Starting /dee2/code/volunteer_pipeline.sh SRR7169947 current disk space = 3049037131776 free memory = 1579067308 SRR7169947 SRAfilesize 93c017b4a68bbf83bae9bc8e7d23d41e SRR7169947.sra SRR7169947.sra file validated SRR7169947 is paired end SRR7169947 is conventional basespace SRR7169947 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86175 34.0 33.0 34.0 33.0 34.0 2 33.37725 34.0 34.0 34.0 33.0 34.0 3 33.528 34.0 34.0 34.0 33.0 34.0 4 33.5485 34.0 34.0 34.0 33.0 34.0 5 33.407 34.0 34.0 34.0 33.0 34.0 6 37.25825 38.0 38.0 38.0 36.0 38.0 7 37.52475 38.0 38.0 38.0 37.0 38.0 8 37.644 38.0 38.0 38.0 38.0 38.0 9 37.646 38.0 38.0 38.0 38.0 38.0 10-14 37.61585 38.0 38.0 38.0 38.0 38.0 15-19 37.6234 38.0 38.0 38.0 38.0 38.0 20-24 37.5339 38.0 38.0 38.0 38.0 38.0 25-29 37.481950000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.473400000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.3725 38.0 38.0 38.0 37.4 38.0 40-44 37.27830000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.157 38.0 38.0 38.0 36.8 38.0 50-54 37.1425 38.0 38.0 38.0 36.6 38.0 55-59 37.0695 38.0 38.0 38.0 36.2 38.0 60-64 37.0399 38.0 38.0 38.0 36.0 38.0 65-69 37.0632 38.0 38.0 38.0 36.0 38.0 70-74 36.9302 38.0 38.0 38.0 36.0 38.0 75-79 36.605999999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.5563 38.0 38.0 38.0 34.6 38.0 85-89 36.43415 38.0 38.0 38.0 34.0 38.0 90-94 36.25925 38.0 38.0 38.0 34.2 38.0 95-99 36.1374 38.0 38.0 38.0 33.6 38.0 100-104 35.95205 38.0 37.6 38.0 32.8 38.0 105-109 35.84935 38.0 37.6 38.0 32.6 38.0 110-114 35.67295 38.0 37.2 38.0 31.8 38.0 115-119 35.5669 38.0 37.0 38.0 30.8 38.0 120-124 35.62165 38.0 37.0 38.0 31.0 38.0 125-129 35.3993 38.0 36.6 38.0 30.4 38.0 130-134 34.6742 38.0 36.0 38.0 26.4 38.0 135-139 34.07105 38.0 35.0 38.0 22.6 38.0 140-144 34.05905 38.0 35.0 38.0 23.0 38.0 145-149 33.44835 38.0 34.4 38.0 19.4 38.0 150-151 29.304875000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 2.0 14 4.0 15 0.0 16 4.0 17 9.0 18 11.0 19 5.0 20 4.0 21 7.0 22 5.0 23 7.0 24 15.0 25 27.0 26 24.0 27 36.0 28 29.0 29 36.0 30 41.0 31 63.0 32 72.0 33 104.0 34 127.0 35 222.0 36 537.0 37 2607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.47844937515939 14.18005610813568 8.237694465697526 33.1038000510074 2 24.75 14.424999999999999 29.7 31.125000000000004 3 19.575 17.45 26.0 36.975 4 22.25 25.324999999999996 24.65 27.775 5 22.650000000000002 29.349999999999998 24.25 23.75 6 21.15 32.875 23.925 22.05 7 15.7 28.249999999999996 38.4 17.65 8 17.05 27.625 30.5 24.825 9 16.475 28.525 32.2 22.8 10-14 19.555 30.525000000000002 27.235 22.685 15-19 19.38 29.615000000000002 26.740000000000002 24.265 20-24 19.49 29.459999999999997 27.310000000000002 23.74 25-29 19.655 29.5 26.85 23.995 30-34 19.77 29.360000000000003 27.525 23.345 35-39 19.6 28.76 26.915 24.725 40-44 19.6 29.635 27.04 23.724999999999998 45-49 19.84293717486995 29.546818727490997 26.965786314525808 23.644457783113246 50-54 19.400000000000002 28.860000000000003 27.22 24.52 55-59 19.994999999999997 28.57 27.045 24.39 60-64 20.4 28.58 26.974999999999998 24.044999999999998 65-69 20.165 28.910000000000004 26.465 24.46 70-74 20.31 28.595 27.1 23.995 75-79 19.89 29.015 26.950000000000003 24.145 80-84 20.26 28.34 27.125 24.275 85-89 20.401421492567195 28.46989338805746 26.858201111166725 24.27048400820862 90-94 20.683236063594286 27.96337291205474 26.98229019923526 