Starting /dee2/code/volunteer_pipeline.sh SRR7169946 current disk space = 3049146183680 free memory = 1497244808 SRR7169946 SRAfilesize 8163b2105939902c04af87bb1b17e6f1 SRR7169946.sra SRR7169946.sra file validated SRR7169946 is paired end SRR7169946 is conventional basespace SRR7169946 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169946_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.1325 34.0 34.0 34.0 33.0 34.0 2 33.5225 34.0 34.0 34.0 33.0 34.0 3 33.57225 34.0 34.0 34.0 33.0 34.0 4 33.59575 34.0 34.0 34.0 33.0 34.0 5 33.635 34.0 34.0 34.0 33.0 34.0 6 37.28675 38.0 38.0 38.0 36.0 38.0 7 37.55275 38.0 38.0 38.0 37.0 38.0 8 37.669 38.0 38.0 38.0 38.0 38.0 9 37.68125 38.0 38.0 38.0 38.0 38.0 10-14 37.6346 38.0 38.0 38.0 38.0 38.0 15-19 37.648250000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5783 38.0 38.0 38.0 38.0 38.0 25-29 37.5295 38.0 38.0 38.0 38.0 38.0 30-34 37.51965 38.0 38.0 38.0 38.0 38.0 35-39 37.462450000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.35725 38.0 38.0 38.0 37.0 38.0 45-49 37.2975 38.0 38.0 38.0 37.0 38.0 50-54 37.304950000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.254549999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.2192 38.0 38.0 38.0 37.0 38.0 65-69 37.13075 38.0 38.0 38.0 36.6 38.0 70-74 37.04774999999999 38.0 38.0 38.0 36.2 38.0 75-79 36.8336 38.0 38.0 38.0 36.0 38.0 80-84 36.753299999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.6646 38.0 38.0 38.0 35.6 38.0 90-94 36.483000000000004 38.0 38.0 38.0 35.2 38.0 95-99 36.328250000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.3312 38.0 38.0 38.0 34.2 38.0 105-109 36.290949999999995 38.0 38.0 38.0 34.0 38.0 110-114 36.06295 38.0 38.0 38.0 33.8 38.0 115-119 35.84595 38.0 37.4 38.0 33.2 38.0 120-124 35.6995 38.0 37.0 38.0 32.6 38.0 125-129 35.4067 38.0 36.8 38.0 31.0 38.0 130-134 35.1198 38.0 36.2 38.0 29.4 38.0 135-139 34.77354999999999 38.0 36.0 38.0 28.0 38.0 140-144 34.48165 38.0 35.4 38.0 26.6 38.0 145-149 33.841300000000004 38.0 35.0 38.0 22.8 38.0 150-151 30.68475 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 2.0 12 2.0 13 2.0 14 1.0 15 3.0 16 6.0 17 5.0 18 12.0 19 12.0 20 5.0 21 5.0 22 7.0 23 7.0 24 10.0 25 14.0 26 16.0 27 17.0 28 23.0 29 19.0 30 26.0 31 45.0 32 54.0 33 93.0 34 127.0 35 197.0 36 517.0 37 2770.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.20532319391635 14.017743979721168 11.609632446134349 32.167300380228134 2 22.2 17.275 30.099999999999998 30.425 3 20.4 19.525000000000002 25.650000000000002 34.425 4 21.575 27.224999999999998 23.375 27.825 5 22.7 30.3 23.674999999999997 23.325000000000003 6 20.0 33.375 26.8 19.825 7 14.875 30.349999999999998 36.925000000000004 17.849999999999998 8 16.45 29.799999999999997 30.625000000000004 23.125 9 17.125 26.825 34.050000000000004 22.0 10-14 19.045 31.240000000000002 27.325 22.39 15-19 18.2 30.470000000000002 27.939999999999998 23.39 20-24 19.03 30.34 27.815 22.814999999999998 25-29 19.62 30.44 26.729999999999997 23.21 30-34 19.189999999999998 29.799999999999997 27.165 23.845 35-39 19.259999999999998 29.799999999999997 27.644999999999996 23.294999999999998 40-44 19.8 29.849999999999998 27.675 22.675 45-49 19.505851755526656 29.758927678303493 27.153145943783137 23.582074622386717 50-54 19.115 29.544999999999998 27.495000000000005 23.845 55-59 19.585 29.525000000000002 27.400000000000002 