Starting /dee2/code/volunteer_pipeline.sh SRR7169950 current disk space = 3049168252928 free memory = 871300344 SRR7169950 SRAfilesize 12992e49760902dc3a768f6c27e31f00 SRR7169950.sra SRR7169950.sra file validated SRR7169950 is paired end SRR7169950 is conventional basespace SRR7169950 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169950_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.25275 34.0 34.0 34.0 33.0 34.0 2 33.53375 34.0 34.0 34.0 33.0 34.0 3 33.548 34.0 34.0 34.0 33.0 34.0 4 33.56525 34.0 34.0 34.0 33.0 34.0 5 33.50275 34.0 34.0 34.0 33.0 34.0 6 37.364 38.0 38.0 38.0 37.0 38.0 7 37.56175 38.0 38.0 38.0 38.0 38.0 8 37.62925 38.0 38.0 38.0 38.0 38.0 9 37.67625 38.0 38.0 38.0 38.0 38.0 10-14 37.6141 38.0 38.0 38.0 38.0 38.0 15-19 37.615700000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5768 38.0 38.0 38.0 38.0 38.0 25-29 37.5476 38.0 38.0 38.0 38.0 38.0 30-34 37.5387 38.0 38.0 38.0 38.0 38.0 35-39 37.46135 38.0 38.0 38.0 37.6 38.0 40-44 37.343450000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2313 38.0 38.0 38.0 37.0 38.0 50-54 37.235200000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.18579999999999 38.0 38.0 38.0 36.4 38.0 60-64 37.176 38.0 38.0 38.0 36.6 38.0 65-69 37.08445 38.0 38.0 38.0 36.0 38.0 70-74 36.98355 38.0 38.0 38.0 36.0 38.0 75-79 36.9104 38.0 38.0 38.0 36.0 38.0 80-84 36.86505 38.0 38.0 38.0 35.6 38.0 85-89 36.70075 38.0 38.0 38.0 34.8 38.0 90-94 36.5946 38.0 38.0 38.0 34.6 38.0 95-99 36.402550000000005 38.0 38.0 38.0 34.0 38.0 100-104 36.40845 38.0 38.0 38.0 34.0 38.0 105-109 36.3017 38.0 38.0 38.0 34.0 38.0 110-114 36.1785 38.0 38.0 38.0 33.8 38.0 115-119 35.958749999999995 38.0 37.0 38.0 32.6 38.0 120-124 35.768950000000004 38.0 37.0 38.0 31.8 38.0 125-129 35.396550000000005 38.0 36.4 38.0 29.6 38.0 130-134 35.1097 38.0 36.0 38.0 29.2 38.0 135-139 34.585750000000004 38.0 35.4 38.0 26.0 38.0 140-144 34.390499999999996 38.0 35.0 38.0 25.8 38.0 145-149 33.51575 38.0 34.8 38.0 19.6 38.0 150-151 29.981250000000003 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 2.0 18 2.0 19 5.0 20 4.0 21 5.0 22 11.0 23 15.0 24 8.0 25 19.0 26 22.0 27 28.0 28 24.0 29 28.0 30 35.0 31 62.0 32 58.0 33 83.0 34 121.0 35 235.0 36 562.0 37 2665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.02069661786976 12.7208480565371 11.963654719838464 36.294800605754666 2 23.425 15.950000000000001 32.125 28.499999999999996 3 21.05 22.475 24.75 31.724999999999998 4 22.25 29.625 22.95 25.174999999999997 5 22.175 33.875 24.45 19.5 6 19.525000000000002 34.4 25.174999999999997 20.9 7 14.524999999999999 24.875 41.475 19.125 8 18.975 24.65 29.925 26.450000000000003 9 17.375 24.875 32.875 24.875 10-14 20.22 29.075 27.400000000000002 23.305 15-19 19.765 28.165000000000003 28.02 24.05 20-24 20.95 28.65 27.029999999999998 23.369999999999997 25-29 19.425 29.330000000000002 26.939999999999998 24.305 30-34 19.865 28.444999999999997 27.725 23.965 35-39 20.47 28.315 27.455000000000002 23.76 40-44 20.662231781123396 29.210223578252386 26.894413044565596 23.23313159605862 45-49 20.341786108048513 28.305101733988174 27.162473689485818 24.1906384684775 50-54 20.07 28.485 27.400000000000002 24.044999999999998 55-59 20.305 28.7 27.345000000000002 23.65 60-64 20.54 28.26 26.795 24.404999999999998 65-69 20.080000000000002 28.835 27.084999999999997 24.0 70-74 20.599999999999998 28.549999999999997 27.26 23.59 75-79 20.365 28.044999999999998 27.395000000000003 24.195 80-84 20.78 27.589999999999996 27.275 24.355 85-89 20.48482420114194 27.84734047881398 27.436642291896224 24.231193028147853 90-94 20.368418410881894 28.580033127541032 26.968829995482608 24.082718466094462 95-99 21.048403293834102 