Starting /dee2/code/volunteer_pipeline.sh SRR7169951 current disk space = 3049113370624 free memory = 1434759664 SRR7169951 SRAfilesize 961c6f897f609a60898adf9fe475d5af SRR7169951.sra SRR7169951.sra file validated SRR7169951 is paired end SRR7169951 is conventional basespace SRR7169951 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169951_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.821 34.0 33.0 34.0 33.0 34.0 2 33.39075 34.0 34.0 34.0 33.0 34.0 3 33.38025 34.0 34.0 34.0 33.0 34.0 4 33.4845 34.0 34.0 34.0 33.0 34.0 5 33.48 34.0 34.0 34.0 33.0 34.0 6 37.261 38.0 38.0 38.0 36.0 38.0 7 37.44875 38.0 38.0 38.0 37.0 38.0 8 37.5105 38.0 38.0 38.0 37.0 38.0 9 37.53125 38.0 38.0 38.0 38.0 38.0 10-14 37.565099999999994 38.0 38.0 38.0 38.0 38.0 15-19 37.535000000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.483349999999994 38.0 38.0 38.0 37.6 38.0 25-29 37.450900000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.42085 38.0 38.0 38.0 37.2 38.0 35-39 37.3661 38.0 38.0 38.0 37.0 38.0 40-44 37.21455 38.0 38.0 38.0 36.8 38.0 45-49 37.12985 38.0 38.0 38.0 36.0 38.0 50-54 37.032199999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.9722 38.0 38.0 38.0 36.0 38.0 60-64 36.9491 38.0 38.0 38.0 35.8 38.0 65-69 36.921949999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.83695 38.0 38.0 38.0 35.4 38.0 75-79 36.75705000000001 38.0 38.0 38.0 34.8 38.0 80-84 36.61110000000001 38.0 38.0 38.0 34.2 38.0 85-89 36.53335 38.0 38.0 38.0 34.0 38.0 90-94 36.50345 38.0 38.0 38.0 34.0 38.0 95-99 36.3679 38.0 38.0 38.0 33.8 38.0 100-104 36.2234 38.0 37.4 38.0 33.6 38.0 105-109 36.03205 38.0 37.0 38.0 33.2 38.0 110-114 35.774950000000004 38.0 37.0 38.0 31.8 38.0 115-119 35.6734 38.0 37.0 38.0 31.0 38.0 120-124 35.4468 38.0 36.2 38.0 30.6 38.0 125-129 35.0175 38.0 35.8 38.0 28.0 38.0 130-134 34.652699999999996 38.0 35.0 38.0 27.4 38.0 135-139 34.216049999999996 38.0 35.0 38.0 24.0 38.0 140-144 34.0049 38.0 35.0 38.0 23.0 38.0 145-149 33.082899999999995 38.0 34.2 38.0 14.4 38.0 150-151 29.218999999999998 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 2.0 15 0.0 16 3.0 17 3.0 18 2.0 19 9.0 20 11.0 21 8.0 22 7.0 23 14.0 24 12.0 25 19.0 26 24.0 27 24.0 28 24.0 29 35.0 30 40.0 31 48.0 32 74.0 33 95.0 34 160.0 35 252.0 36 695.0 37 2434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.700357325165896 12.200102092904542 8.44818785094436 36.651352730985195 2 23.599999999999998 13.325000000000001 33.425 29.65 3 20.474999999999998 16.950000000000003 25.650000000000002 36.925000000000004 4 23.775 25.624999999999996 23.1 27.500000000000004 5 23.575 30.475 23.599999999999998 22.35 6 20.375 34.475 22.95 22.2 7 13.925 27.700000000000003 40.425 17.95 8 18.0 26.724999999999998 30.65 24.625 9 16.925 25.3 33.900000000000006 23.875 10-14 20.34 29.395 27.515 22.75 15-19 20.03 28.349999999999998 27.860000000000003 23.76 20-24 20.14 28.275 28.01 23.575 25-29 20.28 29.01 26.939999999999998 23.77 30-34 19.015 28.605000000000004 28.375 24.005000000000003 35-39 20.09 28.595 27.24 24.075 40-44 20.599999999999998 28.975 27.134999999999998 23.29 45-49 20.47 29.005 27.155 23.369999999999997 50-54 20.349999999999998 28.34 27.13 24.18 55-59 20.155 28.46 27.134999999999998 24.25 60-64 20.345 28.065 27.875 23.715 65-69 20.119999999999997 28.294999999999998 27.375 24.21 70-74 20.95 28.294999999999998 27.200000000000003 23.555 75-79 20.48 28.59 26.655 24.275 80-84 20.86 28.275 27.200000000000003 23.665 85-89 20.69 28.560000000000002 26.950000000000003 23.799999999999997 90-94 20.865000000000002 27.439999999999998 27.37 24.325 95-99 20.61 28.395 