Starting /dee2/code/volunteer_pipeline.sh SRR7169942 current disk space = 2818986737664 free memory = 1578630496 SRR7169942 SRAfilesize 9663ea4762405b4aae3e316bb713025f SRR7169942.sra SRR7169942.sra file validated SRR7169942 is paired end SRR7169942 is conventional basespace SRR7169942 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.918 34.0 33.0 34.0 33.0 34.0 2 33.4095 34.0 34.0 34.0 33.0 34.0 3 33.4385 34.0 34.0 34.0 33.0 34.0 4 33.521 34.0 34.0 34.0 33.0 34.0 5 33.51 34.0 34.0 34.0 33.0 34.0 6 37.24825 38.0 38.0 38.0 36.0 38.0 7 37.49825 38.0 38.0 38.0 37.0 38.0 8 37.6035 38.0 38.0 38.0 38.0 38.0 9 37.6375 38.0 38.0 38.0 38.0 38.0 10-14 37.5937 38.0 38.0 38.0 38.0 38.0 15-19 37.55315 38.0 38.0 38.0 38.0 38.0 20-24 37.5193 38.0 38.0 38.0 38.0 38.0 25-29 37.50880000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.46115 38.0 38.0 38.0 37.8 38.0 35-39 37.400150000000004 38.0 38.0 38.0 37.2 38.0 40-44 37.1678 38.0 38.0 38.0 36.4 38.0 45-49 37.13055000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.05485 38.0 38.0 38.0 36.0 38.0 55-59 37.02334999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.94775 38.0 38.0 38.0 35.6 38.0 65-69 36.85035 38.0 38.0 38.0 35.2 38.0 70-74 36.785149999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.68645 38.0 38.0 38.0 34.8 38.0 80-84 36.58565 38.0 38.0 38.0 34.0 38.0 85-89 36.4517 38.0 38.0 38.0 34.0 38.0 90-94 36.30625 38.0 38.0 38.0 34.0 38.0 95-99 36.065549999999995 38.0 37.4 38.0 33.0 38.0 100-104 35.91155 38.0 37.0 38.0 32.2 38.0 105-109 35.842949999999995 38.0 37.0 38.0 31.6 38.0 110-114 35.7255 38.0 37.0 38.0 31.2 38.0 115-119 35.4332 38.0 36.2 38.0 29.8 38.0 120-124 35.170100000000005 38.0 36.0 38.0 28.6 38.0 125-129 34.91515 38.0 35.6 38.0 28.0 38.0 130-134 34.4398 38.0 35.0 38.0 25.4 38.0 135-139 33.958600000000004 38.0 34.8 38.0 22.6 38.0 140-144 33.71175 38.0 34.2 38.0 21.8 38.0 145-149 32.67495 38.0 33.2 38.0 15.0 38.0 150-151 28.561875 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 7.0 19 7.0 20 7.0 21 4.0 22 9.0 23 9.0 24 12.0 25 22.0 26 22.0 27 17.0 28 31.0 29 48.0 30 41.0 31 59.0 32 67.0 33 126.0 34 164.0 35 332.0 36 709.0 37 2295.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.661577608142494 12.315521628498729 10.610687022900764 36.412213740458014 2 21.0 16.650000000000002 34.35 28.000000000000004 3 19.85 21.55 26.35 32.25 4 22.75 28.725 22.175 26.35 5 21.625 34.8 23.5 20.075000000000003 6 19.575 34.575 25.45 20.4 7 14.799999999999999 25.7 40.35 19.15 8 18.6 26.224999999999998 29.9 25.275 9 17.150000000000002 25.5 32.75 24.6 10-14 19.564999999999998 29.505 27.389999999999997 23.54 15-19 19.23 29.415000000000003 27.595 23.76 20-24 19.685 28.825 27.845 23.645 25-29 19.91 28.95 27.284999999999997 23.855 30-34 20.07 28.884999999999998 27.589999999999996 23.455000000000002 35-39 19.55 29.145 27.47 23.835 40-44 19.905 29.609999999999996 26.955000000000002 23.53 45-49 20.155 28.205000000000002 27.700000000000003 23.94 50-54 20.16 28.754999999999995 27.305 23.78 55-59 19.785 28.925 27.200000000000003 24.09 60-64 19.695 28.74 27.800000000000004 23.765 65-69 19.78 28.815 26.985 24.42 70-74 19.869999999999997 29.15 27.215 23.765 75-79 19.885 28.455000000000002 27.72 23.94 80-84 20.26 29.2 26.740000000000002 23.799999999999997 85-89 20.615153788447113 28.30207551887972 27.22680670167542 23.85596399099775 90-94 20.76946197775774 28.283739104298167 27.60244464482517 23.344354273118924 95-99 20.417272681679123 28.451777922664125 27.197953758964843 23.932995636691913 100-104 20.145 28.475 27.310000000000002 24.07 105-109 20.445 27.91 27.71 23.935000000000002 110-114 20.655 28.89 