27.58083952600924 27.179152440249045 24.191604739907614 100-104 21.252628416942024 27.650946230099127 26.834885350956245 24.261540002002604 105-109 20.77 28.035 27.305 23.89 110-114 20.821231847771656 28.192288432648972 26.82523785678518 24.161241862794192 115-119 21.22 28.189999999999998 26.735 23.855 120-124 21.455 27.625 27.18 23.74 125-129 21.759999999999998 28.115000000000002 26.6 23.525 130-134 21.087958324984974 28.8619515127229 26.507713884992988 23.542376277299137 135-139 20.972354623450904 28.217349857006674 26.78741658722593 24.02287893231649 140-144 21.506993532862083 28.17466285656991 26.61051787236176 23.707825738206246 145-149 21.515121169637492 27.758862407370316 27.28820348487883 23.43781293811336 150-151 20.925 28.212500000000002 26.75 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 2.0 24 1.5 25 2.5 26 4.0 27 7.5 28 10.5 29 12.0 30 14.0 31 17.5 32 33.0 33 40.0 34 44.0 35 57.0 36 69.5 37 98.0 38 125.5 39 158.5 40 179.5 41 195.0 42 234.5 43 249.0 44 265.5 45 283.5 46 264.0 47 252.5 48 236.0 49 206.5 50 187.5 51 165.0 52 130.5 53 103.5 54 80.0 55 52.0 56 48.5 57 43.5 58 30.5 59 22.5 60 16.0 61 11.5 62 7.5 63 4.5 64 4.5 65 7.0 66 6.5 67 4.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.034999999999999996 45-49 0.22999999999999998 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.16999999999999998 90-94 0.385 95-99 0.42 100-104 0.13 105-109 0.0 110-114 0.15 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.18 135-139 0.345 140-144 0.265 145-149 0.13999999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.5999999999999996 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5999999999999996 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.574999999999999 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAAG 10 0.006830828 145.0 5 >>END_MODULE SRR7169950 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169950_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.19175 33.0 33.0 34.0 32.0 34.0 2 32.35475 34.0 33.0 34.0 32.0 34.0 3 32.39775 34.0 33.0 34.0 32.0 34.0 4 32.1675 34.0 33.0 34.0 32.0 34.0 5 32.18325 34.0 33.0 34.0 32.0 34.0 6 36.34925 38.0 38.0 38.0 36.0 38.0 7 36.3145 38.0 38.0 38.0 36.0 38.0 8 36.36775 38.0 38.0 38.0 36.0 38.0 9 36.426 38.0 38.0 38.0 36.0 38.0 10-14 36.3414 38.0 38.0 38.0 36.0 38.0 15-19 36.1024 38.0 38.0 38.0 35.6 38.0 20-24 36.258849999999995 38.0 38.0 38.0 36.0 38.0 25-29 36.3278 38.0 38.0 38.0 36.2 38.0 30-34 36.31415 38.0 38.0 38.0 36.6 38.0 35-39 36.26965 38.0 38.0 38.0 36.0 38.0 40-44 36.089549999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.008500000000005 38.0 38.0 38.0 35.2 38.0 50-54 36.227599999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.1923 38.0 38.0 38.0 36.0 38.0 60-64 36.16685 38.0 38.0 38.0 36.0 38.0 65-69 36.12715 38.0 38.0 38.0 35.6 38.0 70-74 36.059650000000005 38.0 38.0 38.0 35.4 38.0 75-79 36.04715 38.0 38.0 38.0 35.2 38.0 80-84 35.931799999999996 38.0 38.0 38.0 34.6 38.0 85-89 35.479949999999995 38.0 38.0 38.0 33.4 38.0 90-94 35.1263 38.0 38.0 38.0 30.6 38.0 95-99 35.5212 38.0 38.0 38.0 32.0 38.0 100-104 35.5058 38.0 38.0 38.0 32.4 38.0 105-109 35.46895 38.0 38.0 38.0 32.2 38.0 110-114 35.2325 38.0 38.0 38.0 31.4 38.0 115-119 35.117999999999995 38.0 37.8 38.0 29.8 38.0 120-124 34.80275 38.0 36.8 38.0 28.0 38.0 125-129 34.34375 38.0 36.4 38.0 24.6 38.0 130-134 33.45835 38.0 36.0 38.0 14.4 38.0 135-139 32.7719 38.0 34.6 38.0 13.2 38.0 140-144 32.09545000000001 38.0 33.0 38.0 2.0 38.0 145-149 31.569499999999998 38.0 33.2 38.0 2.0 38.0 150-151 27.387375 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 92.0 3 5.0 4 6.0 5 2.0 6 2.0 7 3.0 8 0.0 9 3.0 10 2.0 11 3.0 12 1.0 13 2.0 14 2.0 15 