Starting /dee2/code/volunteer_pipeline.sh SRR7169949 current disk space = 3049204686848 free memory = 1485515736 SRR7169949 SRAfilesize b74493c525eff6a277c3ecb9f6cdaec9 SRR7169949.sra SRR7169949.sra file validated SRR7169949 is paired end SRR7169949 is conventional basespace SRR7169949 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169949_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0405 34.0 34.0 34.0 33.0 34.0 2 33.49375 34.0 34.0 34.0 33.0 34.0 3 33.605 34.0 34.0 34.0 33.0 34.0 4 33.63175 34.0 34.0 34.0 33.0 34.0 5 33.65475 34.0 34.0 34.0 33.0 34.0 6 37.27975 38.0 38.0 38.0 37.0 38.0 7 37.5595 38.0 38.0 38.0 37.0 38.0 8 37.56975 38.0 38.0 38.0 38.0 38.0 9 37.65825 38.0 38.0 38.0 38.0 38.0 10-14 37.633500000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.64915 38.0 38.0 38.0 38.0 38.0 20-24 37.5826 38.0 38.0 38.0 38.0 38.0 25-29 37.53235 38.0 38.0 38.0 38.0 38.0 30-34 37.50475 38.0 38.0 38.0 38.0 38.0 35-39 37.486000000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.36905 38.0 38.0 38.0 37.2 38.0 45-49 37.2992 38.0 38.0 38.0 37.0 38.0 50-54 37.2943 38.0 38.0 38.0 37.0 38.0 55-59 37.18075 38.0 38.0 38.0 36.8 38.0 60-64 37.2376 38.0 38.0 38.0 37.0 38.0 65-69 37.21325 38.0 38.0 38.0 37.0 38.0 70-74 37.12420000000001 38.0 38.0 38.0 36.2 38.0 75-79 36.9328 38.0 38.0 38.0 36.0 38.0 80-84 36.81045 38.0 38.0 38.0 35.8 38.0 85-89 36.7147 38.0 38.0 38.0 35.8 38.0 90-94 36.49905 38.0 38.0 38.0 35.4 38.0 95-99 36.32325 38.0 38.0 38.0 34.0 38.0 100-104 36.43874999999999 38.0 38.0 38.0 34.4 38.0 105-109 36.3824 38.0 38.0 38.0 34.2 38.0 110-114 36.2118 38.0 38.0 38.0 34.0 38.0 115-119 35.951350000000005 38.0 38.0 38.0 33.2 38.0 120-124 35.8754 38.0 37.4 38.0 33.0 38.0 125-129 35.5278 38.0 37.0 38.0 31.0 38.0 130-134 35.146699999999996 38.0 36.0 38.0 29.4 38.0 135-139 34.78395 38.0 35.8 38.0 27.8 38.0 140-144 34.4463 38.0 35.2 38.0 26.8 38.0 145-149 33.8585 38.0 35.0 38.0 23.4 38.0 150-151 30.854125000000003 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 2.0 13 1.0 14 2.0 15 2.0 16 3.0 17 4.0 18 5.0 19 11.0 20 5.0 21 3.0 22 8.0 23 7.0 24 12.0 25 11.0 26 16.0 27 26.0 28 26.0 29 36.0 30 33.0 31 44.0 32 55.0 33 68.0 34 112.0 35 191.0 36 512.0 37 2800.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.437308868501525 14.984709480122325 11.034658511722732 32.54332313965341 2 23.5 15.25 32.5 28.749999999999996 3 18.85 20.875 27.0 33.275 4 20.95 27.400000000000002 23.974999999999998 27.675 5 21.349999999999998 32.6 23.549999999999997 22.5 6 19.225 34.75 25.5 20.525 7 15.325 28.475 38.45 17.75 8 17.849999999999998 26.424999999999997 31.35 24.375 9 17.525 25.724999999999998 32.6 24.15 10-14 19.455 31.185000000000002 26.995 22.365 15-19 19.040000000000003 29.815 27.860000000000003 23.285 20-24 19.62 29.915000000000003 27.224999999999998 23.24 25-29 18.82 30.25 27.575 23.355 30-34 19.085 29.580000000000002 27.725 23.61 35-39 19.555 29.18 27.63 23.635 40-44 19.040000000000003 29.580000000000002 27.465 23.915 45-49 19.49779911964786 29.286714685874347 27.32092837134854 23.89455782312925 50-54 19.285 29.49 27.325 23.9 55-59 19.53 29.21 27.04 24.22 60-64 19.155 29.104999999999997 28.425 23.315 65-69 19.63 29.92 26.889999999999997 