Starting /dee2/code/volunteer_pipeline.sh SRR7169945 current disk space = 3049072705536 free memory = 1582423316 SRR7169945 SRAfilesize 2af6435d16bb9c703ae90c88800398a8 SRR7169945.sra SRR7169945.sra file validated SRR7169945 is paired end SRR7169945 is conventional basespace SRR7169945 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169945_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6405 34.0 33.0 34.0 33.0 34.0 2 33.33075 34.0 34.0 34.0 33.0 34.0 3 33.497 34.0 34.0 34.0 33.0 34.0 4 33.52325 34.0 34.0 34.0 33.0 34.0 5 33.425 34.0 34.0 34.0 33.0 34.0 6 37.194 38.0 37.0 38.0 36.0 38.0 7 37.4575 38.0 38.0 38.0 37.0 38.0 8 37.578 38.0 38.0 38.0 38.0 38.0 9 37.6455 38.0 38.0 38.0 38.0 38.0 10-14 37.60025 38.0 38.0 38.0 38.0 38.0 15-19 37.62245 38.0 38.0 38.0 38.0 38.0 20-24 37.54025 38.0 38.0 38.0 38.0 38.0 25-29 37.44995 38.0 38.0 38.0 38.0 38.0 30-34 37.4046 38.0 38.0 38.0 38.0 38.0 35-39 37.2803 38.0 38.0 38.0 37.4 38.0 40-44 37.1802 38.0 38.0 38.0 36.8 38.0 45-49 37.05515 38.0 38.0 38.0 36.2 38.0 50-54 37.0559 38.0 38.0 38.0 36.2 38.0 55-59 36.951550000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.9241 38.0 38.0 38.0 36.0 38.0 65-69 36.882850000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.7478 38.0 38.0 38.0 35.2 38.0 75-79 36.35355 38.0 38.0 38.0 34.4 38.0 80-84 36.1845 38.0 38.0 38.0 33.8 38.0 85-89 36.10435 38.0 38.0 38.0 33.4 38.0 90-94 35.95795 38.0 38.0 38.0 33.4 38.0 95-99 35.780899999999995 38.0 37.8 38.0 32.6 38.0 100-104 35.56415 38.0 37.0 38.0 31.0 38.0 105-109 35.413799999999995 38.0 37.0 38.0 30.0 38.0 110-114 35.2333 38.0 37.0 38.0 29.0 38.0 115-119 35.034749999999995 38.0 36.4 38.0 28.0 38.0 120-124 35.130100000000006 38.0 36.6 38.0 29.4 38.0 125-129 34.81035 38.0 36.0 38.0 28.0 38.0 130-134 33.96775 38.0 35.2 38.0 22.4 38.0 135-139 33.28959999999999 38.0 34.6 38.0 16.2 38.0 140-144 33.35555000000001 38.0 34.8 38.0 15.0 38.0 145-149 32.733999999999995 38.0 34.2 38.0 11.4 38.0 150-151 28.429375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 2.0 7 2.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 1.0 14 5.0 15 4.0 16 4.0 17 4.0 18 12.0 19 19.0 20 7.0 21 19.0 22 8.0 23 17.0 24 22.0 25 24.0 26 29.0 27 28.0 28 30.0 29 44.0 30 37.0 31 54.0 32 65.0 33 113.0 34 147.0 35 242.0 36 577.0 37 2478.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.78452044227308 14.811005399845719 11.159681151967087 32.24479300591412 2 24.375 15.55 29.825000000000003 30.25 3 18.85 20.424999999999997 26.950000000000003 33.775 4 21.65 25.624999999999996 24.15 28.575 5 22.15 30.675 23.849999999999998 23.325000000000003 6 21.825 32.925 24.75 20.5 7 15.0 29.875 37.6 17.525 8 17.525 28.225 29.549999999999997 24.7 9 15.975 27.625 33.25 23.150000000000002 10-14 19.07 30.814999999999998 26.834999999999997 23.28 15-19 19.43 30.049999999999997 27.235 23.285 20-24 19.36 30.135 27.450000000000003 23.055 25-29 19.67 29.925 26.625 23.78 30-34 19.265 29.909999999999997 26.665 24.16 35-39 19.595000000000002 28.98 27.005000000000003 24.42 40-44 19.650000000000002 29.815 27.255000000000003 23.28 45-49 20.188075230092036 29.27671068427371 26.925770308123248 23.609443777511004 50-54 19.785 29.475 26.584999999999997 24.154999999999998 55-59 20.005 29.37 