23.49 60-64 18.865000000000002 29.645 27.544999999999998 23.945 65-69 18.82 29.565 27.455000000000002 24.16 70-74 19.03 29.7 27.515 23.755000000000003 75-79 19.580000000000002 29.330000000000002 27.334999999999997 23.755000000000003 80-84 19.665 29.115000000000002 27.644999999999996 23.575 85-89 19.753766077773886 28.622191081527454 27.115759971973375 24.50828286872529 90-94 19.66644898779324 28.819008389008893 27.301954086502235 24.212588536695634 95-99 19.3903173965448 28.92728003214142 27.40056247488951 24.28184009642427 100-104 19.654913728432106 29.41235308827207 26.726681670417605 24.20605151287822 105-109 20.08600430021501 29.33646682334117 26.56632831641582 24.011200560028 110-114 20.555 29.520000000000003 26.584999999999997 23.34 115-119 20.09401880376075 28.465693138627724 27.010402080416085 24.42988597719544 120-124 20.005 29.044999999999998 26.534999999999997 24.415 125-129 20.655 28.449999999999996 27.565 23.330000000000002 130-134 20.58352517265539 28.470623561205084 27.02432188970073 23.921529376438794 135-139 20.37993083053481 29.016089419076742 26.45982657510902 24.144153175279435 140-144 20.582495120852727 28.339088224991244 26.54256117700045 24.535855477155582 145-149 20.444644734865555 28.72164638726153 26.197987081267836 24.63572179660508 150-151 20.3 28.7 25.55 25.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.5 2 1.5 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.0 22 1.0 23 1.5 24 3.0 25 5.5 26 9.0 27 10.0 28 18.0 29 26.0 30 26.5 31 38.0 32 55.0 33 65.0 34 77.0 35 96.0 36 111.0 37 129.5 38 146.5 39 147.0 40 170.5 41 205.0 42 234.0 43 258.5 44 246.5 45 243.5 46 262.5 47 255.5 48 206.5 49 173.5 50 163.0 51 137.5 52 111.0 53 89.5 54 71.5 55 51.0 56 37.5 57 30.5 58 23.0 59 14.5 60 7.5 61 4.0 62 4.0 63 3.5 64 4.0 65 3.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.095 90-94 0.46499999999999997 95-99 0.44 100-104 0.025 105-109 0.005 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.0 130-134 0.09 135-139 0.245 140-144 0.08499999999999999 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.15620998719591 95.825 2 1.6645326504481435 3.25 3 0.12804097311139565 0.375 4 0.02560819462227913 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02560819462227913 0.44999999999999996 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTATACATCTCGTATGC 18 0.44999999999999996 TruSeq Adapter, Index 2 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.85 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.125 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.5375 0.0 0.0 0.0 0.0 112-113 2.7874999999999996 0.0 0.0 0.0 0.0 114-115 3.25 0.0 0.0 0.0 0.0 116-117 3.625 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.875 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 5.8 0.0 0.0 0.0 0.0 128-129 6.300000000000001 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.1125 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 8.425 0.0 0.0 0.0 0.0 138-139 8.