Starting /dee2/code/volunteer_pipeline.sh SRR7169943 current disk space = 3049196437504 free memory = 1579356068 SRR7169943 SRAfilesize 0a7ddf55e78ed236f7634bfa3e368168 SRR7169943.sra SRR7169943.sra file validated SRR7169943 is paired end SRR7169943 is conventional basespace SRR7169943 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169943_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.909 34.0 33.0 34.0 33.0 34.0 2 33.411 34.0 34.0 34.0 33.0 34.0 3 33.44125 34.0 34.0 34.0 33.0 34.0 4 33.5255 34.0 34.0 34.0 33.0 34.0 5 33.50375 34.0 34.0 34.0 33.0 34.0 6 37.24 38.0 38.0 38.0 36.0 38.0 7 37.46125 38.0 38.0 38.0 37.0 38.0 8 37.54825 38.0 38.0 38.0 38.0 38.0 9 37.57175 38.0 38.0 38.0 38.0 38.0 10-14 37.56135 38.0 38.0 38.0 38.0 38.0 15-19 37.5792 38.0 38.0 38.0 38.0 38.0 20-24 37.54375 38.0 38.0 38.0 38.0 38.0 25-29 37.497350000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.42100000000001 38.0 38.0 38.0 37.8 38.0 35-39 37.43149999999999 38.0 38.0 38.0 37.6 38.0 40-44 37.207550000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.14805 38.0 38.0 38.0 36.0 38.0 50-54 37.131550000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.03795 38.0 38.0 38.0 36.0 38.0 60-64 36.9572 38.0 38.0 38.0 35.8 38.0 65-69 36.9074 38.0 38.0 38.0 35.6 38.0 70-74 36.86105 38.0 38.0 38.0 35.4 38.0 75-79 36.71595 38.0 38.0 38.0 34.6 38.0 80-84 36.6643 38.0 38.0 38.0 34.6 38.0 85-89 36.52155 38.0 38.0 38.0 34.0 38.0 90-94 36.377700000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.18825 38.0 37.8 38.0 34.0 38.0 100-104 36.02595 38.0 37.2 38.0 33.0 38.0 105-109 35.967 38.0 37.0 38.0 32.6 38.0 110-114 35.74305 38.0 36.8 38.0 31.0 38.0 115-119 35.504650000000005 38.0 36.2 38.0 30.2 38.0 120-124 35.258449999999996 38.0 36.0 38.0 29.4 38.0 125-129 34.9542 38.0 35.8 38.0 27.8 38.0 130-134 34.42385 38.0 35.0 38.0 25.0 38.0 135-139 34.057249999999996 38.0 34.6 38.0 23.6 38.0 140-144 33.714749999999995 38.0 34.6 38.0 22.2 38.0 145-149 32.82770000000001 38.0 33.2 38.0 15.4 38.0 150-151 28.710749999999997 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 6.0 17 1.0 18 3.0 19 5.0 20 4.0 21 8.0 22 15.0 23 10.0 24 12.0 25 20.0 26 14.0 27 31.0 28 32.0 29 38.0 30 35.0 31 62.0 32 67.0 33 97.0 34 170.0 35 301.0 36 731.0 37 2330.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.62757568048842 11.142203001780718 8.750953955736454 36.4792673619944 2 22.95 14.85 32.7 29.5 3 20.45 19.6 25.974999999999998 33.975 4 23.275000000000002 27.500000000000004 22.075 27.150000000000002 5 22.875 32.625 23.225 21.275 6 19.425 34.5 24.925 21.15 7 15.174999999999999 26.125 40.775 17.925 8 17.875 27.525 30.45 24.15 9 16.725 25.05 34.2 24.025 10-14 20.03 29.73 26.91 23.330000000000002 15-19 19.314999999999998 28.935 27.894999999999996 23.855 20-24 19.245 29.404999999999998 27.400000000000002 23.95 25-29 19.55 29.39 26.985 24.075 30-34 20.064999999999998 28.925 26.93 24.08 35-39 20.175 28.715000000000003 26.935 24.175 40-44 19.86 28.99 27.365000000000002 23.785 45-49 20.86 28.535 26.595000000000002 24.01 50-54 19.695 28.535 28.005000000000003 23.765 55-59 20.215 28.555000000000003 27.265 23.965 60-64 19.925 28.694999999999997 27.265 24.115000000000002 65-69 20.735 27.955000000000002 27.61 23.7 70-74 19.73 28.305000000000003 27.889999999999997 24.075 75-79 20.665 28.24 27.474999999999998 23.62 80-84 20.31 27.755000000000003 27.66 24.275 85-89 20.066003300165008 28.351417570878546 27.68638431921596 23.896194809740486 90-94 20.700876095118897 27.91989987484356 27.849812265331664 23.52941176470588 95-99 19.974937343358395 28.37593984962406 27.689223057644107 23.959899749373434 100-104 20.565 28.7 