Starting /dee2/code/volunteer_pipeline.sh SRR7169944 current disk space = 3049024557056 free memory = 831551228 SRR7169944 SRAfilesize f9c2b97417711c4b291371a940a0311f SRR7169944.sra SRR7169944.sra file validated SRR7169944 is paired end SRR7169944 is conventional basespace SRR7169944 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169944_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7675 34.0 33.0 34.0 33.0 34.0 2 33.383 34.0 34.0 34.0 33.0 34.0 3 33.36875 34.0 34.0 34.0 33.0 34.0 4 33.5115 34.0 34.0 34.0 33.0 34.0 5 33.485 34.0 34.0 34.0 33.0 34.0 6 37.1795 38.0 37.0 38.0 36.0 38.0 7 37.39075 38.0 38.0 38.0 37.0 38.0 8 37.5175 38.0 38.0 38.0 37.0 38.0 9 37.6435 38.0 38.0 38.0 38.0 38.0 10-14 37.6015 38.0 38.0 38.0 38.0 38.0 15-19 37.5584 38.0 38.0 38.0 38.0 38.0 20-24 37.5015 38.0 38.0 38.0 38.0 38.0 25-29 37.46675 38.0 38.0 38.0 38.0 38.0 30-34 37.4751 38.0 38.0 38.0 37.4 38.0 35-39 37.4203 38.0 38.0 38.0 37.4 38.0 40-44 37.24375 38.0 38.0 38.0 37.0 38.0 45-49 37.2108 38.0 38.0 38.0 36.4 38.0 50-54 37.160999999999994 38.0 38.0 38.0 36.0 38.0 55-59 37.0755 38.0 38.0 38.0 36.0 38.0 60-64 37.01285 38.0 38.0 38.0 36.0 38.0 65-69 37.00035 38.0 38.0 38.0 36.0 38.0 70-74 36.88215 38.0 38.0 38.0 35.2 38.0 75-79 36.6905 38.0 38.0 38.0 35.0 38.0 80-84 36.561 38.0 38.0 38.0 34.6 38.0 85-89 36.40604999999999 38.0 38.0 38.0 34.0 38.0 90-94 36.41225 38.0 38.0 38.0 34.0 38.0 95-99 36.28215 38.0 38.0 38.0 34.0 38.0 100-104 36.0296 38.0 37.6 38.0 33.0 38.0 105-109 35.95745 38.0 37.2 38.0 33.2 38.0 110-114 35.6441 38.0 36.8 38.0 31.2 38.0 115-119 35.36015 38.0 36.4 38.0 30.0 38.0 120-124 35.2321 38.0 36.2 38.0 29.6 38.0 125-129 34.917199999999994 38.0 35.8 38.0 27.8 38.0 130-134 34.4496 38.0 35.0 38.0 25.6 38.0 135-139 34.1933 38.0 35.0 38.0 24.0 38.0 140-144 33.9814 38.0 35.0 38.0 23.0 38.0 145-149 33.194900000000004 38.0 34.6 38.0 15.8 38.0 150-151 29.394624999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 4.0 15 2.0 16 4.0 17 6.0 18 8.0 19 12.0 20 6.0 21 9.0 22 8.0 23 6.0 24 14.0 25 17.0 26 26.0 27 18.0 28 26.0 29 33.0 30 43.0 31 60.0 32 76.0 33 97.0 34 147.0 35 276.0 36 644.0 37 2454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.01123595505618 11.159346271705822 8.707865168539326 39.12155260469867 2 21.875 14.000000000000002 34.175 29.95 3 20.4 18.125 24.825 36.65 4 24.425 26.900000000000002 22.325 26.35 5 24.025 31.125000000000004 22.900000000000002 21.95 6 19.15 37.15 23.575 20.125 7 14.274999999999999 27.375 40.25 18.099999999999998 8 17.95 26.125 30.775000000000002 25.15 9 18.0 23.974999999999998 34.599999999999994 23.425 10-14 19.89 29.985 27.11 23.015 15-19 20.035 28.15 27.965 23.849999999999998 20-24 19.81 29.12 27.450000000000003 23.62 25-29 19.345000000000002 29.03 27.445000000000004 24.18 30-34 19.555 28.87 27.51 24.065 35-39 20.22 28.87 27.12 23.79 40-44 20.135 29.32 27.105 23.44 45-49 20.415 28.625 27.495000000000005 23.465 50-54 19.91 28.910000000000004 27.355 23.825 55-59 19.93 28.525 28.13 23.415 60-64 20.375 28.689999999999998 27.634999999999998 23.3 65-69 19.86 28.055000000000003 27.875 24.21 70-74 20.105 28.860000000000003 27.529999999999998 23.505000000000003 