.0 120-121 3.1375 0.025 0.0 0.0 0.0 122-123 3.5625 0.025 0.0 0.0 0.0 124-125 3.975 0.025 0.0 0.0 0.0 126-127 4.4 0.025 0.0 0.0 0.0 128-129 4.75 0.025 0.0 0.0 0.0 130-131 5.025 0.025 0.0 0.0 0.0 132-133 5.425000000000001 0.025 0.0 0.0 0.0 134-135 5.8125 0.025 0.0 0.0 0.0 136-137 6.175 0.025 0.0 0.0 0.0 138-139 6.75 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAAA 10 0.006832588 144.9875 6 GATAATT 10 0.006832588 144.9875 2 CTTGATT 10 0.006832588 144.9875 8 AGTAGAA 20 3.5889345E-4 108.74062 5 >>END_MODULE SRR7169941 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169941_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.871 33.0 33.0 34.0 32.0 34.0 2 32.163 34.0 33.0 34.0 32.0 34.0 3 32.0805 34.0 33.0 34.0 32.0 34.0 4 31.8175 34.0 33.0 34.0 32.0 34.0 5 31.773 34.0 33.0 34.0 32.0 34.0 6 36.054 38.0 38.0 38.0 35.0 38.0 7 36.167 38.0 38.0 38.0 36.0 38.0 8 36.17375 38.0 38.0 38.0 36.0 38.0 9 36.25025 38.0 38.0 38.0 36.0 38.0 10-14 36.084500000000006 38.0 38.0 38.0 35.8 38.0 15-19 35.896 38.0 38.0 38.0 35.6 38.0 20-24 35.972449999999995 38.0 38.0 38.0 35.6 38.0 25-29 36.041650000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.0577 38.0 38.0 38.0 36.0 38.0 35-39 35.927049999999994 38.0 38.0 38.0 35.4 38.0 40-44 35.8226 38.0 38.0 38.0 35.8 38.0 45-49 35.68205 38.0 38.0 38.0 34.2 38.0 50-54 35.91985 38.0 38.0 38.0 35.2 38.0 55-59 35.900400000000005 38.0 38.0 38.0 35.2 38.0 60-64 35.86015 38.0 38.0 38.0 35.0 38.0 65-69 35.75485 38.0 38.0 38.0 34.2 38.0 70-74 35.780699999999996 38.0 38.0 38.0 34.4 38.0 75-79 35.676700000000004 38.0 38.0 38.0 33.8 38.0 80-84 35.6271 38.0 38.0 38.0 34.0 38.0 85-89 35.315799999999996 38.0 38.0 38.0 32.4 38.0 90-94 34.837149999999994 38.0 38.0 38.0 29.0 38.0 95-99 35.191199999999995 38.0 38.0 38.0 30.2 38.0 100-104 35.228300000000004 38.0 38.0 38.0 30.8 38.0 105-109 35.098 38.0 38.0 38.0 30.6 38.0 110-114 34.96465 38.0 37.8 38.0 29.6 38.0 115-119 34.63035 38.0 37.2 38.0 26.8 38.0 120-124 34.4409 38.0 36.6 38.0 25.4 38.0 125-129 33.93164999999999 38.0 35.8 38.0 20.6 38.0 130-134 32.8198 38.0 34.4 38.0 9.0 38.0 135-139 31.4895 38.0 33.0 38.0 2.0 38.0 140-144 30.613549999999996 38.0 31.4 38.0 2.0 38.0 145-149 30.001500000000004 38.0 30.0 38.0 2.0 38.0 150-151 25.4955 33.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 117.0 3 19.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 4.0 11 4.0 12 1.0 13 2.0 14 2.0 15 2.0 16 7.0 17 10.0 18 14.0 19 4.0 20 7.0 21 6.0 22 9.0 23 16.0 24 23.0 25 27.0 26 22.0 27 29.0 28 33.0 29 50.0 30 50.0 31 66.0 32 91.0 33 144.0 34 121.0 35 193.0 36 483.0 37 2438.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.03048307930767 20.330663911134074 13.252389563420305 24.38646344613795 2 26.710929519918285 26.455566905005107 30.107252298263532 16.726251276813077 3 21.005385996409338 28.007181328545784 31.16183636829956 19.825596306745318 4 23.950233281493002 32.68532918610679 24.339035769828925 19.02540176257128 5 24.928589976629446 37.05531030901065 22.2020254479356 15.814074266424305 6 22.743589743589745 36.58974358974359 23.205128205128204 17.46153846153846 7 20.761953464587062 21.835847609307084 37.12605471746356 20.27614420864229 8 22.713336739908023 25.08942258559019 27.414409810935105 24.782830863566684 9 22.296087957044232 25.108667859882384 28.892866274610075 23.70237790846331 10-14 23.577444535743634 28.949260476581756 26.32497945768283 21.14831552999178 15-19 23.284136649809064 