27.279999999999998 23.455000000000002 105-109 20.365 28.355000000000004 27.700000000000003 23.580000000000002 110-114 20.435 27.700000000000003 27.794999999999998 24.07 115-119 20.945 28.544999999999998 26.905 23.605 120-124 21.305 28.194999999999997 26.625 23.875 125-129 20.745 28.22 27.1 23.935000000000002 130-134 20.94 28.455000000000002 26.755000000000003 23.849999999999998 135-139 21.23424684936987 27.81056211242248 27.025405081016203 23.929785957191438 140-144 20.49 28.825 26.51 24.175 145-149 21.005 27.694999999999997 26.93 24.37 150-151 21.0 28.0625 26.875 24.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 0.5 23 0.0 24 2.0 25 4.0 26 5.5 27 7.0 28 7.5 29 7.5 30 10.5 31 16.0 32 24.5 33 42.5 34 50.0 35 59.5 36 81.5 37 106.5 38 135.0 39 160.5 40 184.5 41 219.5 42 233.0 43 244.0 44 268.5 45 265.5 46 259.0 47 255.5 48 254.0 49 229.5 50 178.5 51 147.5 52 131.5 53 109.5 54 85.5 55 61.0 56 39.0 57 27.5 58 20.5 59 16.0 60 15.5 61 10.5 62 5.5 63 4.0 64 3.0 65 2.0 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.125 95-99 0.25 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.02 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.125 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.35 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.4 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.0 0.0 0.0 0.0 0.0 128-129 5.3 0.0 0.0 0.0 0.0 130-131 5.6125 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.550000000000001 0.0 0.0 0.0 0.0 136-137 6.825 0.0 0.0 0.0 0.0 138-139 7.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGAT 10 0.0068343505 144.975 8 AAGAGGA 10 0.0068343505 144.975 145 >>END_MODULE SRR7169943 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169943_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.91375 33.0 33.0 34.0 32.0 34.0 2 32.288 34.0 33.0 34.0 32.0 34.0 3 32.13725 34.0 33.0 34.0 32.0 34.0 4 31.862 34.0 33.0 34.0 32.0 34.0 5 31.781 34.0 33.0 34.0 32.0 34.0 6 36.146 38.0 38.0 38.0 34.0 38.0 7 36.27375 38.0 38.0 38.0 35.0 38.0 8 36.25975 38.0 38.0 38.0 35.0 38.0 9 36.3265 38.0 38.0 38.0 36.0 38.0 10-14 36.1684 38.0 38.0 38.0 36.0 38.0 15-19 35.9691 38.0 38.0 38.0 35.2 38.0 20-24 36.1198 38.0 38.0 38.0 36.0 38.0 25-29 36.13805000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.1672 38.0 38.0 38.0 36.0 38.0 35-39 36.06135 38.0 38.0 38.0 36.0 38.0 40-44 35.91460000000001 38.0 38.0 38.0 35.2 38.0 45-49 35.8087 38.0 38.0 38.0 34.4 38.0 50-54 36.003150000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.016099999999994 38.0 38.0 38.0 34.8 38.0 60-64 35.975049999999996 38.0 38.0 38.0 35.0 38.0 65-69 35.895250000000004 38.0 38.0 38.0 34.6 38.0 70-74 35.91175 38.0 38.0 38.0 34.4 38.0 75-79 35.759800000000006 38.0 38.0 38.0 33.6 38.0 80-84 35.675200000000004 38.0 38.0 38.0 33.6 38.0 85-89 35.23945 38.0 38.0 38.0 31.4 38.0 90-94 34.8096 38.0 38.0 38.0 27.6 38.0 95-99 35.27485 38.0 38.0 38.0 29.4 38.0 100-104 35.3069 38.0 38.0 38.0 31.0 38.0 105-109 35.09975000000001 38.0 38.0 38.0 29.4 38.0 110-114 34.934900000000006 38.0 37.4 38.0 28.6 38.0 115-119 34.63555 38.0 37.0 38.0 27.0 38.0 120-124 34.468399999999995 38.0 36.4 38.0 26.8 38.0 125-129 33.850100000000005 38.0 35.8 38.0 19.8 38.0 130-134 32.750699999999995 38.0 34.2 38.0 11.2 38.0 135-139 31.472950000000004 38.0 33.0 38.0 2.0 38.0 140-144 30.774 38.0 32.2 38.0 2.0 38.0 145-149 30.079150000000006 38.0 29.8 38.0 2.0 38.0 150-151 25.487000000000002 33.