26.740000000000002 23.715 115-119 20.855 29.18 26.935 23.03 120-124 21.01 28.38 26.85 23.76 125-129 21.22 28.74 26.02 24.02 130-134 20.575 28.26 26.91 24.255 135-139 21.00050025012506 28.339169584792394 26.183091545772886 24.477238619309656 140-144 20.97 27.82 26.665 24.545 145-149 21.310000000000002 28.165000000000003 26.515 24.01 150-151 20.3375 28.1625 26.6125 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 2.5 24 3.0 25 2.0 26 3.5 27 7.5 28 11.5 29 18.0 30 21.0 31 26.0 32 38.0 33 47.5 34 55.5 35 76.0 36 89.5 37 104.5 38 127.0 39 158.0 40 193.0 41 206.5 42 230.5 43 265.5 44 270.5 45 252.5 46 253.0 47 245.0 48 221.5 49 191.5 50 174.0 51 157.5 52 117.5 53 103.5 54 86.0 55 53.0 56 41.5 57 37.5 58 29.5 59 19.0 60 11.0 61 7.5 62 7.5 63 6.0 64 4.0 65 3.0 66 1.5 67 3.5 68 2.5 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.025 90-94 0.19 95-99 0.305 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.05 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59829274416269 99.175 2 0.37660055234747675 0.75 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5625 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.475 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.275 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.137499999999999 0.0 0.0 0.0 0.0 128-129 5.737500000000001 0.0 0.0 0.0 0.0 130-131 6.1375 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 6.8375 0.0 0.0 0.0 0.0 136-137 7.2875 0.0 0.0 0.0 0.0 138-139 7.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTAT 10 0.0068343505 144.975 5 CTGCACG 10 0.0068343505 144.975 8 >>END_MODULE SRR7169942 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.94025 33.0 33.0 34.0 32.0 34.0 2 32.37125 34.0 33.0 34.0 32.0 34.0 3 32.2345 34.0 33.0 34.0 32.0 34.0 4 31.911 34.0 33.0 34.0 32.0 34.0 5 31.83825 34.0 33.0 34.0 32.0 34.0 6 36.218 38.0 38.0 38.0 35.0 38.0 7 36.3425 38.0 38.0 38.0 36.0 38.0 8 36.34125 38.0 38.0 38.0 36.0 38.0 9 36.3855 38.0 38.0 38.0 36.0 38.0 10-14 36.2097 38.0 38.0 38.0 36.0 38.0 15-19 36.0216 38.0 38.0 38.0 35.2 38.0 20-24 36.1596 38.0 38.0 38.0 36.0 38.0 25-29 36.22449999999999 38.0 38.0 38.0 36.0 38.0 30-34 36.2029 38.0 38.0 38.0 36.0 38.0 35-39 36.0634 38.0 38.0 38.0 36.0 38.0 40-44 35.92745 38.0 38.0 38.0 35.6 38.0 45-49 35.82225 38.0 38.0 38.0 34.6 38.0 50-54 36.0124 38.0 38.0 38.0 35.0 38.0 55-59 36.02375 38.0 38.0 38.0 35.2 38.0 60-64 35.9427 38.0 38.0 38.0 34.8 38.0 65-69 35.87835 38.0 38.0 38.0 34.2 38.0 70-74 35.864250000000006 38.0 38.0 38.0 34.0 38.0 75-79 35.775999999999996 38.0 38.0 38.0 34.0 38.0 80-84 35.65454999999999 38.0 38.0 38.0 33.8 38.0 85-89 35.3411 38.0 38.0 38.0 32.6 38.0 90-94 35.00234999999999 38.0 38.0 38.0 29.0 38.0 95-99 35.216150000000006 38.0 38.0 38.0 29.6 38.0 100-104 35.171350000000004 38.0 38.0 38.0 30.4 38.0 105-109 35.0435 38.0 38.0 38.0 29.8 38.0 110-114 34.91895 38.0 37.2 38.0 29.0 38.0 115-119 34.71535 38.0 37.2 38.0 27.4 38.0 120-124 34.435849999999995 38.0 36.4 38.0 24.8 38.0 125-129 33.8635 38.0 35.6 38.0 19.8 38.0 130-134 32.9477 38.0 34.2 38.0 13.8 38.0 135-139 31.542450000000002 38.0 32.8 38.0 4.2 38.0 140-144 30.785800000000002 38.0 31.4 38.0 2.0 38.0 145-149 30.042499999999997 38.0 29.8 38.0 2.0 38.0 150-151 24.997999999999998 33.0 14.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 98.0 3 17.0 4 1.0 5 3.0 6 5.0 7 0.0 8 2.0 9 0.0 10 1.0 11 4.0 12 0.0 13 3.0 14 5.0 15 3.0 16 7.0 17 9.0 18 8.0 19 6.0 20 10.0 21 18.0 22 13.0 23 15.0 24 23.0 25 12.0 26 25.0 27 31.0 28 35.0 29 42.0 30 54.0 31 62.0 32 101.0 33 135.0 34 168.0 35 200.0 36 525.0 37 2359.