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTTA 10 0.006830828 145.0 1 >>END_MODULE SRR7169946 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169946_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.127 33.0 33.0 34.0 32.0 34.0 2 32.15175 34.0 33.0 34.0 32.0 34.0 3 32.14575 34.0 33.0 34.0 31.0 34.0 4 31.998 34.0 33.0 34.0 32.0 34.0 5 31.98925 34.0 33.0 34.0 32.0 34.0 6 35.94825 38.0 38.0 38.0 35.0 38.0 7 35.971 38.0 38.0 38.0 35.0 38.0 8 35.89925 38.0 38.0 38.0 36.0 38.0 9 35.786 38.0 38.0 38.0 34.0 38.0 10-14 35.75705 38.0 38.0 38.0 34.6 38.0 15-19 35.636700000000005 38.0 38.0 38.0 34.6 38.0 20-24 35.701049999999995 38.0 38.0 38.0 34.6 38.0 25-29 35.79195 38.0 38.0 38.0 35.2 38.0 30-34 35.8101 38.0 38.0 38.0 35.6 38.0 35-39 35.65945 38.0 38.0 38.0 34.8 38.0 40-44 35.53765 38.0 38.0 38.0 34.4 38.0 45-49 35.4211 38.0 38.0 38.0 33.6 38.0 50-54 35.66775 38.0 38.0 38.0 34.6 38.0 55-59 35.66455 38.0 38.0 38.0 34.6 38.0 60-64 35.60025 38.0 38.0 38.0 34.2 38.0 65-69 35.54325 38.0 38.0 38.0 34.0 38.0 70-74 35.42465 38.0 38.0 38.0 33.6 38.0 75-79 35.3503 38.0 38.0 38.0 33.0 38.0 80-84 35.28915000000001 38.0 38.0 38.0 32.8 38.0 85-89 34.7863 38.0 38.0 38.0 28.8 38.0 90-94 34.43245 38.0 38.0 38.0 25.6 38.0 95-99 34.8977 38.0 38.0 38.0 28.6 38.0 100-104 35.01855 38.0 38.0 38.0 30.6 38.0 105-109 34.9062 38.0 38.0 38.0 29.4 38.0 110-114 34.79065 38.0 38.0 38.0 28.4 38.0 115-119 34.703700000000005 38.0 38.0 38.0 28.4 38.0 120-124 34.4899 38.0 37.6 38.0 26.8 38.0 125-129 33.9548 38.0 36.4 38.0 18.8 38.0 130-134 32.959199999999996 38.0 35.8 38.0 8.8 38.0 135-139 32.16080000000001 38.0 34.6 38.0 2.0 38.0 140-144 31.28875 38.0 33.6 38.0 2.0 38.0 145-149 31.077349999999996 38.0 33.4 38.0 2.0 38.0 150-151 27.242375000000003 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 139.0 3 9.0 4 5.0 5 4.0 6 3.0 7 5.0 8 2.0 9 2.0 10 1.0 11 2.0 12 8.0 13 1.0 14 3.0 15 6.0 16 9.0 17 18.0 18 5.0 19 10.0 20 8.0 21 11.0 22 14.0 23 10.0 24 21.0 25 19.0 26 19.0 27 28.0 28 36.0 29 38.0 30 45.0 31 66.0 32 72.0 33 92.0 34 127.0 35 151.0 36 379.0 37 2632.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.02554278416348 20.20434227330779 16.551724137931036 23.218390804597703 2 24.701700939324702 29.499873064229497 27.367352119827366 18.43107387661843 3 22.714540361599187 29.946524064171122 29.080723198370258 18.258212375859433 4 25.21761392729135 33.61495135688684 23.015873015873016 18.151561699948797 5 26.10369609856263 35.1129363449692 21.842915811088297 16.940451745379878 6 22.196561457531434 37.028483448806774 23.19733128047216 17.577623813189632 7 21.52938157557095 22.73543751603798 36.900179625352834 18.835001283038235 8 23.017705927636644 27.9445727482679 26.63587374903772 22.401847575057737 9 22.65165088303046 26.61888917327873 28.436140261069877 22.29331968262094 10-14 24.64774246631698 28.59199835441736 25.50653090609894 21.25372827316672 15-19 24.645234532225604 27.69492749883895 27.25114815005934 20.408689818876102 20-24 24.773662551440328 28.575102880658438 26.872427983539094 19.77880658436214 25-29 23.83321366293979 27.777207918760897 27.643860908811156 20.745717509488152 30-34 23.734550489768704 28.211703164264833 27.114210985178726 20.939535360787733 35-39 24.153371075656203 27.030365414307774 27.987647967061246 20.82861554297478 40-44 24.576533774013633 28.031398471390208 26.84879157198926 20.5432761826069 45-49 24.092835728315933 28.057479582342605 27.395844102139975 20.453840587201487 50-54 24.252525770552335 28.18606082363198 27.083440176419305 20.47797322939638 55-59 24.7678177433424 27.384678536610394 27.26153214633896 20.585971573708246 60-64 23.256769950156723 28.261651508144492 27.634756692872926 20.846821848825854 65-69 23.69082422936862 28.337692978406935 27.99917936092732 