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 95.0 3 20.0 4 2.0 5 0.0 6 3.0 7 0.0 8 0.0 9 1.0 10 0.0 11 5.0 12 1.0 13 3.0 14 3.0 15 4.0 16 7.0 17 13.0 18 4.0 19 9.0 20 14.0 21 12.0 22 22.0 23 20.0 24 20.0 25 21.0 26 27.0 27 45.0 28 41.0 29 40.0 30 44.0 31 67.0 32 91.0 33 118.0 34 135.0 35 198.0 36 506.0 37 2409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.362512873326466 21.292481977342945 13.80020597322348 26.544799176107105 2 25.83841463414634 27.693089430894307 28.91260162601626 17.555894308943092 3 20.997442455242968 29.232736572890026 30.179028132992325 19.59079283887468 4 24.741468459152017 33.247156153050675 23.035160289555325 18.976215098241987 5 24.63054187192118 36.55690951516723 20.81928960331864 17.99325900959295 6 20.398773006134967 37.602249488752555 23.261758691206545 18.737218813905933 7 19.4147582697201 22.239185750636132 37.30279898218829 21.04325699745547 8 21.908396946564885 26.412213740458014 26.895674300254452 24.783715012722645 9 21.57760814249364 26.234096692111958 29.262086513994912 22.92620865139949 10-14 23.006448971235542 28.534138601699254 26.686457160405364 21.772955266659842 15-19 23.258086080115184 27.76777909189078 27.587802745924822 21.386332082069217 20-24 23.0406720622887 28.53703513984223 27.512549943653315 20.909742854215757 25-29 23.15089514066496 28.056265984654733 27.340153452685424 21.452685421994886 30-34 23.37343230099821 28.175070386485796 27.089838750959817 21.361658561556183 35-39 23.51915482845274 28.01682137545515 27.242422688342995 21.221601107749116 40-44 23.50850077279753 27.877382792375066 27.820710973724882 20.793405461102523 45-49 23.83457095709571 27.918729372937296 27.35664191419142 20.890057755775576 50-54 23.809523809523807 27.69167817502941 27.215999181627538 21.282798833819243 55-59 23.10646796742971 28.34536795206637 27.45941516874072 21.0887489117632 60-64 23.881744120510323 27.186555310754727 28.170313060408876 20.761387508326074 65-69 23.325138291333744 27.688998156115552 28.114115959844295 20.871747592706413 70-74 23.541698507310613 27.28106373223292 28.004483162667483 21.172754597788987 75-79 23.94545362031242 27.400396885971606 27.710782068895334 20.94336742482064 80-84 23.94934381861819 27.4421692284124 27.590256855435836 21.018230097533575 85-89 23.86057592707686 28.055728195566605 27.698363372695255 20.385332504661278 90-94 23.605957669192577 26.866997648288475 28.335510844003135 21.19153383851581 95-99 23.076528781587985 27.95120200932903 28.048592957096723 20.92367625198626 100-104 23.760457049581717 27.234237910630483 28.330952866761884 20.674352173025916 105-109 23.87486559827966 28.0425989452665 27.095386820951305 20.987148635502535 110-114 23.60034895058244 27.75696618258326 28.028942371837633 20.613742494996664 115-119 24.409852014952122 27.7535972143991 27.420758871421985 20.41579189922679 120-124 24.432251181222377 28.003861200020324 27.221460143270843 20.34242747548646 125-129 24.67826624112015 27.66910326366725 27.185215690311953 20.46741480490065 130-134 25.00396384969082 27.752232968659165 27.01759949262724 20.22620368902278 135-139 24.564516129032256 27.41397849462366 27.844086021505376 20.17741935483871 140-144 25.591022987253513 27.889748338598974 26.78941061117769 19.729818062969823 145-149 25.525065963060683 27.78364116094987 26.94986807387863 19.741424802110817 150-151 24.619747357566382 26.862593451920596 28.873420984789895 19.644238205723124 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 64.0 1 34.5 2 3.0 3 0.5 4 0.0 5 1.5 6 3.0 7 2.5 8 4.0 9 3.5 10 0.5 11 1.0 12 1.5 13 1.5 14 1.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.0 21 0.0 22 0.5 23 2.0 24 3.0 25 2.0 26 1.0 27 2.0 28 5.5 29 5.5 30 6.0 31 9.5 32 14.0 33 26.5 34 44.5 35 59.0 36 74.0 37 98.5 38 125.5 39 151.0 40 191.5 41 227.0 42 244.5 43 269.5 44 277.5 45 277.0 46 276.0 47 253.5 48 240.5 49 214.5 50 179.0 51 146.5 52 118.5 53 103.5 54 81.0 55 49.5 56 29.0 57 25.5 58 20.5 59 14.0 60 9.5 61 7.5 62 4.0 63 3.5 64 3.