26.740000000000002 23.885 60-64 19.57 29.409999999999997 27.11 23.91 65-69 20.105 29.865000000000002 26.555 23.474999999999998 70-74 20.119999999999997 29.304999999999996 26.83 23.745 75-79 19.77 29.345 27.095000000000002 23.79 80-84 20.335 28.884999999999998 27.224999999999998 23.555 85-89 19.968962755306368 28.809571485782943 26.842210652783336 24.379255106127353 90-94 19.962752302813712 28.73106155936981 27.251220617103737 24.05496552071274 95-99 20.097669032875196 28.726778432260986 27.115742838443335 24.05980969642048 100-104 19.960968775020017 29.063250600480384 26.81144915932746 24.164331465172136 105-109 20.105 28.49 27.150000000000002 24.255 110-114 20.26 28.475 26.96 24.305 115-119 20.794999999999998 28.255000000000003 27.015 23.935000000000002 120-124 20.26 28.265 27.189999999999998 24.285 125-129 20.390097524381094 28.212053013253314 27.04176044011003 24.356089022255563 130-134 21.13113113113113 27.847847847847845 26.786786786786788 24.234234234234233 135-139 20.635797509039776 27.91783848935315 26.908396946564885 24.537967055042188 140-144 21.027873692638742 27.65350547965771 26.717710053545513 24.600910774158034 145-149 19.758710452543053 28.659391269523425 26.531838205847013 25.050060072086506 150-151 20.6625 28.012500000000003 26.3625 24.962500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 3.0 25 3.5 26 4.5 27 9.0 28 16.0 29 20.0 30 23.0 31 34.5 32 44.5 33 48.5 34 57.0 35 77.0 36 100.0 37 120.5 38 140.5 39 153.0 40 175.0 41 202.0 42 212.5 43 231.5 44 259.0 45 271.5 46 279.5 47 263.5 48 226.0 49 188.5 50 164.5 51 153.0 52 131.0 53 107.0 54 77.0 55 51.0 56 36.5 57 27.5 58 23.0 59 17.0 60 12.0 61 10.5 62 7.0 63 3.0 64 2.5 65 3.0 66 3.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.12 90-94 0.6649999999999999 95-99 0.685 100-104 0.08 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.025 130-134 0.1 135-139 0.44 140-144 0.08499999999999999 145-149 0.12 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26656550328781 98.125 2 0.7081436519979768 1.4000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025290844714213456 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCATCATCTCGTATGC 19 0.475 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.525 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 2.9000000000000004 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 3.8125 0.0 0.0 0.0 0.0 122-123 4.15 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.887499999999999 0.0 0.0 0.0 0.0 128-129 5.175 0.0 0.0 0.0 0.0 130-131 5.7375 0.0 0.0 0.0 0.0 132-133 6.262499999999999 0.0 0.0 0.0 0.0 134-135 6.675000000000001 0.0 0.0 0.0 0.0 136-137 7.175000000000001 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169945 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169945_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.61975 33.0 33.0 34.0 32.0 34.0 2 31.94625 34.0 33.0 34.0 31.0 34.0 3 31.86275 34.0 33.0 34.0 31.0 34.0 4 31.7245 34.0 33.0 34.0 31.0 34.0 5 31.67175 34.0 33.0 34.0 31.0 34.0 6 35.722 38.0 38.0 38.0 35.0 38.0 7 35.82175 38.0 38.0 38.0 35.0 38.0 8 35.79025 38.0 38.0 38.0 34.0 38.0 9 35.85575 38.0 38.0 38.0 35.0 38.0 10-14 35.714650000000006 38.0 38.0 38.0 34.6 38.0 15-19 35.660900000000005 38.0 38.0 38.0 34.6 38.0 20-24 