5.0 16 3.0 17 3.0 18 5.0 19 8.0 20 10.0 21 9.0 22 17.0 23 13.0 24 17.0 25 17.0 26 17.0 27 40.0 28 30.0 29 44.0 30 52.0 31 72.0 32 76.0 33 110.0 34 115.0 35 173.0 36 429.0 37 2612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.89320388349515 19.724067450178843 15.789473684210526 27.593254982115482 2 27.1714358065333 26.740947075208915 28.58951633324892 17.498100785008862 3 19.77602443369814 30.236701450750825 30.491219139730212 19.49605497582082 4 23.14600975109058 34.719014626635875 22.453169104439315 19.681806517834232 5 25.27585322042597 34.103156274056964 22.83808057480113 17.782909930715935 6 21.242331288343557 36.75869120654397 23.185071574642127 18.813905930470348 7 19.989775051124745 21.472392638036812 37.372188139059304 21.165644171779142 8 22.744697163301815 25.376948632762584 26.16917965755175 25.70917454638385 9 21.472392638036812 26.12474437627812 29.422290388548056 22.980572597137012 10-14 23.939192301786356 28.10052720479091 26.559860776987254 21.400419716435483 15-19 23.50794221970904 28.072790829178018 27.43535701434226 20.98390993677068 20-24 23.302958943380773 27.971741578785707 27.249923210811914 21.475376267021602 25-29 24.0523811959691 27.413166913908636 27.54105069313008 20.993401196992174 30-34 23.710601719197708 27.855096193205075 26.990380679492425 21.44392140810479 35-39 23.332820749397715 27.823056025424165 27.638525808601162 21.205597416576964 40-44 23.599897145795833 27.492928773463614 27.750064283877602 21.157109796862947 45-49 23.246111053878643 27.861337179355104 27.495621716287218 21.396930050479035 50-54 23.359083235279073 27.825241725072903 27.65641786463396 21.15925717501407 55-59 23.10763089206203 28.287015712165413 27.06893904498695 21.536414350785606 60-64 23.365059871046974 28.287790400163747 27.172244396684064 21.174905332105208 65-69 23.80635926796851 27.82435333810449 27.313158163786934 21.056129230140066 70-74 23.491368335285433 27.519478535417836 27.42272241177369 21.566430717523044 75-79 24.1388096208724 27.323685283326537 27.50203832042397 21.035466775377092 80-84 23.25391144288782 27.482360159525516 27.789139993864403 21.47458840372226 85-89 24.22044960116026 27.530301460685795 27.235056459131872 21.014192479022064 90-94 23.71440492333368 27.76676749765307 27.35996662146657 21.158860957546676 95-99 23.843197540353575 26.861388675377913 28.06559057135537 21.229823212913143 100-104 24.519623875715453 27.34055600981194 27.304783319705646 20.835036794766967 105-109 24.0320016411098 27.65270013846864 27.632186265962353 20.683111954459203 110-114 24.200913242009133 27.571699758863065 27.325432250782413 20.90195474834539 115-119 23.879376437515972 28.188090978788654 26.8591873243036 21.073345259391772 120-124 24.86266531027467 27.42115971515768 27.105798575788402 20.61037639877925 125-129 24.753802526424337 27.821603506058263 26.903841196184587 20.520752771332816 130-134 23.934512806971217 27.673620279904938 27.42540269342487 20.96646421969897 135-139 24.122619302375348 27.942435266424138 27.177402097153863 20.75754333404665 140-144 24.718979680069175 27.815607436230007 26.399697362732383 21.06571552096844 145-149 25.488646541278122 27.56440651177493 27.079711290237608 19.867235656709344 150-151 26.283870967741933 27.716129032258063 26.70967741935484 19.29032258064516 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 58.0 1 34.5 2 8.0 3 3.0 4 2.0 5 3.5 6 2.5 7 1.0 8 2.0 9 1.