19.97230343129712 70-74 24.235294117647058 28.368286445012785 27.074168797953963 20.322250639386187 75-79 24.330813240702902 27.406007355946056 28.04965263588067 20.213526767470373 80-84 24.10335124072653 28.37042721923766 27.42389357892044 20.102327961115375 85-89 23.895415323838236 28.308555982950413 27.851127975881067 19.944900717330285 90-94 23.69192130598577 27.239430724152363 28.683549602344076 20.38509836751779 95-99 24.36167480092474 27.77292576419214 28.507577703570515 19.35782173131261 100-104 24.40573770491803 27.607581967213115 28.048155737704917 19.938524590163933 105-109 24.08927655207799 28.17855310415598 27.829656233966137 19.9025141097999 110-114 24.39813151275602 28.45336481700118 27.26759406601304 19.880909604229764 115-119 24.111116795416176 27.743387732132806 28.47495779403489 19.670537678416125 120-124 24.63302752293578 27.81345565749235 28.068297655453616 19.48521916411825 125-129 25.002580245639383 27.954381257095672 27.82536897512643 19.217669522138507 130-134 24.89384288747346 27.579617834394902 28.444798301486202 19.081740976645438 135-139 24.657681940700808 27.53099730458221 28.62533692722372 19.18598382749326 140-144 25.250040990326283 27.62201453790239 27.993660162868228 19.134284308903098 145-149 25.65953606879346 27.867721216625085 27.19358777005149 19.279154944529964 150-151 25.855809128630707 26.789419087136928 28.021265560165975 19.33350622406639 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 40.0 2 7.0 3 4.5 4 4.0 5 1.0 6 0.5 7 2.0 8 1.5 9 0.5 10 1.0 11 1.0 12 2.5 13 3.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 3.0 26 4.0 27 6.0 28 6.0 29 9.0 30 14.5 31 17.5 32 20.5 33 27.0 34 38.0 35 51.0 36 71.5 37 89.5 38 100.5 39 127.5 40 172.0 41 215.0 42 248.5 43 269.0 44 288.0 45 299.0 46 298.0 47 277.0 48 245.5 49 215.0 50 174.0 51 133.0 52 105.0 53 95.5 54 78.0 55 55.5 56 37.0 57 23.5 58 19.0 59 13.5 60 10.0 61 10.0 62 7.5 63 5.0 64 2.5 65 2.0 66 1.5 67 0.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.125 2 1.525 3 1.825 4 2.35 5 2.6 6 2.5749999999999997 7 2.5749999999999997 8 2.5749999999999997 9 2.325 10-14 2.77 15-19 3.105 20-24 2.8000000000000003 25-29 2.5100000000000002 30-34 2.505 35-39 2.85 40-44 3.18 45-49 3.27 50-54 2.505 55-59 2.555 60-64 2.6950000000000003 65-69 2.5149999999999997 70-74 2.25 75-79 2.12 80-84 2.275 85-89 3.81 90-94 4.44 95-99 2.675 100-104 2.4 105-109 2.55 110-114 2.595 115-119 2.265 120-124 1.9 125-129 3.11 130-134 5.800000000000001 135-139 7.249999999999999 140-144 8.515 145-149 5.805 150-151 3.5999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.04941482444734 94.25 2 1.7685305591677505 3.4000000000000004 3 0.10403120936280884 0.3 4 0.02600780234070221 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02600780234070221 0.42500000000000004 >50 0.02600780234070221 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 61 1.525 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 17 0.42500000000000004 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.6875 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.6500000000000004 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.15 0.0 0.0 0.0 0.0 120-121 4.487500000000001 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.2875 0.0 0.0 0.0 0.0 126-127 5.7625 0.0 0.0 0.0 0.0 128-129 6.25 0.0 0.0 0.0 0.0 130-131 6.675 0.0 0.0 0.0 0.0 132-133 6.925000000000001 0.0 0.0 0.0 0.0 134-135 7.387499999999999 0.0 0.0 0.0 0.0 136-137 8.0625 0.0 0.0 0.0 0.0 138-139 8.662500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702634 spots for SRR7169946.sra Written 702634 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra Read 702631 spots for SRR7169946.sra Written 702631 spots for SRR7169946.sra SRR ids: ['SRR7169946.