35.68305 38.0 38.0 38.0 34.4 38.0 25-29 35.8621 38.0 38.0 38.0 35.6 38.0 30-34 35.88295 38.0 38.0 38.0 35.8 38.0 35-39 35.72795 38.0 38.0 38.0 34.8 38.0 40-44 35.637299999999996 38.0 38.0 38.0 34.8 38.0 45-49 35.554050000000004 38.0 38.0 38.0 34.4 38.0 50-54 35.71805 38.0 38.0 38.0 34.6 38.0 55-59 35.69425 38.0 38.0 38.0 34.6 38.0 60-64 35.632400000000004 38.0 38.0 38.0 34.2 38.0 65-69 35.63445 38.0 38.0 38.0 34.2 38.0 70-74 35.4921 38.0 38.0 38.0 33.8 38.0 75-79 35.43775 38.0 38.0 38.0 33.6 38.0 80-84 35.348200000000006 38.0 38.0 38.0 33.2 38.0 85-89 34.97215 38.0 38.0 38.0 30.8 38.0 90-94 34.57135 38.0 38.0 38.0 27.4 38.0 95-99 34.97185 38.0 38.0 38.0 29.4 38.0 100-104 34.96325 38.0 38.0 38.0 29.8 38.0 105-109 34.9351 38.0 38.0 38.0 29.4 38.0 110-114 34.7787 38.0 38.0 38.0 28.6 38.0 115-119 34.58675 38.0 37.2 38.0 27.0 38.0 120-124 34.391549999999995 38.0 37.0 38.0 24.4 38.0 125-129 33.95125 38.0 36.4 38.0 19.4 38.0 130-134 32.790800000000004 38.0 35.6 38.0 6.6 38.0 135-139 31.68915 38.0 34.2 38.0 2.0 38.0 140-144 30.700350000000004 38.0 32.8 38.0 2.0 38.0 145-149 30.136449999999996 38.0 31.6 38.0 2.0 38.0 150-151 26.941499999999998 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 147.0 3 5.0 4 4.0 5 1.0 6 0.0 7 1.0 8 1.0 9 3.0 10 5.0 11 1.0 12 5.0 13 2.0 14 5.0 15 8.0 16 6.0 17 19.0 18 5.0 19 10.0 20 6.0 21 12.0 22 17.0 23 13.0 24 11.0 25 19.0 26 13.0 27 20.0 28 39.0 29 52.0 30 55.0 31 74.0 32 107.0 33 110.0 34 118.0 35 163.0 36 376.0 37 2567.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.63446475195823 21.33159268929504 15.326370757180158 23.70757180156658 2 28.83780332056194 28.122605363984675 26.48786717752235 16.551724137931036 3 21.619537275064268 29.254498714652954 29.048843187660665 20.077120822622106 4 25.156087408949013 34.28720083246618 22.81477627471384 17.741935483870968 5 26.088089653375036 34.84493093562679 21.13630440448267 17.930675006515507 6 23.100936524453694 34.78147762747138 23.959417273673257 18.158168574401664 7 21.528497409326423 23.00518134715026 36.16580310880829 19.300518134715023 8 23.652849740932645 25.051813471502594 26.865284974093264 24.430051813471504 9 22.876323263619934 26.800929512006196 28.117738187451586 22.20500903692228 10-14 24.689690989353412 27.91482731757985 25.967281225655675 21.428200467411063 15-19 23.82761671784729 28.126789153177533 27.21074272627908 20.834851402696092 20-24 24.431523206312946 28.0967708441491 26.819644896687777 20.652061052850172 25-29 24.090345255323548 28.783336778995245 26.488525945834198 20.637792019847012 30-34 24.095016782855666 28.081590498321713 27.327652982184354 20.495739736638267 35-39 24.450435503940273 27.51970136872667 27.01679800912484 21.013065118208214 40-44 24.469081823860087 28.128253175098894 26.899854257755567 20.502810743285448 45-49 24.30758017492711 27.441690962099123 27.363598500624743 20.887130362349023 50-54 24.007874831623667 28.48409491244431 26.898766967153666 20.609263288778365 55-59 24.075608493008804 27.22941481097877 27.622993267736923 21.071983428275505 60-64 23.776187512964114 28.09583074051027 27.16760008297034 20.96038166355528 65-69 24.210798243347973 28.168431929733917 27.553603719969 20.06716610694911 70-74 24.584768858949964 28.580243739394252 