27.255000000000003 23.74 100-104 20.51 29.035 26.875 23.580000000000002 105-109 20.035 28.64 26.825 24.5 110-114 21.310000000000002 28.465 26.505000000000003 23.72 115-119 20.875 28.215 27.29 23.62 120-124 20.84 28.165000000000003 26.6 24.395 125-129 20.705000000000002 28.144999999999996 27.139999999999997 24.01 130-134 20.595 28.444999999999997 26.265 24.695 135-139 20.75 28.24 27.005000000000003 24.005000000000003 140-144 20.235 27.685 27.435 24.645 145-149 21.21 27.900000000000002 26.745 24.145 150-151 21.15 28.1375 26.724999999999998 23.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 1.5 25 2.5 26 3.0 27 3.5 28 6.5 29 11.5 30 14.5 31 23.0 32 28.5 33 34.5 34 44.0 35 58.0 36 77.0 37 105.5 38 125.5 39 143.0 40 167.5 41 180.0 42 210.0 43 246.0 44 277.5 45 292.0 46 303.0 47 287.5 48 246.0 49 219.0 50 193.0 51 165.5 52 124.0 53 99.0 54 81.0 55 57.5 56 48.5 57 35.0 58 18.5 59 14.5 60 14.5 61 8.5 62 5.0 63 5.0 64 5.0 65 2.5 66 1.0 67 1.5 68 2.0 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.725 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.2750000000000004 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.3375 0.0 0.0 0.0 0.0 126-127 4.6875 0.0 0.0 0.0 0.0 128-129 5.050000000000001 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.775 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACATA 10 0.006832588 144.9875 7 GGATCAT 10 0.006832588 144.9875 145 >>END_MODULE SRR7169951 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169951_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.422 33.0 33.0 34.0 30.0 34.0 2 32.03675 34.0 33.0 34.0 30.0 34.0 3 32.1375 34.0 33.0 34.0 31.0 34.0 4 32.002 34.0 33.0 34.0 31.0 34.0 5 31.93075 34.0 33.0 34.0 32.0 34.0 6 36.115 38.0 38.0 38.0 35.0 38.0 7 36.12425 38.0 38.0 38.0 35.0 38.0 8 36.154 38.0 38.0 38.0 35.0 38.0 9 36.178 38.0 38.0 38.0 35.0 38.0 10-14 36.06995 38.0 38.0 38.0 35.4 38.0 15-19 35.77935 38.0 38.0 38.0 34.0 38.0 20-24 36.011700000000005 38.0 38.0 38.0 35.2 38.0 25-29 36.072250000000004 38.0 38.0 38.0 35.2 38.0 30-34 36.11615 38.0 38.0 38.0 35.8 38.0 35-39 36.00085 38.0 38.0 38.0 35.2 38.0 40-44 35.879949999999994 38.0 38.0 38.0 35.0 38.0 45-49 35.73610000000001 38.0 38.0 38.0 34.4 38.0 50-54 35.975849999999994 38.0 38.0 38.0 34.8 38.0 55-59 35.933299999999996 38.0 38.0 38.0 34.6 38.0 60-64 35.79535 38.0 38.0 38.0 34.0 38.0 65-69 35.8775 38.0 38.0 38.0 34.0 38.0 70-74 35.90195 38.0 38.0 38.0 34.2 38.0 75-79 35.79525 38.0 38.0 38.0 34.0 38.0 80-84 35.73595 38.0 38.0 38.0 34.0 38.0 85-89 35.302099999999996 38.0 38.0 38.0 31.8 38.0 90-94 34.7668 38.0 38.0 38.0 28.0 38.0 95-99 35.28060000000001 38.0 38.0 38.0 29.8 38.0 100-104 35.34405 38.0 38.0 38.0 31.6 38.0 105-109 35.228699999999996 38.0 38.0 38.0 30.6 38.0 110-114 34.97125 38.0 37.6 38.0 29.0 38.0 115-119 34.7599 38.0 37.0 38.0 27.4 38.0 120-124 34.50940000000001 38.0 36.8 38.0 25.6 38.0 125-129 34.0373 38.0 36.0 38.0 21.2 38.0 130-134 32.7509 38.0 35.0 38.0 9.2 38.0 135-139 31.59855 38.0 33.8 38.0 2.0 38.0 140-144 30.675549999999998 38.0 32.8 38.0 2.0 38.0 145-149 30.321199999999997 38.0 31.4 38.0 2.0 38.0 150-151 26.636000000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 100.0 3 11.0 4 2.0 5 0.0 6 4.0 7 1.0 8 4.0 9 1.0 10 3.0 11 2.0 12 0.0 13 8.0 14 8.0 15 2.0 16 3.0 17 10.0 18 11.0 19 10.0 20 18.0 21 8.0 22 10.0 23 14.0 24 14.0 25 24.0 26 25.0 27 29.0 28 46.0 29 43.0 30 59.0 31 66.0 32 117.0 33 149.0 34 157.0 35 177.0 36 408.0 37 2456.