24.371100825115718 95-99 20.469984400946007 27.80153977758768 27.721028531172948 24.007447290293364 100-104 20.587499374468297 28.118901065906023 26.557573937847167 24.736025621778513 105-109 20.331016550827542 27.87139356967848 27.411370568528426 24.386219310965547 110-114 20.79 28.305000000000003 26.51 24.395 115-119 20.916045802290114 27.956397819890995 27.11135556777839 24.016200810040502 120-124 20.985 28.005000000000003 26.345000000000002 24.665 125-129 21.514302860572116 27.265453090618124 27.50550110022004 23.714742948589716 130-134 20.88379541587429 27.48974076669002 27.209488539685715 24.416975277749977 135-139 21.172867399708792 27.96605914545363 26.39955816639052 24.461515288447057 140-144 20.819573701591114 27.429200440308215 27.44921445011508 24.302011407985592 145-149 21.72346494520342 27.738577791122452 26.337386778761946 24.200570484912177 150-151 20.2875 27.825 27.474999999999998 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.5 22 1.0 23 1.0 24 3.5 25 6.0 26 7.0 27 9.5 28 13.5 29 13.5 30 22.0 31 35.5 32 36.5 33 38.5 34 56.0 35 71.0 36 79.0 37 92.5 38 117.5 39 150.5 40 177.0 41 187.5 42 208.0 43 245.0 44 263.5 45 265.0 46 263.5 47 240.5 48 229.0 49 222.5 50 191.0 51 158.5 52 130.0 53 106.5 54 90.0 55 73.5 56 44.0 57 32.0 58 29.0 59 20.0 60 14.5 61 13.0 62 8.5 63 4.5 64 5.0 65 3.5 66 3.5 67 3.0 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.105 90-94 0.62 95-99 0.635 100-104 0.08499999999999999 105-109 0.005 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.02 130-134 0.09 135-139 0.415 140-144 0.06999999999999999 145-149 0.08499999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09067946451124 98.075 2 0.8588027279616064 1.7000000000000002 3 0.0 0.0 4 0.025258903763576663 0.1 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0125 0.0 0.0 0.0 42-43 0.1 0.025 0.0 0.0 0.0 44-45 0.1 0.025 0.0 0.0 0.0 46-47 0.1 0.025 0.0 0.0 0.0 48-49 0.1 0.025 0.0 0.0 0.0 50-51 0.1 0.025 0.0 0.0 0.0 52-53 0.1 0.025 0.0 0.0 0.0 54-55 0.1 0.025 0.0 0.0 0.0 56-57 0.1 0.025 0.0 0.0 0.0 58-59 0.1 0.025 0.0 0.0 0.0 60-61 0.1 0.025 0.0 0.0 0.0 62-63 0.1 0.025 0.0 0.0 0.0 64-65 0.1 0.025 0.0 0.0 0.0 66-67 0.1125 0.025 0.0 0.0 0.0 68-69 0.125 0.025 0.0 0.0 0.0 70-71 0.125 0.025 0.0 0.0 0.0 72-73 0.125 0.025 0.0 0.0 0.0 74-75 0.1375 0.025 0.0 0.0 0.0 76-77 0.15 0.025 0.0 0.0 0.0 78-79 0.175 0.025 0.0 0.0 0.0 80-81 0.2125 0.025 0.0 0.0 0.0 82-83 0.3125 0.025 0.0 0.0 0.0 84-85 0.325 0.025 0.0 0.0 0.0 86-87 0.4125 0.025 0.0 0.0 0.0 88-89 0.5875 0.025 0.0 0.025 0.0 90-91 0.725 0.025 0.0 0.025 0.0 92-93 0.825 0.025 0.0 0.025 0.0 94-95 0.925 0.025 0.0 0.025 0.0 96-97 1.0625 0.025 0.0 0.025 0.0 98-99 1.25 0.025 0.0 0.025 0.0 100-101 1.5125 0.025 0.0 0.025 0.0 102-103 1.825 0.025 0.0 0.025 0.0 104-105 2.1624999999999996 0.025 0.0 0.025 0.0 106-107 2.575 0.025 0.0 0.025 0.0 108-109 2.9625000000000004 0.025 0.0 0.025 0.0 110-111 3.375 0.025 0.0 0.025 0.0 112-113 3.825 0.025 0.0 0.025 0.0 114-115 4.237500000000001 0.025 0.0 0.025 0.0 116-117 4.7125 0.025 0.0 0.025 0.0 118-119 5.1375 0.025 0.0 0.025 0.0 120-121 5.6375 0.025 0.0 0.025 0.0 122-123 6.1625 0.025 0.0 0.025 0.0 124-125 6.7375 0.025 0.0 0.025 0.0 126-127 7.4 0.025 0.0 0.025 0.0 128-129 7.9125 0.025 0.0 0.025 0.0 130-131 8.575 0.025 0.0 0.025 0.0 132-133 9.087499999999999 0.025 0.0 0.025 0.0 134-135 9.7125 0.025 0.0 0.025 0.0 136-137 10.3125 0.025 0.0 0.025 0.0 138-139 