26.636499202961893 20.198488198693887 75-79 24.243204283360793 27.579283360790775 27.919069192751234 20.2584431630972 80-84 23.98907948282079 28.475763663524447 27.234327512491628 20.300829341163137 85-89 24.78167651519113 28.463107253046072 27.051194896198293 19.704021335564505 90-94 25.121154656552886 27.254530130636322 27.78655710071639 19.837758112094395 95-99 24.660797514241324 27.322630761263593 27.607457276022785 20.409114448472295 100-104 24.77291494632535 27.49793559042114 27.580511973575554 20.148637489677952 105-109 24.535719828255136 27.753349542186122 27.598158398427397 20.11277223113134 110-114 24.437998549673676 27.561379881902 27.644255671811873 20.356365896612452 115-119 25.32551078174052 27.893572127013535 27.116463383253564 19.664453707992383 120-124 24.443532670017436 28.177248948610114 27.838752692583856 19.540465688788593 125-129 25.492950418812754 27.94859788772697 27.241038447531345 19.317413245928932 130-134 25.062992548115588 28.081273789738916 27.303918940652977 19.551814721492523 135-139 25.05204338775063 28.15273364741974 27.15569190314452 19.63953106168511 140-144 25.725909825558713 27.05790558992365 27.637518809563616 19.578665774954022 145-149 25.883425384739127 27.422381897152665 27.572523995924712 19.121668722183497 150-151 25.785425628992307 26.919567201147178 27.493156042237 19.801851127623518 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 93.0 1 53.0 2 7.5 3 2.0 4 2.0 5 2.5 6 2.5 7 3.5 8 3.5 9 1.5 10 1.0 11 1.5 12 1.0 13 0.5 14 1.5 15 2.5 16 2.5 17 1.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 4.0 25 4.0 26 3.5 27 3.0 28 6.0 29 9.5 30 9.5 31 10.5 32 15.5 33 20.0 34 28.0 35 38.5 36 51.0 37 80.5 38 108.0 39 130.5 40 159.0 41 201.0 42 245.0 43 268.0 44 282.0 45 277.5 46 286.5 47 302.5 48 274.5 49 225.5 50 181.0 51 146.0 52 113.5 53 101.5 54 87.0 55 57.5 56 37.0 57 28.0 58 22.0 59 12.5 60 7.5 61 4.5 62 4.0 63 2.5 64 1.5 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.25 2 2.125 3 2.75 4 3.9 5 4.075 6 3.9 7 3.5000000000000004 8 3.5000000000000004 9 3.175 10-14 3.7249999999999996 15-19 3.9350000000000005 20-24 3.6900000000000004 25-29 3.26 30-34 3.175 35-39 3.56 40-44 3.94 45-49 3.9600000000000004 50-54 3.49 55-59 3.45 60-64 3.58 65-69 3.225 70-74 2.765 75-79 2.88 80-84 2.935 85-89 4.385 90-94 5.08 95-99 3.45 100-104 3.1199999999999997 105-109 3.345 110-114 3.47 115-119 2.8449999999999998 120-124 2.5100000000000002 125-129 3.895 130-134 6.734999999999999 135-139 8.73 140-144 10.285 145-149 6.755 150-151 4.1125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.025 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9065347565738 94.975 2 0.9372559229367352 1.7999999999999998 3 0.0 0.0 4 0.02603488674824265 0.1 5 0.0 0.0 6 0.02603488674824265 0.15 7 0.02603488674824265 0.17500000000000002 8 0.02603488674824265 0.2 9 0.0 0.0 >10 0.02603488674824265 0.475 >50 0.02603488674824265 2.125 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 85 2.