75-79 20.27 28.494999999999997 27.755000000000003 23.48 80-84 20.495 28.910000000000004 27.529999999999998 23.064999999999998 85-89 20.385 28.415000000000003 27.58 23.62 90-94 20.48 28.26 27.47 23.79 95-99 20.369999999999997 28.945 27.089999999999996 23.595 100-104 20.625 28.410000000000004 27.485 23.48 105-109 20.955 28.555000000000003 26.965 23.525 110-114 20.7 28.83 26.400000000000002 24.07 115-119 21.185000000000002 28.665000000000003 26.805 23.345 120-124 21.12 28.599999999999998 26.415 23.865 125-129 20.990000000000002 28.675 26.810000000000002 23.525 130-134 21.57 28.355000000000004 26.275 23.799999999999997 135-139 21.16 28.88 26.505000000000003 23.455000000000002 140-144 21.43 28.494999999999997 26.490000000000002 23.585 145-149 21.14 28.395 26.834999999999997 23.630000000000003 150-151 20.3125 28.4375 26.75 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 3.5 22 3.0 23 0.0 24 1.5 25 4.5 26 7.0 27 6.0 28 8.0 29 12.0 30 17.5 31 22.5 32 28.5 33 43.0 34 55.0 35 70.5 36 94.5 37 110.0 38 120.0 39 143.0 40 188.5 41 223.0 42 241.5 43 255.0 44 263.5 45 263.5 46 277.5 47 273.0 48 228.0 49 199.5 50 178.5 51 143.5 52 119.5 53 99.0 54 70.5 55 62.5 56 46.0 57 22.5 58 17.5 59 16.0 60 10.0 61 7.5 62 8.5 63 8.5 64 7.0 65 6.0 66 4.0 67 1.5 68 0.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57221942627076 98.925 2 0.40261701056869653 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025163563160543533 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.55 0.0 0.0 0.0 0.0 102-103 1.8624999999999998 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.4125 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.0999999999999996 0.0 0.0 0.0 0.0 112-113 3.3875 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.5625 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.6625 0.0 0.0 0.0 0.0 122-123 6.137499999999999 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.5 0.0 0.0 0.0 0.0 128-129 8.0 0.0 0.0 0.0 0.0 130-131 8.55 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.825 0.0 0.0 0.0 0.0 136-137 10.325 0.0 0.0 0.0 0.0 138-139 10.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169944 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169944_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4675 33.0 33.0 34.0 31.0 34.0 2 32.0995 33.0 33.0 34.0 31.0 34.0 3 32.176 34.0 33.0 34.0 31.0 34.0 4 31.778 34.0 33.0 34.0 31.0 34.0 5 31.74725 34.0 33.0 34.0 31.0 34.0 6 36.23675 38.0 38.0 38.0 34.0 38.0 7 36.304 38.0 38.0 38.0 35.0 38.0 8 36.277 38.0 38.0 38.0 36.0 38.0 9 36.39875 38.0 38.0 38.0 36.0 38.0 10-14 36.3108 38.0 38.0 38.0 35.8 38.0 15-19 35.95615 38.0 38.0 38.0 34.8 38.0 20-24 36.18375 38.0 38.0 38.0 35.8 38.0 25-29 36.32335 38.0 38.0 38.0 35.8 38.0 30-34 36.32235 38.0 38.0 38.0 36.0 38.0 35-39 36.173500000000004 38.0 38.0 38.0 35.6 38.0 40-44 35.91925 38.0 38.0 38.0 34.8 38.0 45-49 35.810050000000004 38.0 38.0 38.0 34.2 38.0 50-54 36.175000000000004 38.0 38.0 38.0 34.8 38.0 55-59 36.0622 38.0 38.0 38.0 34.8 38.0 60-64 36.06245 38.0 38.0 38.0 34.6 38.0 65-69 35.94205000000001 38.0 38.0 38.0 33.8 38.0 70-74 35.82895 38.0 38.0 38.0 33.8 38.0 75-79 35.715250000000005 38.0 