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w88i3kc4 SRR7169946.sra spots: 14052623 blocks: [[1, 702631], [702632, 1405262], [1405263, 2107893], [2107894, 2810524], [2810525, 3513155], [3513156, 4215786], [4215787, 4918417], [4918418, 5621048], [5621049, 6323679], [6323680, 7026310], [7026311, 7728941], [7728942, 8431572], [8431573, 9134203], [9134204, 9836834], [9836835, 10539465], [10539466, 11242096], [11242097, 11944727], [11944728, 12647358], [12647359, 13349989], [13349990, 14052623]] SRR7169946 file size 4740272 SRR7169946 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169946 SRR7169946_1.fastq SRR7169946_2.fastq Input file: SRR7169946_1.fastq Paired file: SRR7169946_2.fastq trimmed: SRR7169946-trimmed-pair1.fastq, SRR7169946-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:53:29 2025 >> started Wed Feb 12 04:53:45 2025 >> done (16.346s) 14052623 read pairs processed; of these: 61912 ( 0.44%) short read pairs filtered out after trimming by size control 134785 ( 0.96%) empty read pairs filtered out after trimming by size control 13855926 (98.60%) read pairs available; of these: 6537229 (47.18%) trimmed read pairs available after processing 7318697 (52.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 13 0.00% 21 18 0.00% 22 12 0.00% 23 23 0.00% 24 18 0.00% 25 23 0.00% 26 21 0.00% 27 26 0.00% 28 38 0.00% 29 31 0.00% 30 34 0.00% 31 36 0.00% 32 39 0.00% 33 37 0.00% 34 34 0.00% 35 39 0.00% 36 49 0.00% 37 40 0.00% 38 50 0.00% 39 50 0.00% 40 59 0.00% 41 66 0.00% 42 70 0.00% 43 78 0.00% 44 102 0.00% 45 121 0.00% 46 169 0.00% 47 138 0.00% 48 140 0.00% 49 173 0.00% 50 207 0.00% 51 193 0.00% 52 235 0.00% 53 219 0.00% 54 244 0.00% 55 268 0.00% 56 258 0.00% 57 305 0.00% 58 361 0.00% 59 334 0.00% 60 383 0.00% 61 395 0.00% 62 511 0.00% 63 639 0.00% 64 692 0.00% 65 1067 0.01% 66 1612 0.01% 67 1808 0.01% 68 1883 0.01% 69 3054 0.02% 70 6066 0.04% 71 4223 0.03% 72 2607 0.02% 73 2197 0.02% 74 2192 0.02% 75 2235 0.02% 76 2279 0.02% 77 2411 0.02% 78 2729 0.02% 79 2908 0.02% 80 3331 0.02% 81 3732 0.03% 82 4198 0.03% 83 4687 0.03% 84 7820 0.06% 85 9450 0.07% 86 10029 0.07% 87 10684 0.08% 88 11101 0.08% 89 11425 0.08% 90 11724 0.08% 91 12091 0.09% 92 12728 0.09% 93 13475 0.10% 94 14262 0.10% 95 15390 0.11% 96 16002 0.12% 97 16393 0.12% 98 17158 0.12% 99 17390 0.13% 100 18731 0.14% 101 19362 0.14% 102 20709 0.15% 103 21926 0.16% 104 22572 0.16% 105 24329 0.18% 106 25255 0.18% 107 25855 0.19% 108 26842 0.19% 109 27814 0.20% 110 28350 0.20% 111 29219 0.21% 112 30492 0.22% 113 32478 0.23% 114 33821 0.24% 115 34951 0.25% 116 36052 0.26% 117 36841 0.27% 118 37073 0.27% 119 37138 0.27% 120 38569 0.28% 121 39261 0.28% 122 40751 0.29% 123 42410 0.31% 124 44045 0.32% 125 45365 0.33% 126 47777 0.34% 127 48386 0.35% 128 50190 0.36% 129 51463 0.37% 130 52532 0.38% 131 52894 0.38% 132 56005 0.40% 133 58006 0.42% 134 60955 0.44% 135 63081 0.46% 136 66667 0.48% 137 70534 0.51% 138 74184 0.54% 139 79252 0.57% 140 82289 0.59% 141 88172 0.64% 142 94682 