11.0 0.025 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCGAT 30 0.0014561843 24.13125 140-144 ACCGATG 30 0.0014561843 24.13125 140-144 CAGTCAC 35 0.0035668064 20.68393 9 CCAGTCA 40 0.007720061 18.098438 135-139 AACTCCA 50 0.0013429631 17.374498 130-134 GAACTCC 55 0.0025408247 15.795 130-134 >>END_MODULE SRR7169947 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169947_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.74275 33.0 33.0 34.0 31.0 34.0 2 32.0735 34.0 33.0 34.0 31.0 34.0 3 32.08575 34.0 33.0 34.0 32.0 34.0 4 31.90575 34.0 33.0 34.0 32.0 34.0 5 31.86775 34.0 33.0 34.0 32.0 34.0 6 35.89525 38.0 38.0 38.0 35.0 38.0 7 35.98 38.0 38.0 38.0 35.0 38.0 8 35.92425 38.0 38.0 38.0 35.0 38.0 9 35.957 38.0 38.0 38.0 35.0 38.0 10-14 35.94135 38.0 38.0 38.0 35.6 38.0 15-19 35.858000000000004 38.0 38.0 38.0 35.4 38.0 20-24 35.87985 38.0 38.0 38.0 35.4 38.0 25-29 36.0452 38.0 38.0 38.0 36.0 38.0 30-34 36.04455 38.0 38.0 38.0 36.0 38.0 35-39 35.99380000000001 38.0 38.0 38.0 36.0 38.0 40-44 35.855599999999995 38.0 38.0 38.0 35.4 38.0 45-49 35.758449999999996 38.0 38.0 38.0 35.0 38.0 50-54 35.88185 38.0 38.0 38.0 35.4 38.0 55-59 35.8337 38.0 38.0 38.0 35.0 38.0 60-64 35.8075 38.0 38.0 38.0 34.6 38.0 65-69 35.791450000000005 38.0 38.0 38.0 34.8 38.0 70-74 35.727599999999995 38.0 38.0 38.0 34.4 38.0 75-79 35.68315 38.0 38.0 38.0 34.0 38.0 80-84 35.669149999999995 38.0 38.0 38.0 34.0 38.0 85-89 35.3119 38.0 38.0 38.0 33.0 38.0 90-94 34.9879 38.0 38.0 38.0 29.4 38.0 95-99 35.2286 38.0 38.0 38.0 30.8 38.0 100-104 35.2981 38.0 38.0 38.0 32.2 38.0 105-109 35.213 38.0 38.0 38.0 31.4 38.0 110-114 35.09185 38.0 38.0 38.0 31.0 38.0 115-119 34.869350000000004 38.0 37.8 38.0 28.4 38.0 120-124 34.71255 38.0 37.4 38.0 27.6 38.0 125-129 34.3147 38.0 36.6 38.0 24.6 38.0 130-134 33.2787 38.0 35.8 38.0 13.8 38.0 135-139 32.35445 38.0 35.0 38.0 4.2 38.0 140-144 31.668650000000003 38.0 34.0 38.0 2.0 38.0 145-149 30.943150000000003 38.0 33.0 38.0 2.0 38.0 150-151 27.463 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 127.0 3 4.0 4 1.0 5 2.0 6 3.0 7 1.0 8 1.0 9 2.0 10 4.0 11 5.0 12 2.0 13 7.0 14 4.0 15 3.0 16 5.0 17 12.0 18 7.0 19 9.0 20 8.0 21 4.0 22 10.0 23 15.0 24 14.0 25 22.0 26 21.0 27 25.0 28 30.0 29 41.0 30 39.0 31 60.0 32 91.0 33 114.0 34 132.0 35 155.0 36 382.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.52724442138038 22.28853139595226 12.558380902957966 22.625843279709393 2 28.868594622019277 28.488077118214107 26.48401826484018 16.15930999492643 3 21.63682864450128 29.769820971867006 28.797953964194374 19.79539641943734 4 24.670627744768794 32.704727460604495 23.663136140532163 18.96150865409455 5 25.330225330225332 34.654234654234656 21.96322196322196 18.052318052318054 6 22.428940568475454 35.76227390180878 23.488372093023255 18.320413436692505 7 21.200412158681093 22.153529108706852 37.635239567233384 19.01081916537867 8 22.926326635754766 25.6053580628542 26.841834106130865 24.626481195260176 9 21.575166752180603 27.244740892765524 28.501795792714212 22.67829656233966 10-14 24.4621020587173 28.62597389195604 25.323770703266085 21.588153346060572 15-19 24.600424145243885 28.671183985930792 25.981482439352405 20.74690942947292 20-24 24.49674821926293 28.64147826984619 26.370393310622486 20.4913802002684 25-29 24.112235983349606 28.105246929441392 26.337427411480547 21.445089675728454 30-34 23.999178813385342 