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 2.0 26 3.0 27 3.0 28 4.0 29 5.0 30 8.0 31 15.0 32 20.0 33 29.5 34 33.0 35 39.0 36 56.0 37 76.5 38 112.0 39 142.0 40 180.0 41 236.5 42 251.5 43 261.5 44 280.0 45 289.5 46 291.5 47 262.0 48 228.0 49 192.5 50 184.0 51 176.5 52 135.0 53 100.5 54 75.0 55 56.0 56 43.0 57 29.0 58 20.0 59 15.0 60 10.5 61 8.5 62 5.0 63 6.0 64 6.5 65 3.0 66 2.5 67 2.0 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.15 2 1.275 3 1.775 4 2.5749999999999997 5 2.5749999999999997 6 2.1999999999999997 7 2.1999999999999997 8 2.175 9 2.1999999999999997 10-14 2.315 15-19 2.735 20-24 2.33 25-29 2.255 30-34 2.2800000000000002 35-39 2.455 40-44 2.775 45-49 2.93 50-54 2.265 55-59 2.305 60-64 2.29 65-69 2.19 70-74 1.815 75-79 1.8800000000000001 80-84 2.21 85-89 3.47 90-94 4.130000000000001 95-99 2.4250000000000003 100-104 2.16 105-109 2.505 110-114 2.545 115-119 2.175 120-124 1.7000000000000002 125-129 3.025 130-134 5.325 135-139 6.54 140-144 7.48 145-149 5.095000000000001 150-151 3.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51505870342011 97.475 2 0.3062787136294028 0.6 3 0.0765696784073507 0.22499999999999998 4 0.0 0.0 5 0.025523226135783564 0.125 6 0.05104645227156713 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025523226135783564 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 51 1.275 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.7375 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.5250000000000004 0.0 0.0 0.0 0.0 126-127 3.8375000000000004 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.55 0.0 0.0 0.0 0.0 132-133 4.887499999999999 0.0 0.0 0.0 0.0 134-135 5.35 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 5.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCCT 10 0.0068961848 144.46753 2 >>END_MODULE Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667046 spots for SRR7169950.sra Written 667046 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra Read 667042 spots for SRR7169950.sra Written 667042 spots for SRR7169950.sra SRR ids: ['SRR7169950.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t1ooba_c SRR7169950.sra spots: 13340844 blocks: [[1, 667042], [667043, 1334084], [1334085, 2001126], [2001127, 2668168], [2668169, 3335210], [3335211, 4002252], [4002253, 4669294], [4669295, 5336336], [5336337, 6003378], [6003379, 6670420], [6670421, 7337462], [7337463, 8004504], [8004505, 8671546], [8671547, 9338588], [9338589, 10005630], [10005631, 10672672], [10672673, 11339714], [11339715, 12006756], [12006757, 12673798], [12673799, 13340844]] SRR7169950 file size 4499073 SRR7169950 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169950 SRR7169950_1.fastq SRR7169950_2.fastq Input file: SRR7169950_1.fastq Paired file: SRR7169950_2.fastq trimmed: SRR7169950-trimmed-pair1.fastq, SRR7169950-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:35:09 2025 >> started Wed Feb 12 04:35:24 2025 >> done (15.022s) 13340844 read pairs processed; of these: 18902 ( 0.14%) short read pairs filtered out after trimming by size control 27947 ( 0.21%) empty read pairs filtered out after trimming by size control 13293995 (99.65%) read pairs available; of these: 6197471 (46.62%) trimmed read pairs available after processing 7096524 (53.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 3 0.00% 26 11 0.00% 27 14 0.00% 28 7 0.00% 29 265 0.00% 30 17 0.00% 31 20 0.00% 32 16 0.00% 33 12 0.00% 34 11 0.00% 35 32 0.00% 36 17 0.00% 37 19 0.00% 38 22 0.00% 39 23 0.00% 40 26 0.00% 41 20 0.00% 42 24 0.00% 43 28 0.00% 44 39 0.00% 45 44 0.00% 46 33 0.00% 47 52 0.00% 48 51 0.00% 49 62 0.00% 50 77 0.00% 51 101 0.00% 52 84 0.00% 53 137 0.00% 54 117 0.00% 55 113 0.00% 56 149 0.00% 57 160 0.00% 58 183 0.00% 59 198 0.00% 60 240 0.00% 61 316 0.00% 62 337 0.00% 63 373 0.00% 64 394 0.00% 65 421 0.00% 66 434 0.00% 67 520 0.00% 68 656 0.00% 69 919 0.01% 70 1270 0.01% 71 1181 0.01% 72 1158 0.01% 73 1141 0.01% 74 1310 0.01% 75 1347 0.01% 