Starting /dee2/code/volunteer_pipeline.sh SRR7169948 current disk space = 3049186525184 free memory = 1490249128 SRR7169948 SRAfilesize 3bc583e09a56a803a39524e6a9f74207 SRR7169948.sra SRR7169948.sra file validated SRR7169948 is paired end SRR7169948 is conventional basespace SRR7169948 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169948_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.951 34.0 33.0 34.0 33.0 34.0 2 33.437 34.0 34.0 34.0 33.0 34.0 3 33.464 34.0 34.0 34.0 33.0 34.0 4 33.571 34.0 34.0 34.0 33.0 34.0 5 33.52625 34.0 34.0 34.0 33.0 34.0 6 37.34875 38.0 38.0 38.0 37.0 38.0 7 37.588 38.0 38.0 38.0 37.0 38.0 8 37.6035 38.0 38.0 38.0 38.0 38.0 9 37.66125 38.0 38.0 38.0 38.0 38.0 10-14 37.63615 38.0 38.0 38.0 38.0 38.0 15-19 37.6476 38.0 38.0 38.0 38.0 38.0 20-24 37.59155 38.0 38.0 38.0 38.0 38.0 25-29 37.564099999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.5543 38.0 38.0 38.0 38.0 38.0 35-39 37.506249999999994 38.0 38.0 38.0 38.0 38.0 40-44 37.35450000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.2858 38.0 38.0 38.0 37.0 38.0 50-54 37.22800000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.16160000000001 38.0 38.0 38.0 36.8 38.0 60-64 37.160000000000004 38.0 38.0 38.0 36.8 38.0 65-69 37.05754999999999 38.0 38.0 38.0 36.2 38.0 70-74 37.0024 38.0 38.0 38.0 36.0 38.0 75-79 36.75019999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.67985 38.0 38.0 38.0 35.6 38.0 85-89 36.5937 38.0 38.0 38.0 35.0 38.0 90-94 36.562599999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.47095 38.0 38.0 38.0 34.6 38.0 100-104 36.256150000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.11195 38.0 38.0 38.0 33.8 38.0 110-114 35.834950000000006 38.0 37.6 38.0 32.6 38.0 115-119 35.77845000000001 38.0 37.6 38.0 32.4 38.0 120-124 35.5677 38.0 37.0 38.0 31.0 38.0 125-129 35.162800000000004 38.0 36.4 38.0 29.0 38.0 130-134 34.87265 38.0 36.0 38.0 27.8 38.0 135-139 34.453100000000006 38.0 35.0 38.0 25.2 38.0 140-144 34.29855 38.0 35.2 38.0 24.4 38.0 145-149 33.46945 38.0 35.0 38.0 16.8 38.0 150-151 30.057375 35.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 3.0 14 3.0 15 3.0 16 5.0 17 4.0 18 9.0 19 12.0 20 6.0 21 6.0 22 10.0 23 13.0 24 10.0 25 11.0 26 12.0 27 29.0 28 17.0 29 35.0 30 33.0 31 51.0 32 64.0 33 77.0 34 128.0 35 209.0 36 518.0 37 2726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.57971014492754 13.119755911517924 10.526315789473683 35.774218154080856 2 23.200000000000003 15.6 32.525 28.675 3 19.5 20.7 26.85 32.95 4 22.55 27.1 23.925 26.424999999999997 5 23.425 31.624999999999996 22.675 22.275 6 20.375 33.775 24.925 20.925 7 15.55 26.674999999999997 38.4 19.375 8 17.825 26.674999999999997 29.15 26.35 9 19.075 25.75 32.675 22.5 10-14 20.04 29.575000000000003 26.51 23.875 15-19 20.02 28.925 26.96 24.095 20-24 20.200000000000003 28.939999999999998 27.279999999999998 23.580000000000002 25-29 20.095 29.03 27.445000000000004 23.43 30-34 20.26 28.645 27.229999999999997 23.865 35-39 20.36 28.465 26.77 24.404999999999998 40-44 19.74 28.675 27.375 24.21 45-49 20.474999999999998 28.439999999999998 27.235 23.849999999999998 50-54 19.915 28.52 27.41 24.154999999999998 55-59 20.375 27.99 27.474999999999998 24.16 60-64 20.69 28.425 26.96 23.925 65-69 20.25 28.965000000000003 26.790000000000003 23.995 70-74 20.79 27.889999999999997 27.339999999999996 23.98 75-79 20.69 27.889999999999997 27.435 23.985 80-84 20.14 28.38 27.005000000000003 24.474999999999998 85-89 21.224999999999998 27.665 26.979999999999997 24.13 90-94 20.669999999999998 27.61 27.12 24.6 95-99 20.745 27.139999999999997 27.450000000000003 24.665 100-104 20.8 27.744999999999997 27.365000000000002 24.09 105-109 21.46 27.435 26.985 24.12 110-114 20.4 27.93 27.13 24.54 115-119 21.54 27.93 27.13 23.400000000000002 