28.218025046191748 27.094025867378363 20.68877027304455 35-39 23.957957648513574 28.316760265856043 27.136895254778707 20.588386830851665 40-44 24.169856211854764 28.27143891589945 26.83355746353574 20.725147408710047 45-49 24.273451235908574 27.577826041989866 27.008997828110452 21.139724893991104 50-54 24.038906901343214 28.264114044567958 26.426843703360607 21.270135350728218 55-59 24.570340640115262 27.98703303488731 26.659462797159616 20.78316352783781 60-64 24.783505154639176 28.02061855670103 26.50515463917526 20.690721649484537 65-69 24.194791185082448 27.7443879385627 27.08686495094262 20.973955925412234 70-74 24.49355432780847 27.844280744833235 26.764886433394718 20.89727849396358 75-79 24.088188654151107 28.07304721469129 27.19320681364776 20.645557317509848 80-84 24.61711827075757 27.87481432156943 27.096245454079803 20.411821953593197 85-89 24.357576701448373 27.835747287546077 27.238747858589008 20.567928152416552 90-94 24.567636762631277 28.14671612936935 27.232352787501956 20.053294320497415 95-99 24.307771487390635 27.52444673185795 27.46268656716418 20.705095213587235 100-104 24.311008468052346 27.92404413651527 27.108031819348216 20.656915576084167 105-109 25.089992800575956 27.512084747505916 26.828139463128664 20.569782988789466 110-114 24.443643107356277 27.622089429219038 28.126931794766126 19.807335668658563 115-119 25.410380976732295 27.05701866530299 27.455893633341855 20.07670672462286 120-124 25.492993630573245 27.271337579617832 27.35796178343949 19.877707006369427 125-129 26.117282355980365 27.424438129682255 26.912942392146732 19.54533712219065 130-134 25.704150783566288 28.208386277001267 26.334180432020332 19.753282507412116 135-139 25.757084144494918 27.81743456629894 26.876487129569544 19.5489941596366 140-144 26.506354075372478 27.333479404031554 26.840490797546014 19.319675723049954 145-149 26.414594049954925 27.363843665482314 26.478230895688604 19.743331388874157 150-151 26.05487962723272 27.388040383121925 26.947967900595394 19.609112089049958 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 69.0 1 40.0 2 9.5 3 5.5 4 1.5 5 1.0 6 2.5 7 2.5 8 1.5 9 1.0 10 1.0 11 2.0 12 1.5 13 1.5 14 2.0 15 2.0 16 3.5 17 2.5 18 2.0 19 2.0 20 2.0 21 2.0 22 1.0 23 0.5 24 1.0 25 1.0 26 1.0 27 2.0 28 2.5 29 5.0 30 7.5 31 9.0 32 11.5 33 20.0 34 27.5 35 37.0 36 57.5 37 71.0 38 90.0 39 134.0 40 175.5 41 215.5 42 245.0 43 259.5 44 284.0 45 286.5 46 260.5 47 270.0 48 271.5 49 231.5 50 191.5 51 160.0 52 140.5 53 109.0 54 80.5 55 57.5 56 39.0 57 32.0 58 25.5 59 18.0 60 8.5 61 7.5 62 8.0 63 4.0 64 3.5 65 4.0 66 2.5 67 1.0 68 1.5 69 1.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.65 2 1.4500000000000002 3 2.25 4 3.225 5 3.4750000000000005 6 3.25 7 2.9499999999999997 8 2.9499999999999997 9 2.55 10-14 3.0949999999999998 15-19 3.335 20-24 3.1300000000000003 25-29 2.705 30-34 2.58 35-39 2.955 40-44 3.3300000000000005 45-49 3.3099999999999996 50-54 2.8449999999999998 55-59 2.83 60-64 3.0 65-69 2.665 70-74 2.26 75-79 2.255 80-84 2.385 85-89 3.685 90-94 4.305 95-99 2.85 100-104 2.5749999999999997 105-109 2.77 110-114 2.94 115-119 2.225 120-124 1.875 125-129 3.225 130-134 5.56 135-139 7.539999999999999 140-144 8.72 145-149 5.715 150-151 3.4250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.07168643630737 96.05 2 0.7220216606498195 1.4000000000000001 3 0.07735946364105209 0.22499999999999998 4 