38.0 38.0 33.6 38.0 80-84 35.706300000000006 38.0 38.0 38.0 33.6 38.0 85-89 35.00789999999999 38.0 38.0 38.0 29.4 38.0 90-94 34.7122 38.0 38.0 38.0 27.8 38.0 95-99 35.02655 38.0 37.8 38.0 28.2 38.0 100-104 35.26604999999999 38.0 38.0 38.0 31.0 38.0 105-109 34.994350000000004 38.0 37.6 38.0 28.8 38.0 110-114 34.85485 38.0 37.0 38.0 27.8 38.0 115-119 34.6025 38.0 37.0 38.0 26.4 38.0 120-124 34.3593 38.0 36.0 38.0 24.2 38.0 125-129 33.85245 38.0 35.6 38.0 18.2 38.0 130-134 32.51885 38.0 34.8 38.0 8.8 38.0 135-139 31.46705 38.0 33.6 38.0 2.0 38.0 140-144 30.42995 38.0 31.8 38.0 2.0 38.0 145-149 29.854150000000004 38.0 31.0 38.0 2.0 38.0 150-151 26.091749999999998 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 86.0 3 4.0 4 2.0 5 4.0 6 4.0 7 1.0 8 0.0 9 2.0 10 4.0 11 3.0 12 4.0 13 0.0 14 6.0 15 11.0 16 7.0 17 13.0 18 9.0 19 6.0 20 11.0 21 13.0 22 15.0 23 17.0 24 25.0 25 24.0 26 41.0 27 30.0 28 43.0 29 51.0 30 54.0 31 82.0 32 111.0 33 168.0 34 141.0 35 196.0 36 455.0 37 2357.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.442006269592476 21.551724137931032 12.434691745036574 29.57157784743992 2 27.00989094598022 27.517118944965762 29.72356074055288 15.749429368501142 3 21.295587860239735 27.77352716143841 30.553430247385872 20.377454730935984 4 23.938923395445137 33.10041407867495 23.24016563146998 19.72049689440994 5 25.181535269709542 36.72199170124482 21.34336099585062 16.75311203319502 6 20.964039785768936 38.76562101504718 22.749298648304002 17.521040550879878 7 20.02551020408163 22.168367346938776 38.163265306122454 19.642857142857142 8 21.03386809269162 24.82811306340718 29.233511586452764 24.904507257448433 9 23.769446569752613 23.922468757969906 29.303749043611322 23.004335628666155 10-14 22.418999846445207 28.965552541331828 27.081947074781183 21.53350053744178 15-19 22.651249225686556 27.808176749948377 28.283088994424944 21.25748502994012 20-24 22.95552367288379 27.997540479606474 27.50563640090182 21.541299446607912 25-29 23.140116338401878 28.217165016838454 28.166139401979795 20.476579242779874 30-34 23.05060511668284 27.702599193177758 28.029413266608792 21.217382423530616 35-39 23.09862044207395 27.616800861582647 27.91425201292374 21.370326683419663 40-44 23.143564356435643 27.810437293729372 27.86716171617162 21.178836633663366 45-49 23.551266835234017 27.633004799009235 28.10258527271789 20.71314309303886 50-54 23.341335103937894 27.77465651974054 27.636753664640683 21.24725471168088 55-59 23.26390665779643 28.0487180799345 27.961721508622894 20.72565375364618 60-64 22.986800368361813 28.880589378901057 27.61690371431495 20.515706538422187 65-69 22.97857106326395 28.266762133687923 28.046847031146115 20.70781977190201 70-74 23.615767550543534 27.903078329777507 28.30945849842528 20.171695621253683 75-79 23.68300736601473 28.00609601219202 27.82829565659131 20.48260096520193 80-84 23.043167670170426 28.11001122563527 28.217165016838454 20.62965608735585 85-89 23.665628245067495 27.637590861889926 27.705088265835933 20.991692627206646 90-94 24.147682639434407 27.577899973815136 28.201099764336213 20.073317622414244 95-99 23.919840090205525 27.850955871047102 27.90220901030188 