120-124 21.33 27.79 26.735 24.145 125-129 21.38 27.900000000000002 26.6 24.12 130-134 21.834999999999997 28.265 25.935000000000002 23.965 135-139 21.435000000000002 28.075 26.045 24.445 140-144 21.23 28.54 25.845000000000002 24.385 145-149 22.3 27.785 26.185000000000002 23.73 150-151 21.125 28.249999999999996 25.5375 25.087500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.5 24 2.0 25 1.5 26 2.0 27 2.5 28 8.0 29 13.0 30 20.5 31 23.0 32 24.0 33 36.0 34 55.0 35 63.0 36 76.0 37 100.5 38 108.5 39 122.5 40 158.5 41 188.0 42 228.0 43 271.0 44 276.0 45 258.0 46 249.0 47 254.5 48 241.0 49 226.0 50 204.5 51 161.0 52 129.5 53 113.0 54 99.0 55 77.5 56 51.0 57 38.5 58 31.5 59 19.5 60 11.0 61 11.5 62 12.0 63 9.0 64 6.0 65 1.5 66 1.5 67 3.0 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4949494949495 98.5 2 0.45454545454545453 0.8999999999999999 3 0.025252525252525252 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGTGGATCTCGTATGC 21 0.525 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.775 0.0 0.0 0.0 0.0 92-93 0.8375 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1375 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.525 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.7374999999999998 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.1375 0.0 0.0 0.0 0.0 120-121 4.512499999999999 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.275 0.0 0.0 0.0 0.0 134-135 7.975 0.0 0.0 0.0 0.0 136-137 8.5625 0.0 0.0 0.0 0.0 138-139 9.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCGTG 10 0.006832588 144.9875 8 GTGGCCA 10 0.006832588 144.9875 7 >>END_MODULE SRR7169948 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169948_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.68375 33.0 33.0 34.0 31.0 34.0 2 32.21825 34.0 33.0 34.0 31.0 34.0 3 32.28325 34.0 33.0 34.0 32.0 34.0 4 32.115 34.0 33.0 34.0 32.0 34.0 5 32.05375 34.0 33.0 34.0 32.0 34.0 6 36.31425 38.0 38.0 38.0 36.0 38.0 7 36.26175 38.0 38.0 38.0 36.0 38.0 8 36.30025 38.0 38.0 38.0 36.0 38.0 9 36.28475 38.0 38.0 38.0 36.0 38.0 10-14 36.26174999999999 38.0 38.0 38.0 36.0 38.0 15-19 36.0332 38.0 38.0 38.0 35.0 38.0 20-24 36.226099999999995 38.0 38.0 38.0 36.0 38.0 25-29 36.28845 38.0 38.0 38.0 36.2 38.0 30-34 36.33945 38.0 38.0 38.0 36.4 38.0 35-39 36.16695 38.0 38.0 38.0 36.0 38.0 40-44 36.0444 38.0 38.0 38.0 35.8 38.0 45-49 35.8642 38.0 38.0 38.0 34.8 38.0 50-54 36.1025 38.0 38.0 38.0 35.8 38.0 55-59 36.091950000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.00795 38.0 38.0 38.0 35.4 38.0 65-69 35.960249999999995 38.0 38.0 38.0 34.8 38.0 70-74 35.89045 38.0 38.0 38.0 34.8 38.0 75-79 35.72474999999999 38.0 38.0 38.0 34.0 38.0 80-84 35.704350000000005 38.0 38.0 38.0 34.0 38.0 85-89 35.3317 38.0 38.0 38.0 32.6 38.0 90-94 34.901199999999996 38.0 38.0 38.0 29.4 38.0 95-99 35.246500000000005 38.0 38.0 38.0 30.8 38.0 100-104 35.29905 38.0 38.0 38.0 31.4 38.0 105-109 35.225100000000005 38.0 38.0 38.0 31.0 38.0 110-114 34.8809 38.0 38.0 38.0 29.0 38.0 115-119 34.750350000000005 38.0 37.4 38.0 28.2 38.0 120-124 34.49115 38.0 37.0 38.0 26.0 38.0 125-129 34.11115 38.0 36.2 38.0 21.8 38.0 130-134 32.9526 38.0 35.6 38.0 9.2 38.0 135-139 31.76175 38.0 34.2 38.0 2.0 38.0 140-144 30.803449999999998 38.0 33.0 38.0 2.0 38.0 145-149 30.435000000000002 38.0 31.4 38.0 2.0 38.0 150-151 26.765 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 89.0 3 8.0 4 4.0 5 6.0 6 4.0 7 4.0 8 2.0 9 1.0 10 0.0 11 2.0 12 0.0 13 4.0 14 10.0 15 4.0 16 9.0 17 21.0 18 11.0 19 11.0 20 12.0 21 15.0 22 10.0 23 16.0 24 15.0 25 17.0 26 24.0 27 26.0 28 34.0 29 45.0 30 67.0 31 53.0 32 92.0 33 120.0 34 127.0 35 179.0 36 456.0 37 2502.