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.297325102880656 20.9619341563786 14.300411522633743 26.440329218106996 2 25.24123920771966 26.942610462163536 30.11681056373794 17.69933976637887 3 20.634108923548965 28.10023012017387 31.552032728202505 19.71362822807466 4 23.549135929842663 33.298942481299974 23.70389476399278 19.448026824864588 5 25.86073000258866 33.445508672016565 23.06497540771421 17.62878591768056 6 20.49578328648096 37.15819064656274 24.380270891898796 17.965755175057502 7 20.488673962840416 21.659455332145583 38.33036396029524 19.52150674471876 8 23.51296390442298 25.31774275546518 25.495678698525676 25.673614641586173 9 20.97225757190125 25.273606515652837 29.11682361924154 24.637312293204378 10-14 23.895798147295153 27.89293208454885 25.7331490864425 22.478120681713495 15-19 23.730207690725887 27.405922270203575 27.54472547809994 21.319144560970592 20-24 23.372963000922415 27.84154965665676 27.462334734037103 21.323152608383726 25-29 23.872122762148337 27.979539641943735 27.253196930946295 20.895140664961637 30-34 23.403819568890484 28.027238748655982 27.49987199836158 21.069069684091957 35-39 23.733333333333334 28.4 26.743589743589745 21.123076923076923 40-44 23.810749588138385 27.96540362438221 26.873970345963755 21.34987644151565 45-49 23.986399464221318 26.9074236257792 27.87079491010252 21.235381999896966 50-54 23.458115986498925 27.6004909481436 27.994272271657973 20.9471207936995 55-59 23.31847753701142 27.017058552328262 28.39506172839506 21.269402182265253 60-64 23.398800061535304 27.737039126198653 28.03445977129378 20.829701040972257 65-69 23.77658211632078 27.57366128619011 27.727389187804253 20.92236740968486 70-74 24.028322551067188 27.70108501859304 27.512607610412104 20.757984819927668 75-79 23.820910709743067 27.763927753752228 27.433223098448234 20.981938438056474 80-84 23.591890925802993 28.35112087014247 27.360465710054637 20.696522493999897 85-89 23.669923995656895 27.423607879633938 28.121606948968513 20.784861175740655 90-94 23.38885996876627 27.39718896408121 28.636127017178552 20.577824049973973 95-99 23.560155769624924 27.64398442303751 28.222996515679444 20.572863291658127 100-104 24.564984436393324 27.330713884778284 27.754248099198858 20.350053579629535 105-109 24.254687019772565 27.056654031349247 28.137485913328554 20.551173035549635 110-114 24.25953493147169 28.09917355371901 27.46778912786818 20.173502386941124 115-119 24.187023096225737 27.986889947252525 27.41844625390485 20.407640702616888 120-124 24.34394193188163 28.003654636820468 27.013857164610933 20.63854626668697 125-129 25.38449668226943 26.793889203230286 27.62717967182758 20.1944344426727 130-134 25.110549589387237 27.82691092861655 27.13729206148663 19.92524742050958 135-139 25.165207113307904 27.169182829205397 27.271262021168003 20.394348036318704 140-144 25.249169435215947 27.759925929960243 26.507270845814496 20.483633789009314 145-149 25.32238538870467 28.043581241117955 27.20669508921522 19.427338280962157 150-151 25.36045314109166 28.244078269824925 26.918125643666325 19.477342945417096 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 64.0 1 33.5 2 1.5 3 0.0 4 1.0 5 5.0 6 5.0 7 2.0 8 2.5 9 2.0 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.5 18 0.5 19 0.5 20 1.0 21 2.0 22 2.0 23 1.5 24 2.0 25 1.5 26 1.5 27 3.0 28 4.5 29 9.5 30 14.0 31 15.0 32 18.5 33 28.0 34 39.0 35 44.5 36 73.5 37 102.5 38 107.0 39 139.5 40 185.0 41 226.0 42 247.0 43 260.0 44 289.0 45 290.0 46 275.5 47 253.0 48 229.5 49 203.0 50 177.5 51 149.0 52 113.0 53 94.0 54 81.0 55 59.0 56 36.0 57 29.5 58 23.0 59 18.5 60 16.0 61 9.5 62 7.5 63 5.5 64 4.5 65 3.5 66 1.5 67 2.0 68 2.5 69 2.0 70 0.5 71 0.0 72 1.5 73 2.