20.326995028445495 100-104 24.27878478427368 28.164411539443453 27.61807505744192 19.93872861884095 105-109 23.575447570332482 28.20971867007673 28.010230179028135 20.20460358056266 110-114 24.99357689738451 27.645033657057706 27.382971070345818 19.978418375211962 115-119 24.533401325854157 28.36817950025497 27.215706272310047 19.882712901580827 120-124 24.738764329917824 27.949680430151165 27.670690879577965 19.64086436035305 125-129 24.64977338277709 28.708281829419036 26.84899052327977 19.792954264524106 130-134 25.551646945954587 28.024730838929752 27.028035390683296 19.39558682443236 135-139 25.632599408478473 27.976777303100008 26.684193230364773 19.706430058056743 140-144 25.829765942069272 27.664424306443543 27.48651804080725 19.019291710679937 145-149 26.177425363205792 28.157096482358572 26.65105635676654 19.014421797669097 150-151 25.24196670538134 27.68099109562524 27.96489869660601 19.112143502387404 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 58.0 1 30.0 2 2.0 3 2.5 4 2.5 5 3.5 6 4.5 7 2.5 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 1.5 18 2.0 19 2.5 20 1.0 21 1.0 22 3.0 23 3.5 24 2.5 25 3.5 26 5.0 27 7.0 28 13.0 29 13.0 30 9.5 31 15.5 32 24.5 33 37.0 34 48.5 35 63.0 36 79.0 37 102.0 38 145.0 39 160.5 40 181.5 41 222.0 42 249.0 43 282.0 44 278.5 45 264.0 46 258.5 47 243.5 48 236.0 49 208.0 50 165.0 51 131.0 52 111.0 53 96.0 54 72.5 55 48.5 56 34.5 57 26.5 58 21.0 59 14.0 60 8.0 61 5.0 62 2.0 63 2.0 64 2.5 65 3.0 66 2.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.3 2 1.425 3 1.975 4 3.4000000000000004 5 3.5999999999999996 6 1.975 7 2.0 8 1.825 9 1.975 10-14 2.315 15-19 3.1399999999999997 20-24 2.42 25-29 2.01 30-34 2.085 35-39 2.505 40-44 3.04 45-49 3.105 50-54 2.105 55-59 2.2950000000000004 60-64 2.27 65-69 2.235 70-74 1.5699999999999998 75-79 1.575 80-84 2.01 85-89 3.6999999999999997 90-94 4.5249999999999995 95-99 2.445 100-104 2.075 105-109 2.25 110-114 2.6950000000000003 115-119 1.95 120-124 1.43 125-129 2.92 130-134 6.1899999999999995 135-139 8.709999999999999 140-144 10.065 145-149 6.045 150-151 3.1375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56466069142125 97.2 2 0.28169014084507044 0.5499999999999999 3 0.05121638924455826 0.15 4 0.0 0.0 5 0.0 0.0 6 0.02560819462227913 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02560819462227913 0.22499999999999998 >10 0.02560819462227913 0.3 >50 0.02560819462227913 1.425 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 57 1.425 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 1.1375000000000002 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.575 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.6875 0.0 0.0 0.0 0.0 110-111 3.0250000000000004 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.925 0.0 0.0 0.0 0.0 116-117 4.4375 0.0 0.0 0.0 0.0 118-119 4.9375 0.0 0.0 0.0 0.0 120-121 5.475 0.0 0.0 0.0 0.0 122-123 5.9 0.0 0.0 0.0 0.0 124-125 6.4125 0.0 0.0 0.0 0.0 126-127 7.0875 0.0 0.0 0.0 0.0 128-129 7.55 0.0 0.0 0.0 0.0 130-131 8.05 0.0 0.0 0.0 0.0 132-133 8.65 0.0 0.0 0.0 0.0 134-135 9.175 0.0 0.0 0.0 0.0 136-137 9.5625 0.0 0.0 0.0 0.0 138-139 10.