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.88054251434533 22.013562858633282 13.823682837767345 27.282211789254042 2 27.307110438729197 27.155824508320727 28.567826525466465 16.96923852748361 3 19.79193098198427 28.444557218979956 31.108855620400917 20.654656178634863 4 24.045116636759804 33.14534734683415 23.404255319148938 19.405280697257112 5 24.613402061855673 35.43814432989691 22.08762886597938 17.86082474226804 6 20.112445693841043 37.618195757730646 23.485816509072325 18.783542039355993 7 20.73638455637944 22.47507031449757 36.99821017642547 19.79033495269752 8 21.782431052093973 25.485188968335038 28.421859039836566 24.310520939734424 9 21.171974522292995 25.80891719745223 29.503184713375795 23.51592356687898 10-14 23.553190400654966 28.961776595200327 26.53123880673387 20.95379419741084 15-19 23.602676273803397 27.90530108080288 26.994338651569738 21.497683993823983 20-24 23.284163081335794 27.714607662364273 27.54046301987298 21.460766236426963 25-29 23.551316057947357 27.933074882677005 27.08630891654764 21.429300142827994 30-34 24.293583596858102 27.619096195042335 27.74150770172396 20.345812506375598 35-39 23.377222193759923 28.19304267636662 27.18376966033096 21.245965469542497 40-44 23.653311360593264 27.901946647440518 27.94829539602431 20.496446595941908 45-49 23.318709677419356 27.401290322580646 27.84516129032258 21.43483870967742 50-54 23.423515573057845 28.287219352529025 27.724645834398814 20.56461924001432 55-59 23.83536398075151 27.802805365004605 27.224326814784476 21.137503839459406 60-64 24.093543258628646 27.760397969126622 27.57577311657008 20.57028565567465 65-69 23.910266237416323 28.294751903520876 27.247176656957432 20.54780520210537 70-74 23.99247852823093 27.412715352950144 27.194186105605528 21.400620013213395 75-79 23.475965687020963 27.836150449215776 28.003654636820468 20.684229226942794 80-84 24.12385859307249 27.174412079783707 28.000816201601797 20.70091312554201 85-89 23.93564740572138 27.47400548342041 27.701619160933216 20.88872794992499 90-94 23.741382912053478 27.783580530603718 27.794025485690412 20.681011071652392 95-99 24.16841244698789 28.082366767155488 27.510091461856828 20.239129323999798 100-104 24.820198928844682 27.70721754654425 27.36036725325172 20.112216271359348 105-109 24.159083938247623 27.957264083427052 27.359165729475514 20.52448624884981 110-114 24.248486713860675 27.485380116959064 27.18272288909408 21.08341028008618 115-119 24.51649022801303 27.575325732899024 27.20378664495114 20.70439739413681 120-124 24.432163861285744 27.646522003650375 27.626242141553437 20.295071993510444 125-129 24.378698224852073 28.24800617442758 27.162335991767428 20.21095960895292 130-134 25.08389708624088 27.582165876524794 26.916315985724175 20.41762105151015 135-139 24.55210836792659 28.34280096132838 26.584006991479136 20.521083679265896 140-144 24.791009245418813 28.118252781929915 27.154957648231193 19.935780324420087 145-149 25.765957446808514 27.952127659574465 26.29255319148936 19.98936170212766 150-151 25.342112057836303 27.794990963077716 27.02039762458043 19.842499354505552 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 52.0 1 29.5 2 4.5 3 1.5 4 1.5 5 2.5 6 3.0 7 4.0 8 3.0 9 1.5 10 1.5 11 1.5 12 1.0 13 1.0 14 1.5 15 1.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.5 21 2.5 22 2.5 23 1.5 24 3.0 25 4.0 26 2.5 27 3.5 28 5.5 29 6.5 30 6.5 31 10.0 32 18.5 33 28.0 34 40.5 35 45.5 36 60.0 37 84.0 38 107.5 39 147.0 40 203.0 41 237.5 42 249.0 43 273.0 44 287.0 45 288.5 46 282.5 47 258.0 48 234.5 49 218.5 50 188.0 51 142.0 52 113.0 53 96.0 54 68.0 55 52.0 56 41.0 57 22.5 58 17.5 59 14.5 60 12.0 61 11.0 62 6.5 63 4.0 64 1.5 65 3.0 66 2.5 67 1.0 68 0.5 69 0.