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.633411275656016 20.706677058976357 16.23798389191998 24.42192777344765 2 27.657430730478588 27.304785894206553 28.211586901763226 16.82619647355164 3 21.332657714720042 28.50266024828984 29.46541677223207 20.699265264758044 4 24.8402760030667 33.9125990288781 22.10580117556862 19.141323792486585 5 25.481633701515538 34.75468790136142 21.217569997431287 18.546108399691754 6 22.400611620795107 36.493374108053004 22.655453618756372 18.450560652395513 7 21.215215726321166 21.72581056931325 37.426601991319885 19.6323717130457 8 23.300229182582125 26.636108989050168 26.636108989050168 23.427552839317546 9 23.086702262903636 25.222476481057715 28.782100177981185 22.90872107805746 10-14 23.980607297780047 27.59887726460832 26.282214850727225 22.13830058688441 15-19 24.256257693885924 27.405621665982764 26.92860073861305 21.40951990151826 20-24 23.88128320392317 28.008786268900693 26.660196158561504 21.44973436861463 25-29 23.911604460512244 27.847650084016497 27.07877183155965 21.161973623911603 30-34 23.78504910691568 27.947687140603534 27.057147218971046 21.210116533509744 35-39 24.097062579821202 27.780332056194123 26.901660280970624 21.220945083014048 40-44 24.74089276552078 27.752693689071318 25.93637762955362 21.570035915854284 45-49 24.129954248702 27.486762967151595 26.86475093815864 21.518531845987766 50-54 24.071428571428573 27.862244897959183 27.158163265306122 20.908163265306122 55-59 23.923029808084934 27.521437321355656 27.842997141690486 20.712535728868925 60-64 23.55466952921331 27.935388232888613 27.14818790574043 21.361754332157645 65-69 23.612173115155223 27.72085436101341 27.36911862160371 21.297853902227658 70-74 24.461710339224048 27.6863700995328 27.3664432256754 20.485476335567743 75-79 24.467869450638556 27.706263936752485 27.037299817555237 20.78856679505372 80-84 23.883712641922507 28.073926989460823 26.719617127437502 21.322743241179165 85-89 24.907235621521338 27.293341579055863 26.911976911976907 20.88744588744589 90-94 24.398107222713328 27.268472778326657 27.476470282356612 20.856949716603403 95-99 23.62959563510275 27.606955280199884 28.009790423741777 20.753658660955587 100-104 24.178284318713747 28.4369593975781 26.844408262949017 20.540348020759133 105-109 24.923500611995102 27.172582619339046 27.41738066095471 20.48653610771114 110-114 24.714906673485043 27.42009716185119 26.58655075428279 21.27844541038098 115-119 24.762533651648297 28.145476710519635 27.10418042362981 19.987809214202265 120-124 24.908906882591094 27.216599190283404 26.902834008097166 20.97165991902834 125-129 25.329571685047448 27.576301615798922 26.97614773018723 20.1179789689664 130-134 25.55045144939015 28.354189767147158 26.184064628544274 19.911294154918423 135-139 24.95806957744955 28.096088297354328 26.748904398636586 20.19693772655954 140-144 25.59951709378258 27.98661032760797 26.559841957965208 19.85403062064424 145-149 26.141407736207988 27.938068061720568 26.236525047558658 19.683999154512787 150-151 26.36047857969896 27.05519104592821 27.338222050688284 19.24610832368455 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 42.0 1 28.0 2 7.0 3 1.5 4 1.5 5 2.0 6 2.5 7 1.5 8 1.0 9 0.5 10 1.5 11 1.5 12 1.0 13 1.0 14 1.0 15 2.0 16 1.5 17 1.0 18 2.0 19 2.0 20 1.5 21 0.5 22 0.5 23 1.5 24 2.0 25 2.0 26 2.5 27 2.5 28 4.0 29 5.5 30 7.5 31 9.0 32 11.0 33 19.0 34 29.0 35 40.0 36 49.5 37 71.0 38 105.0 39 144.0 40 168.5 41 195.5 42 238.5 43 263.5 44 294.0 45 294.0 46 279.0 47 270.0 48 245.5 49 220.5 50 190.0 51 165.0 52 143.0 53 121.0 54 95.5 55 61.0 56 38.0 57 33.0 58 27.5 59 19.0 60 12.5 61 9.0 62 6.5 63 5.5 64 4.0 65 2.5 66 3.0 67 4.