23.56 70-74 19.794999999999998 29.299999999999997 27.54 23.365 75-79 19.73 28.999999999999996 27.815 23.455000000000002 80-84 19.830000000000002 28.999999999999996 26.83 24.34 85-89 19.914829659318638 29.41382765531062 27.18937875751503 23.481963927855713 90-94 20.22375648843421 28.942196240487828 26.81046212770247 24.0235851433755 95-99 19.557660335533274 28.84780089677062 27.628595899037734 23.96594286865837 100-104 19.716830098058836 28.80228136882129 27.04622773664199 24.434660796477885 105-109 19.785 29.080000000000002 27.365000000000002 23.77 110-114 19.900000000000002 29.015 27.384999999999998 23.7 115-119 20.443177270908365 29.421768707482993 26.680672268907564 23.45438175270108 120-124 20.175 28.939999999999998 26.889999999999997 23.995 125-129 20.255000000000003 28.389999999999997 27.275 24.08 130-134 20.167351438019843 27.72321875939473 27.567892574406255 24.541537228179173 135-139 20.090474993717013 28.38904247298316 27.48931892435285 24.03116360894697 140-144 20.55391395803075 28.186507737767315 26.789202183602946 24.47037612059899 145-149 20.306705422471687 28.42537837025158 26.821689886739502 24.446226320537235 150-151 20.225 28.299999999999997 27.537499999999998 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 2.5 23 2.0 24 2.5 25 4.0 26 10.0 27 12.0 28 12.0 29 20.0 30 25.5 31 36.5 32 51.0 33 57.5 34 71.5 35 85.5 36 103.0 37 118.0 38 127.5 39 159.5 40 208.5 41 235.0 42 251.0 43 255.0 44 253.5 45 268.5 46 255.5 47 226.0 48 196.5 49 180.5 50 165.0 51 134.0 52 105.0 53 86.0 54 70.0 55 52.5 56 37.5 57 22.5 58 16.5 59 14.5 60 10.5 61 9.5 62 10.5 63 8.0 64 5.0 65 3.5 66 2.0 67 1.5 68 1.5 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.04 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.2 90-94 0.7849999999999999 95-99 0.755 100-104 0.06 105-109 0.0 110-114 0.0 115-119 0.04 120-124 0.0 125-129 0.0 130-134 0.21 135-139 0.525 140-144 0.165 145-149 0.22999999999999998 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96097313735427 97.625 2 1.0136847440446022 2.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025342118601115054 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGTCAATCTCGTATGC 15 0.375 TruSeq Adapter, Index 15 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3624999999999998 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.0875 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 3.8499999999999996 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.5375 0.0 0.0 0.0 0.0 126-127 4.887499999999999 0.0 0.0 0.0 0.0 128-129 5.262499999999999 0.0 0.0 0.0 0.0 130-131 5.675 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.525 0.0 0.0 0.0 0.0 136-137 7.112500000000001 0.0 0.0 0.0 0.0 138-139 7.699999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACGTT 10 0.006830828 145.0 4 >>END_MODULE SRR7169949 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169949_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.90575 33.0 33.0 34.0 32.0 34.0 2 32.01325 34.0 33.0 34.0 32.0 34.0 3 32.02725 34.0 33.0 34.0 32.0 34.0 4 31.8735 34.0 33.0 34.0 32.0 34.0 5 31.70275 34.0 33.0 34.0 32.0 34.0 6 35.681 38.0 38.0 38.0 35.0 38.0 7 35.64675 38.0 38.0 38.0 35.0 38.0 8 35.6875 38.0 