27.737640623387342 27.716998658272267 21.261224068531323 20-24 23.12516062708815 28.290927782061164 27.530197892572605 21.053713698278077 25-29 23.55295566502463 27.858169129720856 27.801724137931032 20.78715106732348 30-34 23.696779826408505 27.466488624107647 27.69760156129629 21.13912998818756 35-39 23.097504502186776 28.08850012863391 27.25495240545408 21.55904296372524 40-44 23.470126111225966 27.832334091378954 27.94087244159603 20.75666735579905 45-49 23.32988624612203 27.254395036194417 28.066184074457084 21.349534643226473 50-54 23.790715568094384 28.012310848935623 27.02231341369582 21.174660169274173 55-59 23.638232271325794 27.970195272353543 27.857142857142858 20.534429599177802 60-64 23.703970376465747 27.813207159020774 27.864636905986423 20.618185558527053 65-69 23.240631265100497 28.30411761682003 27.831182850974145 20.62406826710533 70-74 23.295309222978158 27.096015141439462 28.298122666121028 21.31055296946135 75-79 23.269958090565265 28.043544924869675 27.455790657262597 21.230706327302464 80-84 23.380151732622515 28.311461964322334 28.019274143940947 20.289112159114207 85-89 24.1552914309441 27.471843047698137 28.21923496133285 20.15363056002491 90-94 23.750196304245407 28.0008375647804 27.969428885515363 20.27953724545883 95-99 23.547557840616967 27.37789203084833 28.688946015424165 20.38560411311054 100-104 24.04116954273132 27.24153822520354 27.830406062778433 20.886886169286704 105-109 23.037402383888203 28.154541718043568 27.71783806000822 21.090217838060006 110-114 24.168297455968688 27.11401792151612 28.334534967555875 20.383149654959315 115-119 24.473440871262714 27.006061851433266 27.976985513202507 20.54351176410151 120-124 23.599346872129807 28.038575364833147 28.05898561077661 20.303092152260437 125-129 24.761167053963337 27.31732507100439 27.467079783113864 20.45442809191841 130-134 24.277210884353742 28.629889455782315 27.072704081632654 20.02019557823129 135-139 24.72551364278726 27.459506468094357 27.747581258832483 20.0673986302859 140-144 25.284059569773852 27.457253171538888 27.727523441809154 19.531163816878102 145-149 25.389920424403183 27.543766578249336 27.119363395225466 19.946949602122015 150-151 25.808119989656063 26.583915179725885 27.72174812516162 19.886216705456423 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 83.0 1 43.0 2 2.0 3 0.5 4 0.5 5 1.5 6 1.5 7 2.0 8 2.5 9 1.5 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.5 17 2.5 18 1.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 3.5 25 4.5 26 2.5 27 1.5 28 4.0 29 8.0 30 12.0 31 14.0 32 20.0 33 28.0 34 43.5 35 61.5 36 75.0 37 95.5 38 128.5 39 156.0 40 189.5 41 226.0 42 246.0 43 265.0 44 269.5 45 272.0 46 284.0 47 270.0 48 224.5 49 199.5 50 174.0 51 140.5 52 115.5 53 96.5 54 75.0 55 45.0 56 33.5 57 28.0 58 23.0 59 15.0 60 7.5 61 7.0 62 4.5 63 2.5 64 2.5 65 2.0 66 2.0 67 2.5 68 2.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.225 2 2.1 3 2.5250000000000004 4 3.55 5 3.7249999999999996 6 2.5 7 2.225 8 2.15 9 2.225 10-14 2.64 15-19 3.11 20-24 2.725 25-29 2.56 30-34 2.645 35-39 2.825 40-44 3.26 45-49 3.3000000000000003 50-54 2.5250000000000004 55-59 2.7 60-64 2.78 65-69 2.735 70-74 2.255 75-79 2.17 80-84 2.46 85-89 3.665 90-94 4.485 95-99 2.75 100-104 2.355 105-109 2.68 110-114 2.91 115-119 2.67 120-124 2.01 125-129 3.175 130-134 5.92 135-139 8.01 140-144 9.35 145-149 5.75 150-151 3.325 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48678470618424 