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.775 2 0.75 3 1.325 4 2.175 5 2.675 6 1.9 7 2.075 8 1.825 9 1.675 10-14 2.025 15-19 2.52 20-24 2.12 25-29 1.805 30-34 1.745 35-39 2.125 40-44 2.55 45-49 2.735 50-54 2.0 55-59 2.04 60-64 2.185 65-69 1.915 70-74 1.54 75-79 1.34 80-84 1.7950000000000002 85-89 2.98 90-94 3.8449999999999998 95-99 1.9449999999999998 100-104 1.73 105-109 1.96 110-114 2.225 115-119 1.5650000000000002 120-124 1.2 125-129 2.5250000000000004 130-134 5.305 135-139 7.585 140-144 8.885 145-149 5.38 150-151 2.8375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46387541485831 97.39999999999999 2 0.33188664794485573 0.65 3 0.051059484299208584 0.15 4 0.025529742149604292 0.1 5 0.025529742149604292 0.125 6 0.0 0.0 7 0.025529742149604292 0.17500000000000002 8 0.025529742149604292 0.2 9 0.0 0.0 >10 0.051059484299208584 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 30 0.75 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 18 0.44999999999999996 Illumina Single End PCR Primer 1 (100% over 50bp) NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.5499999999999998 0.0 0.0 0.0 0.0 102-103 1.6749999999999998 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.4124999999999996 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.125 0.0 0.0 0.0 0.0 114-115 3.3375 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.4125 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.6875 0.0 0.0 0.0 0.0 128-129 6.225 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.074999999999999 0.0 0.0 0.0 0.0 134-135 7.737500000000001 0.0 0.0 0.0 0.0 136-137 8.3 0.0 0.0 0.0 0.0 138-139 9.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGAGAA 10 0.0057699527 153.23288 145 CTAAGAA 10 0.0070528793 143.41026 3 TAAGAAA 10 0.0070528793 143.41026 4 >>END_MODULE Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823152 spots for SRR7169948.sra Written 823152 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra Read 823146 spots for SRR7169948.sra Written 823146 spots for SRR7169948.sra SRR ids: ['SRR7169948.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_auk8xujr SRR7169948.sra spots: 16462926 blocks: [[1, 823146], [823147, 1646292], [1646293, 2469438], [2469439, 3292584], [3292585, 4115730], [4115731, 4938876], [4938877, 5762022], [5762023, 6585168], [6585169, 7408314], [7408315, 8231460], [8231461, 9054606], [9054607, 9877752], [9877753, 10700898], [10700899, 11524044], [11524045, 12347190], [12347191, 13170336], [13170337, 13993482], [13993483, 14816628], [14816629, 15639774], [15639775, 16462926]] SRR7169948 file size 5557045 SRR7169948 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169948 SRR7169948_1.fastq SRR7169948_2.fastq Input file: SRR7169948_1.fastq Paired file: SRR7169948_2.fastq trimmed: SRR7169948-trimmed-pair1.fastq, SRR7169948-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:28:52 2025 >> started Wed Feb 12 04:29:09 2025 >> done (17.102s) 16462926 read pairs processed; of these: 31027 ( 0.19%) short read pairs filtered out after trimming by size control 108325 ( 0.66%) empty read pairs filtered out after trimming by size control 16323574 (99.15%) read pairs available; of these: 7645648 (46.84%) trimmed read pairs available after processing 8677926 (53.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 4 0.00% 20 7 0.00% 21 9 0.00% 22 9 0.00% 23 10 0.00% 24 11 0.00% 25 12 0.00% 26 15 0.00% 27 10 0.00% 28 12 0.00% 29 12 0.00% 30 30 0.00% 31 24 0.00% 32 24 0.00% 33 25 0.00% 34 30 0.00% 35 21 0.00% 36 35 0.00% 37 24 0.00% 38 37 0.00% 39 46 0.00% 40 47 0.00% 41 59 0.00% 42 61 0.00% 43 66 0.00% 44 71 0.00% 45 99 0.00% 46 121 0.00% 47 131 0.00% 48 145 0.00% 49 164 0.00% 50 195 0.00% 51 195 0.00% 52 241 0.00% 53 261 0.00% 54 220 0.00% 55 241 0.00% 56 312 0.00% 57 317 0.00% 58 371 0.00% 59 434 0.00% 60 487 0.00% 61 520 0.00% 62 615 0.00% 63 725 0.00% 64 770 0.00% 65 855 0.01% 66 939 0.01% 67 1190 0.01% 68 1403 0.01% 69 2203 0.01% 70 3594 0.02% 71 2337 0.01% 72 1977 0.01% 73 2262 