0.68% 143 101577 0.73% 144 116115 0.84% 145 126661 0.91% 146 148035 1.07% 147 192745 1.39% 148 289007 2.09% 149 517078 3.73% 150 2859383 20.64% 151 7318697 52.82% 13855926 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=38 prefix-density=0.34 prefix-fanout=1.9 sequence=GTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCCTAATTAATGTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=45.92 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.2 sequence=TCCATTCAAAAAGCTAGATAATTTACACACATAAATTAACACCACAATACCAAATTCACATATGATAGATAGAGAAGCCAAAGTTCAAACAAGGATAGAAGAAGTTGTGAGATGGTGTGATTCTTGAAAGGGCGAACGAAATTAAGCTCTGCTCTTGAAAGGAATGGCTCTAATGACTATCTGGTGGTAGACAGCGGCAAGAGCAGCTCCAATGAATGGGCCAACCCAGAAGATCCAGTGGTCATCCCATGCATGGTCTTTGTTGAAGATGATGGCGGCTCCAAGACTCCTTGCCGGGTTAATGCCAGTTCCAGTTATGGGGATGGTAGCCAAATGAACCAAGAAGACTGCAAATCCAATGGGAAGGGGAGCCAAAATAGGGACATGAGAGTCTCTAGCGTTTCTCTTGGCATCAGTAGCAGAGAAGACAGTGTAGACAAGAACAAAGGTACCGACTATCTCCGCACCAAGGCCATCACCCTTGGTGTATCCATGATTCACAACAT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.08 fanout-score-rank=33 prefix-density=0.20 prefix-fanout=2.6 sequence=TACCAGGATGCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=139.09 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=10.0 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169946 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:54:31 Started mapping on | Feb 12 04:54:31 Finished on | Feb 12 04:56:46 Mapping speed, Million of reads per hour | 369.49 Number of input reads | 13855926 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12704495 Uniquely mapped reads % | 91.69% Average mapped length | 291.11 Number of splices: Total | 10550328 Number of splices: Annotated (sjdb) | 10342878 Number of splices: GT/AG | 10396787 Number of splices: GC/AG | 119189 Number of splices: AT/AC | 9488 Number of splices: Non-canonical | 24864 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245837 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 29598 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.26% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 952439 952439 952439 N_multimapping 245837 245837 245837 N_noFeature 285163 12509414 363159 N_ambiguous 169723 973 52001 UnstrandedReadsAssigned:12249609 PositiveStrandReadsAssigned:194108 NegativeStrandReadsAssigned:12289335 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169946 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169946-trimmed-pair1.fastq SRR7169946-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,855,926 reads, 12,322,223 reads pseudoaligned [quant] estimated average fragment length: 220.717 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52401 SRR7169946.ke.tsv 34699 SRR7169946.se.tsv 87100 total ==> SRR7169946.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.28 229 9.00171 Potri.005G024800.1.v4.1 1035 815.283 30 2.60112 Potri.004G059700.1.v4.1 961 741.298 5 0.476787 Potri.007G009000.2.v4.1 1416 1196.28 0 0 Potri.003G141000.2.v4.1 2943 2723.28 149.024 3.86822 Potri.016G087400.1.v4.1 270 86.1775 1541.38 1264.34 Potri.015G069301.1.v4.1 564 346.394 0 0 Potri.010G195200.1.v4.1 1773 1553.28 16 0.728144 Potri.012G127500.1.v4.1 977 757.298 3654 341.075 ==> SRR7169946.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1153 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169946 completed mapping pipeline successfully