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.15 2 0.8500000000000001 3 1.4749999999999999 4 2.475 5 3.0 6 2.175 7 2.225 8 2.1 9 1.875 10-14 2.2849999999999997 15-19 2.85 20-24 2.3800000000000003 25-29 1.9800000000000002 30-34 1.97 35-39 2.405 40-44 2.91 45-49 3.125 50-54 2.235 55-59 2.33 60-64 2.505 65-69 2.155 70-74 1.6150000000000002 75-79 1.4949999999999999 80-84 1.9849999999999999 85-89 3.345 90-94 4.26 95-99 2.145 100-104 1.975 105-109 2.19 110-114 2.53 115-119 1.76 120-124 1.38 125-129 2.825 130-134 6.135 135-139 8.459999999999999 140-144 9.685 145-149 6.0 150-151 3.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.48979591836735 97.5 2 0.30612244897959184 0.6 3 0.025510204081632654 0.075 4 0.025510204081632654 0.1 5 0.05102040816326531 0.25 6 0.025510204081632654 0.15 7 0.025510204081632654 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.05102040816326531 1.15 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 34 0.8500000000000001 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit CATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAAT 5 0.125 No Hit GGACTGCACGCAAAGAGCAGAGAGAGAGAGAGAGTATCAAAACTAGCAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 5.025 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTCTG 10 0.0070236977 143.63292 5 >>END_MODULE Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra Read 871010 spots for SRR7169951.sra Written 871010 spots for SRR7169951.sra Read 870991 spots for SRR7169951.sra Written 870991 spots for SRR7169951.sra SRR ids: ['SRR7169951.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3alcmrzn SRR7169951.sra spots: 17419839 blocks: [[1, 870991], [870992, 1741982], [1741983, 2612973], [2612974, 3483964], [3483965, 4354955], [4354956, 5225946], [5225947, 6096937], [6096938, 6967928], [6967929, 7838919], [7838920, 8709910], [8709911, 9580901], [9580902, 10451892], [10451893, 11322883], [11322884, 12193874], [12193875, 13064865], [13064866, 13935856], [13935857, 14806847], [14806848, 15677838], [15677839, 16548829], [16548830, 17419839]] SRR7169951 file size 5881311 SRR7169951 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169951 SRR7169951_1.fastq SRR7169951_2.fastq Input file: SRR7169951_1.fastq Paired file: SRR7169951_2.fastq trimmed: SRR7169951-trimmed-pair1.fastq, SRR7169951-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:01:05 2025 >> started Wed Feb 12 05:01:25 2025 >> done (20.340s) 17419839 read pairs processed; of these: 35756 ( 0.21%) short read pairs filtered out after trimming by size control 67624 ( 0.39%) empty read pairs filtered out after trimming by size control 17316459 (99.41%) read pairs available; of these: 8124935 (46.92%) trimmed read pairs available after processing 9191524 (53.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 6 0.00% 21 3 0.00% 22 5 0.00% 23 2 0.00% 24 4 0.00% 25 9 0.00% 26 2 0.00% 27 6 0.00% 28 6 0.00% 29 6 0.00% 30 14 0.00% 31 10 0.00% 32 6 0.00% 33 13 0.00% 34 15 0.00% 35 10 0.00% 36 12 0.00% 37 21 0.00% 38 16 0.00% 39 20 0.00% 40 22 0.00% 41 36 0.00% 42 32 0.00% 43 38 0.00% 44 48 0.00% 45 29 0.00% 46 34 0.00% 47 49 0.00% 48 59 0.00% 49 64 0.00% 50 75 0.00% 51 72 0.00% 52 85 0.00% 53 89 0.00% 54 109 0.00% 55 125 0.00% 56 127 0.00% 57 158 0.00% 58 183 0.00% 59 184 0.00% 60 222 0.00% 61 241 0.00% 62 312 0.00% 63 300 0.00% 64 381 0.00% 65 440 0.00% 66 517 0.00% 67 669 0.00% 68 702 0.00% 69 759 0.00% 70 987 0.01% 71 1005 0.01% 72 1081 0.01% 73 1223 0.01% 74 1317 0.01% 75 1496 0.01% 76 1661 0.01% 77 1802 0.01% 78 1998 0.01% 79 2144 0.01% 80 2496 0.01% 81 2894 0.02% 82 3373 0.02% 83 3802 0.02% 84 5578 0.03% 85 