96.925 2 0.4618937644341801 0.8999999999999999 3 0.025660764690787787 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025660764690787787 2.1 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 84 2.1 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.2625 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.7374999999999998 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.175 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.3875 0.0 0.0 0.0 0.0 124-125 3.8 0.0 0.0 0.0 0.0 126-127 4.2125 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.199999999999999 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 5.9125 0.0 0.0 0.0 0.0 138-139 6.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAAAA 10 0.006948355 144.1282 5 AGGCAAA 10 0.006948355 144.1282 4 >>END_MODULE Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759853 spots for SRR7169941.sra Written 759853 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra Read 759835 spots for SRR7169941.sra Written 759835 spots for SRR7169941.sra SRR ids: ['SRR7169941.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bwac4gxw SRR7169941.sra spots: 15196718 blocks: [[1, 759835], [759836, 1519670], [1519671, 2279505], [2279506, 3039340], [3039341, 3799175], [3799176, 4559010], [4559011, 5318845], [5318846, 6078680], [6078681, 6838515], [6838516, 7598350], [7598351, 8358185], [8358186, 9118020], [9118021, 9877855], [9877856, 10637690], [10637691, 11397525], [11397526, 12157360], [12157361, 12917195], [12917196, 13677030], [13677031, 14436865], [14436866, 15196718]] SRR7169941 file size 5127968 SRR7169941 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169941 SRR7169941_1.fastq SRR7169941_2.fastq Input file: SRR7169941_1.fastq Paired file: SRR7169941_2.fastq trimmed: SRR7169941-trimmed-pair1.fastq, SRR7169941-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 03:50:15 2025 >> started Wed Feb 12 03:50:31 2025 >> done (15.649s) 15196718 read pairs processed; of these: 24562 ( 0.16%) short read pairs filtered out after trimming by size control 33846 ( 0.22%) empty read pairs filtered out after trimming by size control 15138310 (99.62%) read pairs available; of these: 7264179 (47.99%) trimmed read pairs available after processing 7874131 (52.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 3 0.00% 21 6 0.00% 22 4 0.00% 23 2 0.00% 24 3 0.00% 25 9 0.00% 26 7 0.00% 27 12 0.00% 28 15 0.00% 29 3 0.00% 30 9 0.00% 31 9 0.00% 32 15 0.00% 33 12 0.00% 34 19 0.00% 35 16 0.00% 36 13 0.00% 37 17 0.00% 38 20 0.00% 39 21 0.00% 40 27 0.00% 41 20 0.00% 42 36 0.00% 43 35 0.00% 44 30 0.00% 45 33 0.00% 46 43 0.00% 47 55 0.00% 48 64 0.00% 49 50 0.00% 50 81 0.00% 51 84 0.00% 52 108 0.00% 53 88 0.00% 54 133 0.00% 55 116 0.00% 56 124 0.00% 57 147 0.00% 58 167 0.00% 59 207 0.00% 60 227 0.00% 61 279 0.00% 62 300 0.00% 63 340 0.00% 64 399 0.00% 65 454 0.00% 66 454 0.00% 67 530 0.00% 68 611 0.00% 69 803 0.01% 70 1022 0.01% 71 1005 0.01% 72 1042 0.01% 73 1144 0.01% 74 1344 0.01% 75 1461 0.01% 76 1686 0.01% 77 1741 0.01% 78 2016 0.01% 79 2227 0.01% 80 2541 0.02% 81 2796 0.02% 82 3146 0.02% 83 3649 0.02% 84 4975 0.03% 85 5839 0.04% 86 6239 0.04% 87 6668 0.04% 88 7003 0.05% 89 7430 0.05% 90 7933 0.05% 91 8584 0.06% 92 9210 0.06% 93 9859 0.07% 94 10679 0.07% 95 11432 0.08% 96 12115 0.08% 97 12424 0.08% 98 13093 0.09% 99 13670 0.09% 100 14744 0.10% 101 15233 0.10% 102 16575 0.11% 