76 1531 0.01% 77 1590 0.01% 78 1675 0.01% 79 1906 0.01% 80 2156 0.02% 81 2510 0.02% 82 2955 0.02% 83 3265 0.02% 84 4318 0.03% 85 5055 0.04% 86 5233 0.04% 87 5540 0.04% 88 5925 0.04% 89 6138 0.05% 90 6538 0.05% 91 7189 0.05% 92 7773 0.06% 93 8380 0.06% 94 9242 0.07% 95 9691 0.07% 96 9897 0.07% 97 10469 0.08% 98 10590 0.08% 99 11025 0.08% 100 11992 0.09% 101 12430 0.09% 102 13456 0.10% 103 14459 0.11% 104 15357 0.12% 105 15882 0.12% 106 16788 0.13% 107 17125 0.13% 108 17587 0.13% 109 18195 0.14% 110 18736 0.14% 111 19713 0.15% 112 20822 0.16% 113 21767 0.16% 114 23164 0.17% 115 23684 0.18% 116 24765 0.19% 117 25373 0.19% 118 25631 0.19% 119 26017 0.20% 120 26751 0.20% 121 27845 0.21% 122 29053 0.22% 123 30313 0.23% 124 32539 0.24% 125 33759 0.25% 126 35199 0.26% 127 36270 0.27% 128 37053 0.28% 129 37988 0.29% 130 38898 0.29% 131 41126 0.31% 132 43306 0.33% 133 45541 0.34% 134 48394 0.36% 135 51175 0.38% 136 54449 0.41% 137 58018 0.44% 138 63041 0.47% 139 67734 0.51% 140 71493 0.54% 141 79428 0.60% 142 86151 0.65% 143 94889 0.71% 144 108459 0.82% 145 125329 0.94% 146 153201 1.15% 147 196394 1.48% 148 291328 2.19% 149 561919 4.23% 150 3052667 22.96% 151 7096524 53.38% 13293995 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=11 fanout-score=88.25 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=17.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=9 fanout-score=56.91 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=14.8 sequence=TGTTGGTGGTGG SRR7169950 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:36:05 Started mapping on | Feb 12 04:36:05 Finished on | Feb 12 04:37:27 Mapping speed, Million of reads per hour | 583.64 Number of input reads | 13293995 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12576562 Uniquely mapped reads % | 94.60% Average mapped length | 293.55 Number of splices: Total | 12097946 Number of splices: Annotated (sjdb) | 11906315 Number of splices: GT/AG | 11927507 Number of splices: GC/AG | 138115 Number of splices: AT/AC | 9471 Number of splices: Non-canonical | 22853 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.60 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260286 % of reads mapped to multiple loci | 1.96% Number of reads mapped to too many loci | 25272 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474037 474037 474037 N_multimapping 260286 260286 260286 N_noFeature 253345 12437746 316265 N_ambiguous 123285 811 46916 UnstrandedReadsAssigned:12199932 PositiveStrandReadsAssigned:138005 NegativeStrandReadsAssigned:12213381 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169950 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169950-trimmed-pair1.fastq SRR7169950-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,293,995 reads, 12,157,113 reads pseudoaligned [quant] estimated average fragment length: 242.362 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,341 rounds 52401 SRR7169950.ke.tsv 34699 SRR7169950.se.tsv 87100 total ==> SRR7169950.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.64 262 12.0998 Potri.005G024800.1.v4.1 1035 793.638 37 3.8252 Potri.004G059700.1.v4.1 961 719.673 11 1.2541 Potri.007G009000.2.v4.1 1416 1174.64 0 0 Potri.003G141000.2.v4.1 2943 2701.64 168.022 5.10284 Potri.016G087400.1.v4.1 270 81.7014 1175.64 1180.65 Potri.015G069301.1.v4.1 564 328.084 0 0 Potri.010G195200.1.v4.1 1773 1531.64 6 0.321417 Potri.012G127500.1.v4.1 977 735.644 4215 470.115 ==> SRR7169950.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 915 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 194 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 14 SRR7169950 completed mapping pipeline successfully