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 19 0.475 Illumina Single End PCR Primer 1 (100% over 50bp) NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.3125 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.55 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 3.8375 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.925000000000001 0.0 0.0 0.0 0.0 128-129 5.2125 0.0 0.0 0.0 0.0 130-131 5.725 0.0 0.0 0.0 0.0 132-133 6.2125 0.0 0.0 0.0 0.0 134-135 6.612500000000001 0.0 0.0 0.0 0.0 136-137 7.112500000000001 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCACT 10 0.0068264604 144.9342 6 >>END_MODULE Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861526 spots for SRR7169945.sra Written 861526 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra Read 861525 spots for SRR7169945.sra Written 861525 spots for SRR7169945.sra SRR ids: ['SRR7169945.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7db3vjut SRR7169945.sra spots: 17230501 blocks: [[1, 861525], [861526, 1723050], [1723051, 2584575], [2584576, 3446100], [3446101, 4307625], [4307626, 5169150], [5169151, 6030675], [6030676, 6892200], [6892201, 7753725], [7753726, 8615250], [8615251, 9476775], [9476776, 10338300], [10338301, 11199825], [11199826, 12061350], [12061351, 12922875], [12922876, 13784400], [13784401, 14645925], [14645926, 15507450], [15507451, 16368975], [16368976, 17230501]] SRR7169945 file size 5817151 SRR7169945 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169945 SRR7169945_1.fastq SRR7169945_2.fastq Input file: SRR7169945_1.fastq Paired file: SRR7169945_2.fastq trimmed: SRR7169945-trimmed-pair1.fastq, SRR7169945-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:53:50 2025 >> started Wed Feb 12 04:54:09 2025 >> done (18.669s) 17230501 read pairs processed; of these: 35964 ( 0.21%) short read pairs filtered out after trimming by size control 96281 ( 0.56%) empty read pairs filtered out after trimming by size control 17098256 (99.23%) read pairs available; of these: 7999656 (46.79%) trimmed read pairs available after processing 9098600 (53.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 8 0.00% 21 8 0.00% 22 9 0.00% 23 9 0.00% 24 14 0.00% 25 13 0.00% 26 9 0.00% 27 13 0.00% 28 28 0.00% 29 14 0.00% 30 29 0.00% 31 23 0.00% 32 27 0.00% 33 33 0.00% 34 29 0.00% 35 29 0.00% 36 35 0.00% 37 44 0.00% 38 36 0.00% 39 53 0.00% 40 55 0.00% 41 52 0.00% 42 67 0.00% 43 66 0.00% 44 68 0.00% 45 82 0.00% 46 101 0.00% 47 114 0.00% 48 128 0.00% 49 152 0.00% 50 188 0.00% 51 186 0.00% 52 214 0.00% 53 244 0.00% 54 253 0.00% 55 255 0.00% 56 288 0.00% 57 317 0.00% 58 384 0.00% 59 391 0.00% 60 443 0.00% 61 504 0.00% 62 613 0.00% 63 630 0.00% 64 721 0.00% 65 862 0.01% 66 1048 0.01% 67 1272 0.01% 68 1692 0.01% 69 2658 0.02% 70 5000 0.03% 71 3377 0.02% 72 2680 0.02% 73 2481 0.01% 74 2622 0.02% 75 2641 0.02% 76 2882 0.02% 77 3176 0.02% 78 3504 0.02% 79 3751 0.02% 80 4117 0.02% 81 4685 0.03% 82 5393 0.03% 83 5962 0.03% 84 8152 0.05% 85 9801 0.06% 86 10191 0.06% 87 10955 0.06% 88 11524 0.07% 89 11528 0.07% 90 12239 0.07% 91 13334 0.08% 92 13994 0.08% 93 15234 0.09% 94 15892 0.09% 95 17561 0.10% 96 18308 0.11% 97 18653 0.11% 98 19152 0.11% 99 19749 0.12% 100 20589 0.12% 101 21736 0.13% 102 23330 0.14% 103 24300 0.14% 104 25595 0.15% 105 26689 0.16% 106 27826 0.16% 107 28903 0.17% 108 29914 0.17% 109 30456 0.18% 110 30969 0.18% 111 32196 0.19% 112 33570 0.20% 113 35560 0.21% 114 36841 0.22% 115 38166 0.22% 116 39192 0.23% 117 40532 0.24% 118 41191 0.24% 119 41896 0.25% 