0.0257864878803507 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0257864878803507 0.22499999999999998 >10 0.0515729757607014 0.5499999999999999 >50 0.0257864878803507 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 58 1.4500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.4 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.237500000000001 0.0 0.0 0.0 0.0 116-117 4.7125 0.0 0.0 0.0 0.0 118-119 5.1 0.0 0.0 0.0 0.0 120-121 5.55 0.0 0.0 0.0 0.0 122-123 6.0625 0.0 0.0 0.0 0.0 124-125 6.625 0.0 0.0 0.0 0.0 126-127 7.199999999999999 0.0 0.0 0.0 0.0 128-129 7.6125 0.0 0.0 0.0 0.0 130-131 8.25 0.0 0.0 0.0 0.0 132-133 8.7625 0.0 0.0 0.0 0.0 134-135 9.3125 0.0 0.0 0.0 0.0 136-137 9.825 0.0 0.0 0.0 0.0 138-139 10.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAAA 10 0.006968985 143.96104 4 >>END_MODULE Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra Read 731933 spots for SRR7169947.sra Written 731933 spots for SRR7169947.sra SRR ids: ['SRR7169947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kmhmmgm_ SRR7169947.sra spots: 14638660 blocks: [[1, 731933], [731934, 1463866], [1463867, 2195799], [2195800, 2927732], [2927733, 3659665], [3659666, 4391598], [4391599, 5123531], [5123532, 5855464], [5855465, 6587397], [6587398, 7319330], [7319331, 8051263], [8051264, 8783196], [8783197, 9515129], [9515130, 10247062], [10247063, 10978995], [10978996, 11710928], [11710929, 12442861], [12442862, 13174794], [13174795, 13906727], [13906728, 14638660]] SRR7169947 file size 4938861 SRR7169947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169947 SRR7169947_1.fastq SRR7169947_2.fastq Input file: SRR7169947_1.fastq Paired file: SRR7169947_2.fastq trimmed: SRR7169947-trimmed-pair1.fastq, SRR7169947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:02:12 2025 >> started Wed Feb 12 05:02:28 2025 >> done (15.368s) 14638660 read pairs processed; of these: 26901 ( 0.18%) short read pairs filtered out after trimming by size control 72310 ( 0.49%) empty read pairs filtered out after trimming by size control 14539449 (99.32%) read pairs available; of these: 6922082 (47.61%) trimmed read pairs available after processing 7617367 (52.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 10 0.00% 21 13 0.00% 22 15 0.00% 23 11 0.00% 24 12 0.00% 25 9 0.00% 26 9 0.00% 27 19 0.00% 28 12 0.00% 29 21 0.00% 30 12 0.00% 31 23 0.00% 32 14 0.00% 33 23 0.00% 34 16 0.00% 35 35 0.00% 36 37 0.00% 37 57 0.00% 38 36 0.00% 39 48 0.00% 40 48 0.00% 41 61 0.00% 42 76 0.00% 43 52 0.00% 44 71 0.00% 45 83 0.00% 46 99 0.00% 47 103 0.00% 48 129 0.00% 49 140 0.00% 50 184 0.00% 51 206 0.00% 52 216 0.00% 53 201 0.00% 54 234 0.00% 55 263 0.00% 56 295 0.00% 57 304 0.00% 58 387 0.00% 59 381 0.00% 60 435 0.00% 61 508 0.00% 62 587 0.00% 63 749 0.01% 64 717 0.00% 65 914 0.01% 66 1107 0.01% 67 1181 0.01% 68 1386 0.01% 69 1747 0.01% 70 3300 0.02% 71 2333 0.02% 72 2074 0.01% 73 2134 0.01% 74 2324 0.02% 75 2548 0.02% 76 2748 0.02% 77 3106 0.02% 78 3397 0.02% 79 3817 0.03% 80 4100 0.03% 81 4784 0.03% 82 5344 0.04% 83 5990 0.04% 84 7695 0.05% 85 9101 0.06% 86 9960 0.07% 87 10392 0.07% 88 11361 0.08% 89 11816 0.08% 90 12137 0.08% 91 12870 0.09% 92 13875 0.10% 93 14719 0.10% 94 15925 0.11% 95 17171 0.12% 96 17890 0.12% 97 18964 0.13% 98 19478 0.13% 99 20253 0.14% 100 21372 0.15% 101 22164 0.15% 102 23528 0.16% 103 24311 0.17% 104 25628 0.18% 105 27238 0.19% 106 