38.0 38.0 35.0 38.0 9 35.64575 38.0 38.0 38.0 35.0 38.0 10-14 35.556200000000004 38.0 38.0 38.0 34.6 38.0 15-19 35.468 38.0 38.0 38.0 34.2 38.0 20-24 35.51955 38.0 38.0 38.0 34.8 38.0 25-29 35.62775 38.0 38.0 38.0 35.6 38.0 30-34 35.63125 38.0 38.0 38.0 35.6 38.0 35-39 35.45235 38.0 38.0 38.0 34.4 38.0 40-44 35.400549999999996 38.0 38.0 38.0 34.4 38.0 45-49 35.2943 38.0 38.0 38.0 33.8 38.0 50-54 35.4853 38.0 38.0 38.0 34.4 38.0 55-59 35.466899999999995 38.0 38.0 38.0 34.4 38.0 60-64 35.417449999999995 38.0 38.0 38.0 34.0 38.0 65-69 35.38915 38.0 38.0 38.0 33.8 38.0 70-74 35.27305 38.0 38.0 38.0 33.8 38.0 75-79 35.2206 38.0 38.0 38.0 33.0 38.0 80-84 35.1865 38.0 38.0 38.0 33.0 38.0 85-89 34.7515 38.0 38.0 38.0 29.0 38.0 90-94 34.4285 38.0 38.0 38.0 25.0 38.0 95-99 34.76729999999999 38.0 38.0 38.0 28.2 38.0 100-104 34.9135 38.0 38.0 38.0 30.2 38.0 105-109 34.7285 38.0 38.0 38.0 28.4 38.0 110-114 34.62815 38.0 38.0 38.0 27.8 38.0 115-119 34.506099999999996 38.0 38.0 38.0 26.8 38.0 120-124 34.377700000000004 38.0 38.0 38.0 25.0 38.0 125-129 33.955549999999995 38.0 37.2 38.0 20.2 38.0 130-134 32.84585 38.0 35.8 38.0 4.2 38.0 135-139 31.8685 38.0 34.8 38.0 2.0 38.0 140-144 30.8202 38.0 33.2 38.0 2.0 38.0 145-149 30.6409 38.0 33.2 38.0 2.0 38.0 150-151 27.299999999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 175.0 3 4.0 4 8.0 5 3.0 6 1.0 7 1.0 8 3.0 9 2.0 10 4.0 11 2.0 12 2.0 13 3.0 14 3.0 15 4.0 16 10.0 17 21.0 18 8.0 19 7.0 20 10.0 21 12.0 22 9.0 23 12.0 24 13.0 25 17.0 26 20.0 27 21.0 28 34.0 29 19.0 30 44.0 31 53.0 32 72.0 33 127.0 34 126.0 35 135.0 36 329.0 37 2686.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.60874062580812 22.058443237651925 15.360744763382467 23.972071373157487 2 29.017400204708288 26.228249744114635 28.121801432958033 16.632548618219037 3 21.205874774542643 30.86833290389075 29.090440608090702 18.83535171347591 4 23.87130254281266 34.04255319148936 23.949143746756615 18.13700051894136 5 24.478623566214807 33.60271115745569 24.009384775808133 17.909280500521376 6 21.322572246810726 35.95417859932309 25.331944806040095 17.391304347826086 7 20.572916666666664 22.135416666666664 37.265625 20.026041666666668 8 23.04087477219474 25.514189013277793 26.295235615725073 25.149700598802394 9 22.037853253824217 26.26393570132227 27.24915737619912 24.449053668654393 10-14 23.558269401388237 28.584103126141642 26.235582694013882 21.62204477845624 15-19 23.875595580920468 27.577360071207917 27.57212419498403 20.974920152887584 20-24 24.410888761168295 28.162390929515645 26.97633105177909 20.450389257536965 25-29 24.242739668991362 27.979598209638805 27.0844176121578 20.693244509212033 30-34 23.71380962299521 28.171214330347844 27.744219954176213 20.370756092480732 35-39 23.331416923639782 28.27575393299535 27.439502430355926 20.953326713008938 40-44 24.020121567805493 28.107315028295954 27.614755816390694 20.25780758750786 45-49 23.675375091805687 28.024341622075333 27.63088867904732 20.669394607071663 50-54 23.741606371349746 27.791369527874654 27.81219093227838 20.654833168497216 55-59 23.883940198989425 28.504453820909514 27.749127467833517 19.862478512267543 60-64 24.103179990601014 28.181296015873848 