103 17420 0.12% 104 18806 0.12% 105 19511 0.13% 106 20538 0.14% 107 21175 0.14% 108 21972 0.15% 109 22859 0.15% 110 23499 0.16% 111 24455 0.16% 112 25537 0.17% 113 27178 0.18% 114 28286 0.19% 115 29475 0.19% 116 30957 0.20% 117 31938 0.21% 118 32714 0.22% 119 33206 0.22% 120 34072 0.23% 121 35080 0.23% 122 36749 0.24% 123 38228 0.25% 124 40095 0.26% 125 41480 0.27% 126 43874 0.29% 127 45662 0.30% 128 46416 0.31% 129 48251 0.32% 130 49995 0.33% 131 51984 0.34% 132 54755 0.36% 133 57758 0.38% 134 60776 0.40% 135 64396 0.43% 136 67776 0.45% 137 71537 0.47% 138 78070 0.52% 139 84232 0.56% 140 90713 0.60% 141 96899 0.64% 142 104883 0.69% 143 114498 0.76% 144 126861 0.84% 145 146302 0.97% 146 176298 1.16% 147 230145 1.52% 148 326011 2.15% 149 629099 4.16% 150 3514968 23.22% 151 7874131 52.01% 15138310 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=38 prefix-density=0.22 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=65.69 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=12.3 sequence=CACCACCAACATCCACCAAGGATGTGAGGCCTTCAAAGCCTTTGTAGGTCTCAAGAAGCTTCTTCATGGTAATGGTAGAGTGGTCAGACATTCCCTTATTGAA criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.2 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=47.51 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=11.9 sequence=TCAAGGAAGCTTTCAG SRR7169941 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 03:51:16 Started mapping on | Feb 12 03:51:16 Finished on | Feb 12 03:52:54 Mapping speed, Million of reads per hour | 556.10 Number of input reads | 15138310 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14211374 Uniquely mapped reads % | 93.88% Average mapped length | 292.99 Number of splices: Total | 12805911 Number of splices: Annotated (sjdb) | 12577180 Number of splices: GT/AG | 12623979 Number of splices: GC/AG | 143857 Number of splices: AT/AC | 10747 Number of splices: Non-canonical | 27328 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249380 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 61985 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 698791 698791 698791 N_multimapping 249380 249380 249380 N_noFeature 341860 14021798 425684 N_ambiguous 162802 978 56370 UnstrandedReadsAssigned:13706712 PositiveStrandReadsAssigned:188598 NegativeStrandReadsAssigned:13729320 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169941 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169941-trimmed-pair1.fastq SRR7169941-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,138,310 reads, 13,668,410 reads pseudoaligned [quant] estimated average fragment length: 236.127 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,252 rounds 52401 SRR7169941.ke.tsv 34699 SRR7169941.se.tsv 87100 total ==> SRR7169941.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.87 276 11.6158 Potri.005G024800.1.v4.1 1035 799.873 30 2.81425 Potri.004G059700.1.v4.1 961 725.94 9 0.930259 Potri.007G009000.2.v4.1 1416 1180.87 0 0 Potri.003G141000.2.v4.1 2943 2707.87 204.078 5.65497 Potri.016G087400.1.v4.1 270 83.0959 1351 1219.94 Potri.015G069301.1.v4.1 564 334.335 0 0 Potri.010G195200.1.v4.1 1773 1537.87 27 1.31736 Potri.012G127500.1.v4.1 977 741.905 3298 333.553 ==> SRR7169941.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1607 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 285 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169941 completed mapping pipeline successfully