120 43035 0.25% 121 43998 0.26% 122 44966 0.26% 123 47109 0.28% 124 49414 0.29% 125 51486 0.30% 126 52990 0.31% 127 54808 0.32% 128 56349 0.33% 129 58090 0.34% 130 59392 0.35% 131 60913 0.36% 132 63862 0.37% 133 66684 0.39% 134 70489 0.41% 135 73365 0.43% 136 77357 0.45% 137 82033 0.48% 138 88049 0.51% 139 92722 0.54% 140 98021 0.57% 141 104459 0.61% 142 113933 0.67% 143 123264 0.72% 144 136703 0.80% 145 155200 0.91% 146 187251 1.10% 147 241075 1.41% 148 336106 1.97% 149 637660 3.73% 150 3706362 21.68% 151 9098600 53.21% 17098256 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=34 prefix-density=0.23 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=130.23 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=42 prefix-density=0.18 prefix-fanout=2.4 sequence=ATTGAATGGCCAGTTCAGATGGATTTCTTCTCAGATGAACCGCGTGAGGAATGGAGAGCTCTACCGTTACATTTGTGATACCAAGGGAGCTTTCGTGCAGCCTGCTTTGTATGAGGCTTTTGGATTGACTGTTGTTGAGGCCATGACATGTGGTTTGCCAACCTTTGCTACTTGCAATGGTGGTCCTGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=200.23 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=10.4 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169945 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:54:52 Started mapping on | Feb 12 04:54:53 Finished on | Feb 12 04:56:26 Mapping speed, Million of reads per hour | 661.87 Number of input reads | 17098256 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16227631 Uniquely mapped reads % | 94.91% Average mapped length | 292.05 Number of splices: Total | 14390573 Number of splices: Annotated (sjdb) | 14134835 Number of splices: GT/AG | 14178167 Number of splices: GC/AG | 169139 Number of splices: AT/AC | 12121 Number of splices: Non-canonical | 31146 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285897 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 29802 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 615688 615688 615688 N_multimapping 285897 285897 285897 N_noFeature 322880 16003544 427585 N_ambiguous 186880 1435 66384 UnstrandedReadsAssigned:15717871 PositiveStrandReadsAssigned:222652 NegativeStrandReadsAssigned:15733662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169945 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169945-trimmed-pair1.fastq SRR7169945-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,098,256 reads, 15,671,446 reads pseudoaligned [quant] estimated average fragment length: 224.858 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,047 rounds 52401 SRR7169945.ke.tsv 34699 SRR7169945.se.tsv 87100 total ==> SRR7169945.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.14 268 8.3853 Potri.005G024800.1.v4.1 1035 811.142 74 5.12125 Potri.004G059700.1.v4.1 961 737.148 5 0.380764 Potri.007G009000.2.v4.1 1416 1192.14 0 0 Potri.003G141000.2.v4.1 2943 2719.14 331.042 6.83426 Potri.016G087400.1.v4.1 270 84.4358 1807.87 1201.94 Potri.015G069301.1.v4.1 564 342.459 0 0 Potri.010G195200.1.v4.1 1773 1549.14 33 1.19581 Potri.012G127500.1.v4.1 977 753.148 5275 393.172 ==> SRR7169945.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1007 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 297 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169945 completed mapping pipeline successfully