27.63824343376325 20.077280559761892 65-69 24.24258198854763 28.167621030713168 27.55856324830817 20.031233732431026 70-74 24.60391425908667 28.45086465776121 27.156466811639223 19.788754271512893 75-79 23.926983142000207 28.379356707001758 27.562312545247696 20.131347605750335 80-84 23.55472598123088 28.034427334474 27.676673406958052 20.734173277337067 85-89 24.166842438304155 27.615481965829993 28.016241299303946 20.201434296561906 90-94 24.39360968101481 28.15137200785521 27.387081365108006 20.067936946021973 95-99 23.615236308686363 27.940180292845607 28.13818977645772 20.30639362201032 100-104 23.87160442528437 28.203396873214565 28.07354697969148 19.85145172180959 105-109 23.86955615753282 27.59949989581163 28.396540946030424 20.13440300062513 110-114 24.391388208309444 27.519157587447218 28.342803523953503 19.74665068028984 115-119 24.64504093688465 28.33972432376412 27.02352575396414 19.991708985387085 120-124 24.347601856627126 27.720474471377 28.14337287261475 19.788550799381124 125-129 24.350785340314136 28.172774869109947 27.895287958115183 19.581151832460733 130-134 25.051246089114255 27.743014348904953 27.494875391088573 19.710864170892222 135-139 24.798097134638788 27.884721761256774 27.491979201239076 19.82520190286536 140-144 24.967490247074124 28.173234579069373 27.511731780403686 19.347543393452817 145-149 24.95799685653894 28.301989052083897 27.125901035174245 19.614113056202918 150-151 24.190150118514616 28.864893336844876 28.377666578878063 18.56728996576244 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 109.0 1 61.0 2 10.5 3 5.5 4 3.0 5 3.5 6 3.0 7 2.0 8 1.5 9 2.5 10 2.5 11 1.5 12 3.0 13 3.0 14 2.0 15 2.0 16 1.5 17 0.5 18 2.0 19 2.5 20 1.0 21 2.0 22 2.5 23 2.0 24 2.0 25 2.0 26 2.5 27 6.5 28 8.5 29 9.0 30 11.5 31 16.5 32 22.5 33 32.0 34 40.5 35 49.0 36 59.5 37 80.5 38 119.0 39 149.5 40 178.5 41 199.0 42 238.5 43 289.0 44 294.0 45 293.0 46 295.5 47 258.0 48 226.0 49 203.0 50 159.5 51 131.5 52 112.0 53 83.0 54 66.5 55 53.5 56 35.5 57 28.5 58 16.5 59 8.5 60 10.5 61 10.0 62 5.5 63 3.5 64 3.5 65 3.5 66 3.0 67 1.5 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.325 2 2.3 3 2.9749999999999996 4 3.65 5 4.1000000000000005 6 3.975 7 4.0 8 3.975 9 3.5749999999999997 10-14 4.195 15-19 4.505 20-24 4.305 25-29 3.93 30-34 3.9800000000000004 35-39 4.335 40-44 4.58 45-49 4.6899999999999995 50-54 3.945 55-59 4.015 60-64 4.245 65-69 3.95 70-74 3.4299999999999997 75-79 3.3099999999999996 80-84 3.565 85-89 5.18 90-94 5.795 95-99 4.045 100-104 3.7350000000000003 105-109 4.02 110-114 4.085 115-119 3.51 120-124 3.05 125-129 4.5 130-134 7.31 135-139 9.610000000000001 140-144 11.565 145-149 7.745 150-151 5.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.82629107981221 94.72500000000001 2 0.99113197704747 1.9 3 0.05216484089723526 0.15 4 0.0 0.0 5 0.02608242044861763 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02608242044861763 0.22499999999999998 >10 0.05216484089723526 0.575 >50 0.02608242044861763 2.