6809 0.04% 86 7013 0.04% 87 7233 0.04% 88 7773 0.04% 89 8134 0.05% 90 8650 0.05% 91 9186 0.05% 92 10068 0.06% 93 10632 0.06% 94 11444 0.07% 95 12361 0.07% 96 13375 0.08% 97 13530 0.08% 98 14296 0.08% 99 15150 0.09% 100 16094 0.09% 101 16529 0.10% 102 17787 0.10% 103 19055 0.11% 104 20148 0.12% 105 21394 0.12% 106 22619 0.13% 107 23476 0.14% 108 24573 0.14% 109 25316 0.15% 110 26170 0.15% 111 27134 0.16% 112 28263 0.16% 113 30047 0.17% 114 31392 0.18% 115 33377 0.19% 116 34552 0.20% 117 36200 0.21% 118 37178 0.21% 119 37735 0.22% 120 38731 0.22% 121 39774 0.23% 122 41354 0.24% 123 43195 0.25% 124 45540 0.26% 125 47353 0.27% 126 49551 0.29% 127 51400 0.30% 128 53648 0.31% 129 55235 0.32% 130 57414 0.33% 131 59392 0.34% 132 61830 0.36% 133 64959 0.38% 134 68610 0.40% 135 72375 0.42% 136 76326 0.44% 137 81983 0.47% 138 89373 0.52% 139 95973 0.55% 140 101403 0.59% 141 109204 0.63% 142 119394 0.69% 143 129907 0.75% 144 144118 0.83% 145 166252 0.96% 146 200426 1.16% 147 258088 1.49% 148 376785 2.18% 149 722524 4.17% 150 3878908 22.40% 151 9191524 53.08% 17316459 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=34 prefix-density=0.27 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=39 fanout-score=76.07 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=14.0 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=37 prefix-density=0.26 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=5 fanout-score=37.67 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.1 sequence=TGTTGGTGGTGG SRR7169951 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:02:14 Started mapping on | Feb 12 05:02:14 Finished on | Feb 12 05:04:10 Mapping speed, Million of reads per hour | 537.41 Number of input reads | 17316459 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16420497 Uniquely mapped reads % | 94.83% Average mapped length | 293.29 Number of splices: Total | 15307685 Number of splices: Annotated (sjdb) | 15065965 Number of splices: GT/AG | 15095805 Number of splices: GC/AG | 169164 Number of splices: AT/AC | 12258 Number of splices: Non-canonical | 30458 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284851 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 33197 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.30% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 636360 636360 636360 N_multimapping 284851 284851 284851 N_noFeature 302046 16211603 388761 N_ambiguous 185344 1073 62354 UnstrandedReadsAssigned:15933107 PositiveStrandReadsAssigned:207821 NegativeStrandReadsAssigned:15969382 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169951 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169951-trimmed-pair1.fastq SRR7169951-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,316,459 reads, 15,878,626 reads pseudoaligned [quant] estimated average fragment length: 235.936 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7169951.ke.tsv 34699 SRR7169951.se.tsv 87100 total ==> SRR7169951.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.06 241 8.54132 Potri.005G024800.1.v4.1 1035 800.064 35 2.76451 Potri.004G059700.1.v4.1 961 726.092 4 0.348132 Potri.007G009000.2.v4.1 1416 1181.06 0 0 Potri.003G141000.2.v4.1 2943 2708.06 287.057 6.69861 Potri.016G087400.1.v4.1 270 82.9805 1197 911.576 Potri.015G069301.1.v4.1 564 334.215 0 0 Potri.010G195200.1.v4.1 1773 1538.06 17 0.698473 Potri.012G127500.1.v4.1 977 742.071 4585 390.453 ==> SRR7169951.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1192 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169951 completed mapping pipeline successfully