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGAT 10 0.006744593 145.54546 1 GTTTGTG 10 0.0070134383 143.67949 5 GGTTCAA 10 0.0070134383 143.67949 9 ATCAGGC 10 0.0070134383 143.67949 2 AGTTTTT 10 0.0070134383 143.67949 3 TGTGATA 10 0.0070134383 143.67949 8 TTGTGAT 10 0.0072893095 141.86076 7 TTTGTGA 10 0.0072893095 141.86076 6 >>END_MODULE Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967586 spots for SRR7169944.sra Written 967586 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra Read 967581 spots for SRR7169944.sra Written 967581 spots for SRR7169944.sra SRR ids: ['SRR7169944.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p2ossun2 SRR7169944.sra spots: 19351625 blocks: [[1, 967581], [967582, 1935162], [1935163, 2902743], [2902744, 3870324], [3870325, 4837905], [4837906, 5805486], [5805487, 6773067], [6773068, 7740648], [7740649, 8708229], [8708230, 9675810], [9675811, 10643391], [10643392, 11610972], [11610973, 12578553], [12578554, 13546134], [13546135, 14513715], [14513716, 15481296], [15481297, 16448877], [16448878, 17416458], [17416459, 18384039], [18384040, 19351625]] SRR7169944 file size 6535930 SRR7169944 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169944 SRR7169944_1.fastq SRR7169944_2.fastq Input file: SRR7169944_1.fastq Paired file: SRR7169944_2.fastq trimmed: SRR7169944-trimmed-pair1.fastq, SRR7169944-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:11:19 2025 >> started Wed Feb 12 04:11:39 2025 >> done (20.139s) 19351625 read pairs processed; of these: 21357 ( 0.11%) short read pairs filtered out after trimming by size control 131400 ( 0.68%) empty read pairs filtered out after trimming by size control 19198868 (99.21%) read pairs available; of these: 9356930 (48.74%) trimmed read pairs available after processing 9841938 (51.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 2 0.00% 20 5 0.00% 21 7 0.00% 22 8 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 19 0.00% 27 13 0.00% 28 12 0.00% 29 7 0.00% 30 9 0.00% 31 14 0.00% 32 10 0.00% 33 23 0.00% 34 15 0.00% 35 12 0.00% 36 20 0.00% 37 44 0.00% 38 36 0.00% 39 45 0.00% 40 62 0.00% 41 58 0.00% 42 60 0.00% 43 65 0.00% 44 68 0.00% 45 102 0.00% 46 136 0.00% 47 133 0.00% 48 136 0.00% 49 157 0.00% 50 205 0.00% 51 205 0.00% 52 229 0.00% 53 252 0.00% 54 277 0.00% 55 302 0.00% 56 339 0.00% 57 347 0.00% 58 482 0.00% 59 509 0.00% 60 537 0.00% 61 696 0.00% 62 667 0.00% 63 818 0.00% 64 997 0.01% 65 1010 0.01% 66 1095 0.01% 67 1253 0.01% 68 1381 0.01% 69 1713 0.01% 70 1982 0.01% 71 2189 0.01% 72 2356 0.01% 73 2705 0.01% 74 3022 0.02% 75 3388 0.02% 76 3731 0.02% 77 4100 0.02% 78 4542 0.02% 79 4915 0.03% 80 5517 0.03% 81 6180 0.03% 82 7053 0.04% 83 7939 0.04% 84 9798 0.05% 85 11048 0.06% 86 11900 0.06% 87 12511 0.07% 88 13485 0.07% 89 14303 0.07% 90 15309 0.08% 91 16436 0.09% 92 17354 0.09% 93 18917 0.10% 94 20642 0.11% 95 21708 0.11% 96 23115 0.12% 97 24616 0.13% 98 25590 0.13% 99 26224 0.14% 100 27911 0.15% 101 28860 0.15% 102 30428 0.16% 103 32133 0.17% 104 33351 0.17% 105 35830 0.19% 106 37112 0.19% 107 38216 0.20% 108 39987 0.21% 109 40996 0.21% 110 41933 0.22% 111 43166 0.22% 112 45241 0.24% 113 46318 0.24% 114 48845 