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 1.0 71 1.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.9000000000000004 2 1.6 3 2.25 4 3.3000000000000003 5 3.5749999999999997 6 2.1999999999999997 7 1.7500000000000002 8 1.7500000000000002 9 1.7500000000000002 10-14 2.31 15-19 2.765 20-24 2.39 25-29 2.25 30-34 2.325 35-39 2.505 40-44 2.9499999999999997 45-49 3.04 50-54 2.245 55-59 2.365 60-64 2.415 65-69 2.3800000000000003 70-74 1.855 75-79 1.735 80-84 2.085 85-89 3.46 90-94 4.324999999999999 95-99 2.455 100-104 1.9800000000000002 105-109 2.3449999999999998 110-114 2.565 115-119 2.355 120-124 1.585 125-129 2.87 130-134 5.395 135-139 7.000000000000001 140-144 8.21 145-149 5.25 150-151 3.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64313025745602 97.725 2 0.30588835075197557 0.6 3 0.025490695895997964 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025490695895997964 1.6 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 64 1.6 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8375 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5125 0.0 0.0 0.0 0.0 120-121 3.9375 0.0 0.0 0.0 0.0 122-123 4.199999999999999 0.0 0.0 0.0 0.0 124-125 4.4125 0.0 0.0 0.0 0.0 126-127 4.7875 0.0 0.0 0.0 0.0 128-129 5.0125 0.0 0.0 0.0 0.0 130-131 5.3625 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.25 0.0 0.0 0.0 0.0 136-137 6.4625 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716687 spots for SRR7169943.sra Written 716687 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra Read 716674 spots for SRR7169943.sra Written 716674 spots for SRR7169943.sra SRR ids: ['SRR7169943.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2hgofpbf SRR7169943.sra spots: 14333493 blocks: [[1, 716674], [716675, 1433348], [1433349, 2150022], [2150023, 2866696], [2866697, 3583370], [3583371, 4300044], [4300045, 5016718], [5016719, 5733392], [5733393, 6450066], [6450067, 7166740], [7166741, 7883414], [7883415, 8600088], [8600089, 9316762], [9316763, 10033436], [10033437, 10750110], [10750111, 11466784], [11466785, 12183458], [12183459, 12900132], [12900133, 13616806], [13616807, 14333493]] SRR7169943 file size 4835450 SRR7169943 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169943 SRR7169943_1.fastq SRR7169943_2.fastq Input file: SRR7169943_1.fastq Paired file: SRR7169943_2.fastq trimmed: SRR7169943-trimmed-pair1.fastq, SRR7169943-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:25:49 2025 >> started Wed Feb 12 04:26:04 2025 >> done (15.192s) 14333493 read pairs processed; of these: 23140 ( 0.16%) short read pairs filtered out after trimming by size control 33808 ( 0.24%) empty read pairs filtered out after trimming by size control 14276545 (99.60%) read pairs available; of these: 6955169 (48.72%) trimmed read pairs available after processing 7321376 (51.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 2 0.00% 21 6 0.00% 22 5 0.00% 23 4 0.00% 24 3 0.00% 25 3 0.00% 26 2 0.00% 27 8 0.00% 28 4 0.00% 29 2 0.00% 30 7 0.00% 31 12 0.00% 32 9 0.00% 33 10 0.00% 34 15 0.00% 35 5 0.00% 36 14 0.00% 37 20 0.00% 38 21 0.00% 39 20 0.00% 40 28 0.00% 41 36 0.00% 42 36 0.00% 43 25 0.00% 44 39 0.00% 45 47 0.00% 46 41 0.00% 47 61 0.00% 48 72 0.00% 49 65 0.00% 50 99 0.00% 51 101 0.00% 52 116 0.00% 53 123 0.00% 54 133 0.00% 55 141 0.00% 56 156 0.00% 57 196 0.00% 58 208 0.00% 59 241 0.00% 60 276 0.00% 61 319 0.00% 62 409 0.00% 63 434 0.00% 64 478 0.00% 65 537 0.00% 66 551 0.00% 67 684 0.00% 68 848 0.01% 69 1065 0.01% 70 1377 0.01% 71 1407 0.01% 72 1351 0.01% 73 