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 92 2.3 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.2374999999999998 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.7 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.65 0.0 0.0 0.0 0.0 116-117 3.0875 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.9749999999999996 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 4.95 0.0 0.0 0.0 0.0 130-131 5.325 0.0 0.0 0.0 0.0 132-133 5.775 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCTTT 10 0.007072039 143.3038 8 >>END_MODULE Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915262 spots for SRR7169949.sra Written 915262 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra Read 915253 spots for SRR7169949.sra Written 915253 spots for SRR7169949.sra SRR ids: ['SRR7169949.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjbp1aak SRR7169949.sra spots: 18305069 blocks: [[1, 915253], [915254, 1830506], [1830507, 2745759], [2745760, 3661012], [3661013, 4576265], [4576266, 5491518], [5491519, 6406771], [6406772, 7322024], [7322025, 8237277], [8237278, 9152530], [9152531, 10067783], [10067784, 10983036], [10983037, 11898289], [11898290, 12813542], [12813543, 13728795], [13728796, 14644048], [14644049, 15559301], [15559302, 16474554], [16474555, 17389807], [17389808, 18305069]] SRR7169949 file size 6181286 SRR7169949 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169949 SRR7169949_1.fastq SRR7169949_2.fastq Input file: SRR7169949_1.fastq Paired file: SRR7169949_2.fastq trimmed: SRR7169949-trimmed-pair1.fastq, SRR7169949-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:33:38 2025 >> started Wed Feb 12 04:33:58 2025 >> done (19.384s) 18305069 read pairs processed; of these: 37149 ( 0.20%) short read pairs filtered out after trimming by size control 131876 ( 0.72%) empty read pairs filtered out after trimming by size control 18136044 (99.08%) read pairs available; of these: 8154100 (44.96%) trimmed read pairs available after processing 9981944 (55.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 17 0.00% 21 16 0.00% 22 23 0.00% 23 27 0.00% 24 32 0.00% 25 26 0.00% 26 14 0.00% 27 38 0.00% 28 40 0.00% 29 27 0.00% 30 31 0.00% 31 34 0.00% 32 36 0.00% 33 46 0.00% 34 43 0.00% 35 48 0.00% 36 47 0.00% 37 45 0.00% 38 43 0.00% 39 78 0.00% 40 62 0.00% 41 51 0.00% 42 78 0.00% 43 73 0.00% 44 101 0.00% 45 123 0.00% 46 132 0.00% 47 148 0.00% 48 186 0.00% 49 182 0.00% 50 196 0.00% 51 256 0.00% 52 264 0.00% 53 271 0.00% 54 272 0.00% 55 340 0.00% 56 330 0.00% 57 366 0.00% 58 450 0.00% 59 505 0.00% 60 482 0.00% 61 609 0.00% 62 692 0.00% 63 687 0.00% 64 836 0.00% 65 1007 0.01% 66 1199 0.01% 67 1436 0.01% 68 1922 0.01% 69 4158 0.02% 70 7480 0.04% 71 5647 0.03% 72 3885 0.02% 73 3118 0.02% 74 3050 0.02% 75 3040 0.02% 76 3272 0.02% 77 3358 0.02% 78 3577 0.02% 79 3956 0.02% 80 4274 0.02% 81 4979 0.03% 82 5554 0.03% 83 6212 0.03% 84 8437 0.05% 85 9710 0.05% 86 10317 0.06% 87 10958 0.06% 88 11651 0.06% 89 11914 0.07% 90 12695 0.07% 91 13245 0.07% 92 13977 0.08% 93 15564 0.09% 94 15930 0.09% 95 17253 0.10% 96 17952 0.10% 97 18419 0.10% 98 18784 0.10% 99 19180 0.11% 100 20109 0.11% 101 20877 0.12% 102 22843 0.13% 103 23879 0.13% 104 24853 0.14% 105 26292 0.14% 106 27341 0.15% 107 27682 0.15% 108 28493 0.16% 109 29018 0.16% 110 29848 0.16% 111 30976 0.17% 112 32185 0.18% 113 34496 0.19% 114 35449 0.20% 115 36962 0.20% 116 