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.8000000000000003 2 1.55 3 2.225 4 3.075 5 3.4250000000000003 6 2.175 7 1.775 8 1.6500000000000001 9 1.775 10-14 2.305 15-19 2.74 20-24 2.4299999999999997 25-29 2.25 30-34 2.3449999999999998 35-39 2.5 40-44 2.88 45-49 2.945 50-54 2.23 55-59 2.395 60-64 2.495 65-69 2.4250000000000003 70-74 1.8450000000000002 75-79 1.725 80-84 2.085 85-89 3.295 90-94 3.95 95-99 2.42 100-104 2.015 105-109 2.39 110-114 2.595 115-119 2.365 120-124 1.4949999999999999 125-129 2.795 130-134 5.0200000000000005 135-139 6.935 140-144 8.195 145-149 5.005 150-151 2.9000000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59214886566403 97.675 2 0.3568697425439714 0.7000000000000001 3 0.025490695895997964 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025490695895997964 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 62 1.55 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.05 0.0 0.0 0.0 0.0 112-113 2.3375000000000004 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.85 0.0 0.0 0.0 0.0 122-123 4.2875 0.0 0.0 0.0 0.0 124-125 4.7625 0.0 0.0 0.0 0.0 126-127 5.137499999999999 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.0625 0.0 0.0 0.0 0.0 132-133 6.3875 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.137499999999999 0.0 0.0 0.0 0.0 138-139 7.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCTA 10 0.006952052 144.10255 7 CTGCTGC 10 0.006952052 144.10255 8 >>END_MODULE Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755443 spots for SRR7169942.sra Written 755443 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra Read 755439 spots for SRR7169942.sra Written 755439 spots for SRR7169942.sra SRR ids: ['SRR7169942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_octdb6lc SRR7169942.sra spots: 15108784 blocks: [[1, 755439], [755440, 1510878], [1510879, 2266317], [2266318, 3021756], [3021757, 3777195], [3777196, 4532634], [4532635, 5288073], [5288074, 6043512], [6043513, 6798951], [6798952, 7554390], [7554391, 8309829], [8309830, 9065268], [9065269, 9820707], [9820708, 10576146], [10576147, 11331585], [11331586, 12087024], [12087025, 12842463], [12842464, 13597902], [13597903, 14353341], [14353342, 15108784]] SRR7169942 file size 5098170 SRR7169942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169942 SRR7169942_1.fastq SRR7169942_2.fastq Input file: SRR7169942_1.fastq Paired file: SRR7169942_2.fastq trimmed: SRR7169942-trimmed-pair1.fastq, SRR7169942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:43:36 2025 >> started Thu Apr 10 15:57:59 2025 >> done (863.532s) 15108784 read pairs processed; of these: 29583 ( 0.20%) short read pairs filtered out after trimming by size control 53891 ( 0.36%) empty read pairs filtered out after trimming by size control 15025310 (99.45%) read pairs available; of these: 7533847 (50.14%) trimmed read pairs available after processing 7491463 (49.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 4 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 6 0.00% 24 7 0.00% 25 7 0.00% 26 8 0.00% 27 6 0.00% 28 8 0.00% 29 9 0.00% 30 10 0.00% 31 17 0.00% 32 10 0.00% 33 15 0.00% 34 15 0.00% 35 11 0.00% 36 11 0.00% 37 12 0.00% 38 23 0.00% 39 27 0.00% 40 30 0.00% 41 42 0.00% 42 47 0.00% 43 36 0.00% 44 40 0.00% 45 40 0.00% 46 52 0.00% 47 79 0.00% 48 79 0.00% 49 79 0.00% 50 84 0.00% 51 119 0.00% 52 125 0.00% 53 122 0.00% 54 163 0.00% 55 155 0.00% 56 221 0.00% 57 221 0.00% 58 253 0.00% 59 307 0.00% 60 319 0.00% 61 365 0.00% 62 448 0.00% 63 501 0.00% 64 561 0.00% 65 659 0.00% 66 700 0.00% 67 856 0.01% 68 971 0.01% 69 1173 0.01% 70 1400 0.01% 71 1412 0.01% 72 1609 0.01% 73 1802 0.01% 74 