28316 0.19% 107 29077 0.20% 108 29808 0.21% 109 31279 0.22% 110 31656 0.22% 111 32754 0.23% 112 33671 0.23% 113 35776 0.25% 114 36720 0.25% 115 38547 0.27% 116 38879 0.27% 117 41256 0.28% 118 41498 0.29% 119 42350 0.29% 120 43057 0.30% 121 44065 0.30% 122 45113 0.31% 123 47219 0.32% 124 48304 0.33% 125 49874 0.34% 126 51596 0.35% 127 53197 0.37% 128 54785 0.38% 129 56012 0.39% 130 57338 0.39% 131 59157 0.41% 132 60843 0.42% 133 63301 0.44% 134 66161 0.46% 135 69318 0.48% 136 71934 0.49% 137 75746 0.52% 138 81032 0.56% 139 84934 0.58% 140 90253 0.62% 141 95614 0.66% 142 101576 0.70% 143 108719 0.75% 144 119570 0.82% 145 135087 0.93% 146 158898 1.09% 147 200047 1.38% 148 274456 1.89% 149 511445 3.52% 150 3022680 20.79% 151 7617367 52.39% 14539449 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=105.17 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=15.3 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACACTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=19.85 fanout-score-rank=9 prefix-density=0.46 prefix-fanout=7.7 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGA criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=159.84 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=10.3 sequence=GAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCC SRR7169947 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:03:13 Started mapping on | Feb 12 05:03:13 Finished on | Feb 12 05:04:34 Mapping speed, Million of reads per hour | 646.20 Number of input reads | 14539449 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13685437 Uniquely mapped reads % | 94.13% Average mapped length | 290.91 Number of splices: Total | 12150070 Number of splices: Annotated (sjdb) | 11933947 Number of splices: GT/AG | 11966897 Number of splices: GC/AG | 145622 Number of splices: AT/AC | 10093 Number of splices: Non-canonical | 27458 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268321 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 23879 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.82% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 608868 608868 608868 N_multimapping 268321 268321 268321 N_noFeature 250291 13508325 337114 N_ambiguous 144589 745 53903 UnstrandedReadsAssigned:13290557 PositiveStrandReadsAssigned:176367 NegativeStrandReadsAssigned:13294420 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169947 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169947-trimmed-pair1.fastq SRR7169947-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,539,449 reads, 13,258,697 reads pseudoaligned [quant] estimated average fragment length: 218.876 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,012 rounds 52401 SRR7169947.ke.tsv 34699 SRR7169947.se.tsv 87100 total ==> SRR7169947.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.12 211 7.52825 Potri.005G024800.1.v4.1 1035 817.124 46 3.61563 Potri.004G059700.1.v4.1 961 743.13 4 0.345708 Potri.007G009000.2.v4.1 1416 1198.12 0 0 Potri.003G141000.2.v4.1 2943 2725.12 219 5.16145 Potri.016G087400.1.v4.1 270 88.4822 1632.51 1184.99 Potri.015G069301.1.v4.1 564 348.438 0 0 Potri.010G195200.1.v4.1 1773 1555.12 12 0.495599 Potri.012G127500.1.v4.1 977 759.13 7473 632.256 ==> SRR7169947.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1016 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169947 completed mapping pipeline successfully