0.25% 115 50248 0.26% 116 52380 0.27% 117 53516 0.28% 118 55182 0.29% 119 56324 0.29% 120 57686 0.30% 121 58902 0.31% 122 60866 0.32% 123 62317 0.32% 124 64990 0.34% 125 66530 0.35% 126 70257 0.37% 127 71519 0.37% 128 74490 0.39% 129 76417 0.40% 130 78560 0.41% 131 81096 0.42% 132 83423 0.43% 133 85997 0.45% 134 89693 0.47% 135 93948 0.49% 136 99145 0.52% 137 104415 0.54% 138 111786 0.58% 139 119310 0.62% 140 125964 0.66% 141 133963 0.70% 142 142408 0.74% 143 153206 0.80% 144 169352 0.88% 145 189707 0.99% 146 225248 1.17% 147 292619 1.52% 148 394788 2.06% 149 740026 3.85% 150 3983137 20.75% 151 9841938 51.26% 19198868 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=41 prefix-density=0.15 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=283.63 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.89 fanout-score-rank=37 prefix-density=0.35 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=308.10 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.3 sequence=AAGAAGAAGAAG SRR7169944 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:12:21 Started mapping on | Feb 12 04:12:21 Finished on | Feb 12 04:14:01 Mapping speed, Million of reads per hour | 691.16 Number of input reads | 19198868 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 18427909 Uniquely mapped reads % | 95.98% Average mapped length | 290.51 Number of splices: Total | 17172056 Number of splices: Annotated (sjdb) | 16871792 Number of splices: GT/AG | 16915165 Number of splices: GC/AG | 205359 Number of splices: AT/AC | 13764 Number of splices: Non-canonical | 37768 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 342205 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 25922 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.06% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 446795 446795 446795 N_multimapping 342205 342205 342205 N_noFeature 464089 18207473 588826 N_ambiguous 170493 1119 73984 UnstrandedReadsAssigned:17793327 PositiveStrandReadsAssigned:219317 NegativeStrandReadsAssigned:17765099 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169944 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169944-trimmed-pair1.fastq SRR7169944-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,198,868 reads, 17,674,418 reads pseudoaligned [quant] estimated average fragment length: 219.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,181 rounds 52401 SRR7169944.ke.tsv 34699 SRR7169944.se.tsv 87100 total ==> SRR7169944.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.69 323 10.7389 Potri.005G024800.1.v4.1 1035 816.693 56 4.10286 Potri.004G059700.1.v4.1 961 742.732 2 0.161122 Potri.007G009000.2.v4.1 1416 1197.69 0 0 Potri.003G141000.2.v4.1 2943 2724.69 373.153 8.19459 Potri.016G087400.1.v4.1 270 90.0939 1353 898.586 Potri.015G069301.1.v4.1 564 349.115 0 0 Potri.010G195200.1.v4.1 1773 1554.69 19 0.731251 Potri.012G127500.1.v4.1 977 758.716 9034 712.457 ==> SRR7169944.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1143 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 315 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169944 completed mapping pipeline successfully