0.01% 74 2452 0.02% 75 2601 0.02% 76 2775 0.02% 77 2979 0.02% 78 3443 0.02% 79 3689 0.02% 80 4008 0.02% 81 4667 0.03% 82 5403 0.03% 83 6131 0.04% 84 7885 0.05% 85 9242 0.06% 86 9701 0.06% 87 10144 0.06% 88 10717 0.07% 89 11086 0.07% 90 12069 0.07% 91 12752 0.08% 92 13638 0.08% 93 15114 0.09% 94 16311 0.10% 95 17446 0.11% 96 18304 0.11% 97 18726 0.11% 98 19424 0.12% 99 19823 0.12% 100 20902 0.13% 101 22027 0.13% 102 23838 0.15% 103 25315 0.16% 104 27103 0.17% 105 28407 0.17% 106 29319 0.18% 107 29625 0.18% 108 30229 0.19% 109 31136 0.19% 110 31726 0.19% 111 33359 0.20% 112 35081 0.21% 113 37577 0.23% 114 39065 0.24% 115 40759 0.25% 116 41825 0.26% 117 42967 0.26% 118 43032 0.26% 119 43526 0.27% 120 44607 0.27% 121 45993 0.28% 122 47655 0.29% 123 49809 0.31% 124 52610 0.32% 125 54263 0.33% 126 56490 0.35% 127 57385 0.35% 128 59007 0.36% 129 59790 0.37% 130 61398 0.38% 131 63039 0.39% 132 65831 0.40% 133 69583 0.43% 134 72275 0.44% 135 77119 0.47% 136 80142 0.49% 137 83945 0.51% 138 89794 0.55% 139 94258 0.58% 140 97917 0.60% 141 105253 0.64% 142 113055 0.69% 143 121448 0.74% 144 133626 0.82% 145 151521 0.93% 146 177966 1.09% 147 223132 1.37% 148 314249 1.93% 149 587813 3.60% 150 3393282 20.79% 151 8677926 53.16% 16323574 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=38 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=25.96 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=6.7 sequence=ATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.25 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=111.09 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=13.2 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGATGCCAAGGAGAAGAAGGGACTACTCGAGAAGATCAAGGAGA SRR7169948 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:30:14 Started mapping on | Feb 12 04:30:14 Finished on | Feb 12 04:31:58 Mapping speed, Million of reads per hour | 565.05 Number of input reads | 16323574 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15209990 Uniquely mapped reads % | 93.18% Average mapped length | 291.35 Number of splices: Total | 14104289 Number of splices: Annotated (sjdb) | 13869980 Number of splices: GT/AG | 13902160 Number of splices: GC/AG | 162102 Number of splices: AT/AC | 12134 Number of splices: Non-canonical | 27893 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279460 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 21979 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.94% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 858497 858497 858497 N_multimapping 279460 279460 279460 N_noFeature 255751 15032486 333236 N_ambiguous 158396 910 57781 UnstrandedReadsAssigned:14795843 PositiveStrandReadsAssigned:176594 NegativeStrandReadsAssigned:14818973 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169948 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169948-trimmed-pair1.fastq SRR7169948-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,323,574 reads, 14,766,483 reads pseudoaligned [quant] estimated average fragment length: 223.354 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7169948.ke.tsv 34699 SRR7169948.se.tsv 87100 total ==> SRR7169948.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.65 244 8.40293 Potri.005G024800.1.v4.1 1035 812.646 25 1.90239 Potri.004G059700.1.v4.1 961 738.681 12 1.00458 Potri.007G009000.2.v4.1 1416 1193.65 0 0 Potri.003G141000.2.v4.1 2943 2720.65 241.029 5.47846 Potri.016G087400.1.v4.1 270 88.391 1818 1271.88 Potri.015G069301.1.v4.1 564 344.958 0 0 Potri.010G195200.1.v4.1 1773 1550.65 15 0.598192 Potri.012G127500.1.v4.1 977 754.676 7130 584.239 ==> SRR7169948.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 914 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169948 completed mapping pipeline successfully