38251 0.21% 117 38832 0.21% 118 39498 0.22% 119 39318 0.22% 120 40432 0.22% 121 41198 0.23% 122 42946 0.24% 123 44730 0.25% 124 47265 0.26% 125 49301 0.27% 126 50212 0.28% 127 51901 0.29% 128 52716 0.29% 129 54318 0.30% 130 55690 0.31% 131 57541 0.32% 132 59976 0.33% 133 63132 0.35% 134 66728 0.37% 135 70559 0.39% 136 74014 0.41% 137 78450 0.43% 138 83198 0.46% 139 89507 0.49% 140 94857 0.52% 141 102181 0.56% 142 109736 0.61% 143 121025 0.67% 144 139685 0.77% 145 154849 0.85% 146 183680 1.01% 147 245817 1.36% 148 377708 2.08% 149 687246 3.79% 150 3850762 21.23% 151 9981944 55.04% 18136044 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=14.73 fanout-score-rank=13 prefix-density=0.32 prefix-fanout=6.7 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=292.14 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=30.4 sequence=TTCTTCTTCTTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=20.20 fanout-score-rank=12 prefix-density=0.39 prefix-fanout=8.1 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=313.31 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=29.0 sequence=AAGAAGAAGAAG SRR7169949 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:34:43 Started mapping on | Feb 12 04:34:43 Finished on | Feb 12 04:36:31 Mapping speed, Million of reads per hour | 604.53 Number of input reads | 18136044 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17142133 Uniquely mapped reads % | 94.52% Average mapped length | 292.58 Number of splices: Total | 14814210 Number of splices: Annotated (sjdb) | 14541792 Number of splices: GT/AG | 14590506 Number of splices: GC/AG | 176842 Number of splices: AT/AC | 12590 Number of splices: Non-canonical | 34272 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310489 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 43424 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 716975 716975 716975 N_multimapping 310489 310489 310489 N_noFeature 389192 16905675 506602 N_ambiguous 192674 1508 72542 UnstrandedReadsAssigned:16560267 PositiveStrandReadsAssigned:234950 NegativeStrandReadsAssigned:16562989 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169949 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169949-trimmed-pair1.fastq SRR7169949-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,136,044 reads, 16,538,574 reads pseudoaligned [quant] estimated average fragment length: 234.183 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR7169949.ke.tsv 34699 SRR7169949.se.tsv 87100 total ==> SRR7169949.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.82 315 10.1507 Potri.005G024800.1.v4.1 1035 801.817 70 5.02112 Potri.004G059700.1.v4.1 961 727.864 7 0.553128 Potri.007G009000.2.v4.1 1416 1182.82 0 0 Potri.003G141000.2.v4.1 2943 2709.82 271.032 5.75252 Potri.016G087400.1.v4.1 270 82.0943 1952 1367.56 Potri.015G069301.1.v4.1 564 334.063 0 0 Potri.010G195200.1.v4.1 1773 1539.82 54 2.01698 Potri.012G127500.1.v4.1 977 743.828 8089 625.461 ==> SRR7169949.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1701 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 325 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169949 completed mapping pipeline successfully