1904 0.01% 75 2145 0.01% 76 2287 0.02% 77 2504 0.02% 78 2746 0.02% 79 3107 0.02% 80 3530 0.02% 81 4057 0.03% 82 4631 0.03% 83 5321 0.04% 84 6977 0.05% 85 8006 0.05% 86 8319 0.06% 87 8805 0.06% 88 9103 0.06% 89 9647 0.06% 90 10128 0.07% 91 10875 0.07% 92 11909 0.08% 93 12918 0.09% 94 13844 0.09% 95 14864 0.10% 96 15254 0.10% 97 15904 0.11% 98 16331 0.11% 99 16738 0.11% 100 18118 0.12% 101 18837 0.13% 102 20214 0.13% 103 21680 0.14% 104 23138 0.15% 105 24201 0.16% 106 24935 0.17% 107 25333 0.17% 108 25656 0.17% 109 26317 0.18% 110 27257 0.18% 111 28204 0.19% 112 30147 0.20% 113 31460 0.21% 114 33262 0.22% 115 34939 0.23% 116 36023 0.24% 117 36607 0.24% 118 37379 0.25% 119 37257 0.25% 120 38488 0.26% 121 39279 0.26% 122 41330 0.28% 123 43746 0.29% 124 46229 0.31% 125 47894 0.32% 126 49444 0.33% 127 50782 0.34% 128 52157 0.35% 129 53424 0.36% 130 55391 0.37% 131 56469 0.38% 132 59713 0.40% 133 63159 0.42% 134 66704 0.44% 135 70691 0.47% 136 74606 0.50% 137 78386 0.52% 138 84730 0.56% 139 90161 0.60% 140 95762 0.64% 141 102408 0.68% 142 110654 0.74% 143 120031 0.80% 144 133930 0.89% 145 152951 1.02% 146 183556 1.22% 147 238270 1.59% 148 336956 2.24% 149 645354 4.30% 150 3453072 22.98% 151 7491463 49.86% 15025310 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=40 prefix-density=0.22 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=542.41 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=24.3 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=31 fanout-score=62.87 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=13.6 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7169942 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:58:59 Started mapping on | Apr 10 15:58:59 Finished on | Apr 10 16:00:38 Mapping speed, Million of reads per hour | 546.37 Number of input reads | 15025310 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14061057 Uniquely mapped reads % | 93.58% Average mapped length | 291.69 Number of splices: Total | 12867291 Number of splices: Annotated (sjdb) | 12653150 Number of splices: GT/AG | 12681853 Number of splices: GC/AG | 147768 Number of splices: AT/AC | 10765 Number of splices: Non-canonical | 26905 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253881 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 83175 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.09% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 732373 732373 732373 N_multimapping 253881 253881 253881 N_noFeature 271271 13887829 341732 N_ambiguous 152106 882 48720 UnstrandedReadsAssigned:13637680 PositiveStrandReadsAssigned:172346 NegativeStrandReadsAssigned:13670605 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169942-trimmed-pair1.fastq SRR7169942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,025,310 reads, 13,658,600 reads pseudoaligned [quant] estimated average fragment length: 229.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52401 SRR7169942.ke.tsv 34699 SRR7169942.se.tsv 87100 total ==> SRR7169942.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.13 284 11.1212 Potri.005G024800.1.v4.1 1035 806.129 37 3.21566 Potri.004G059700.1.v4.1 961 732.184 14 1.33962 Potri.007G009000.2.v4.1 1416 1187.13 0 0 Potri.003G141000.2.v4.1 2943 2714.13 219.028 5.65383 Potri.016G087400.1.v4.1 270 87.3346 1807.54 1450.03 Potri.015G069301.1.v4.1 564 340.366 0 0 Potri.010G195200.1.v4.1 1773 1544.13 12 0.544467 Potri.012G127500.1.v4.1 977 748.161 4471 418.681 ==> SRR7169942.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 823 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169942 completed mapping pipeline successfully