1535 0.01% 74 1610 0.01% 75 1800 0.01% 76 2043 0.01% 77 2158 0.02% 78 2370 0.02% 79 2606 0.02% 80 2875 0.02% 81 3351 0.02% 82 3768 0.03% 83 4384 0.03% 84 5564 0.04% 85 6627 0.05% 86 6787 0.05% 87 7255 0.05% 88 7763 0.05% 89 7973 0.06% 90 8639 0.06% 91 9240 0.06% 92 9914 0.07% 93 10665 0.07% 94 11468 0.08% 95 12543 0.09% 96 13035 0.09% 97 13275 0.09% 98 13958 0.10% 99 14396 0.10% 100 15062 0.11% 101 15916 0.11% 102 16925 0.12% 103 18010 0.13% 104 18844 0.13% 105 20123 0.14% 106 20625 0.14% 107 21146 0.15% 108 21875 0.15% 109 22532 0.16% 110 23133 0.16% 111 24080 0.17% 112 24976 0.17% 113 26280 0.18% 114 27358 0.19% 115 28559 0.20% 116 29756 0.21% 117 30641 0.21% 118 31422 0.22% 119 31676 0.22% 120 32684 0.23% 121 33205 0.23% 122 34549 0.24% 123 36023 0.25% 124 37821 0.26% 125 39625 0.28% 126 41379 0.29% 127 43047 0.30% 128 44191 0.31% 129 45692 0.32% 130 46872 0.33% 131 48251 0.34% 132 51172 0.36% 133 54008 0.38% 134 56670 0.40% 135 60769 0.43% 136 63867 0.45% 137 67933 0.48% 138 73139 0.51% 139 79613 0.56% 140 85322 0.60% 141 91805 0.64% 142 99001 0.69% 143 108934 0.76% 144 120620 0.84% 145 138868 0.97% 146 169547 1.19% 147 220432 1.54% 148 316702 2.22% 149 615642 4.31% 150 3329365 23.32% 151 7321376 51.28% 14276545 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=28 prefix-density=0.23 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=164.83 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=30 prefix-density=0.30 prefix-fanout=2.6 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=130.50 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGAAGTTACCTGGGTACCACCCCAAGACTGAAG SRR7169943 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:27:04 Started mapping on | Feb 12 04:27:05 Finished on | Feb 12 04:28:18 Mapping speed, Million of reads per hour | 704.05 Number of input reads | 14276545 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13556471 Uniquely mapped reads % | 94.96% Average mapped length | 292.58 Number of splices: Total | 12957586 Number of splices: Annotated (sjdb) | 12745593 Number of splices: GT/AG | 12772190 Number of splices: GC/AG | 148741 Number of splices: AT/AC | 10402 Number of splices: Non-canonical | 26253 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254841 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 37108 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 484829 484829 484829 N_multimapping 254841 254841 254841 N_noFeature 255841 13400602 325866 N_ambiguous 138603 1080 51971 UnstrandedReadsAssigned:13162027 PositiveStrandReadsAssigned:154789 NegativeStrandReadsAssigned:13178634 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169943 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169943-trimmed-pair1.fastq SRR7169943-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,276,545 reads, 13,123,116 reads pseudoaligned [quant] estimated average fragment length: 236.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52401 SRR7169943.ke.tsv 34699 SRR7169943.se.tsv 87100 total ==> SRR7169943.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.57 257 10.5587 Potri.005G024800.1.v4.1 1035 799.571 28 2.56463 Potri.004G059700.1.v4.1 961 725.628 11 1.1102 Potri.007G009000.2.v4.1 1416 1180.57 0 0 Potri.003G141000.2.v4.1 2943 2707.57 254.029 6.87111 Potri.016G087400.1.v4.1 270 84.4774 1072 929.348 Potri.015G069301.1.v4.1 564 333.914 0 0 Potri.010G195200.1.v4.1 1773 1537.57 15 0.714464 Potri.012G127500.1.v4.1 977 741.612 4388 433.325 ==> SRR7169943.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 551 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169943 completed mapping pipeline successfully