Starting /dee2/code/volunteer_pipeline.sh SRR7169952 current disk space = 3048993320960 free memory = 1419220552 SRR7169952 SRAfilesize c1df65dd0f4fa5a290400606d4d114b3 SRR7169952.sra SRR7169952.sra file validated SRR7169952 is paired end SRR7169952 is conventional basespace SRR7169952 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169952_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.26775 34.0 34.0 34.0 33.0 34.0 2 33.5165 34.0 34.0 34.0 33.0 34.0 3 33.56275 34.0 34.0 34.0 33.0 34.0 4 33.55725 34.0 34.0 34.0 33.0 34.0 5 33.589 34.0 34.0 34.0 33.0 34.0 6 37.28725 38.0 38.0 38.0 36.0 38.0 7 37.5455 38.0 38.0 38.0 37.0 38.0 8 37.61875 38.0 38.0 38.0 38.0 38.0 9 37.66 38.0 38.0 38.0 38.0 38.0 10-14 37.6327 38.0 38.0 38.0 38.0 38.0 15-19 37.63615 38.0 38.0 38.0 38.0 38.0 20-24 37.58945 38.0 38.0 38.0 38.0 38.0 25-29 37.56535 38.0 38.0 38.0 38.0 38.0 30-34 37.56699999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.523649999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.312599999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.3996 38.0 38.0 38.0 37.0 38.0 50-54 37.379549999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.32065 38.0 38.0 38.0 37.0 38.0 60-64 37.3039 38.0 38.0 38.0 37.0 38.0 65-69 37.22925 38.0 38.0 38.0 37.0 38.0 70-74 37.053599999999996 38.0 38.0 38.0 36.6 38.0 75-79 36.28425 38.0 38.0 38.0 35.6 38.0 80-84 36.167899999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.1319 38.0 38.0 38.0 35.0 38.0 90-94 35.967200000000005 38.0 38.0 38.0 34.4 38.0 95-99 35.8245 38.0 38.0 38.0 34.0 38.0 100-104 35.8178 38.0 38.0 38.0 34.0 38.0 105-109 35.72935 38.0 38.0 38.0 33.8 38.0 110-114 35.58825 38.0 38.0 38.0 33.2 38.0 115-119 35.36535 38.0 37.6 38.0 32.0 38.0 120-124 35.18554999999999 38.0 37.4 38.0 30.6 38.0 125-129 34.8909 38.0 37.0 38.0 28.0 38.0 130-134 34.6798 38.0 36.2 38.0 27.6 38.0 135-139 34.367399999999996 38.0 36.0 38.0 25.2 38.0 140-144 34.07415 38.0 35.4 38.0 23.4 38.0 145-149 33.53085 38.0 35.0 38.0 17.6 38.0 150-151 30.584625 36.5 29.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 2.0 15 3.0 16 2.0 17 8.0 18 29.0 19 65.0 20 6.0 21 4.0 22 5.0 23 7.0 24 7.0 25 16.0 26 10.0 27 19.0 28 21.0 29 25.0 30 40.0 31 40.0 32 52.0 33 72.0 34 107.0 35 181.0 36 444.0 37 2829.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.812720848056536 13.629480060575466 12.87228672387683 32.685512367491164 2 22.400000000000002 18.75 31.525 27.325 3 19.175 20.974999999999998 28.599999999999998 31.25 4 21.275 27.500000000000004 23.175 28.050000000000004 5 23.599999999999998 31.900000000000002 22.875 21.625 6 21.25 34.599999999999994 24.8 19.35 7 13.225000000000001 29.575000000000003 38.800000000000004 18.4 8 16.85 29.875 30.5 22.775000000000002 9 18.625 25.174999999999997 32.75 23.45 10-14 19.015 31.465 26.540000000000003 22.98 15-19 19.02 30.545 27.02 23.415 20-24 19.515 30.575000000000003 27.279999999999998 22.63 25-29 19.009999999999998 30.095 27.46 23.435 30-34 18.455 29.970000000000002 27.505000000000003 24.07 35-39 19.905 30.064999999999998 26.415 23.615 40-44 18.725 30.330000000000002 27.375 23.57 45-49 20.13201320132013 29.17791779177918 27.367736773677372 23.32233223322332 50-54 19.16 29.2 26.935 24.705 55-59 19.64 28.395 28.294999999999998 23.669999999999998 60-64 19.939999999999998 30.005 26.840000000000003 23.215 65-69 18.435000000000002 31.445 26.705000000000002 23.415 70-74 19.189999999999998 31.019999999999996 27.08 22.71 75-79 19.52 30.64 26.61 23.23 80-84 19.05 29.685 27.065 24.2 85-89 20.056044835868693 28.938150520416333 27.116693354683747 23.889111289031227 90-94 19.17168674698795 28.960843373493976 27.339357429718874 24.528112449799195 95-99 19.130565734651874 28.92927061894483 27.799809246523772 24.140354399879524 100-104 19.40388077615523 30.251050210042006 26.6753350670134 23.66973394678936 105-109 19.785 30.945 26.085 23.185 110-114 19.400000000000002 30.275000000000002 26.834999999999997 23.49 115-119 20.172017201720173 30.30803080308031 25.79257925792579 23.72737273727373 120-124 20.13 29.625 26.205000000000002 24.04 125-129 20.305 29.404999999999998 26.465 23.825 130-134 20.093083775397858 29.271344209788808 26.368731858672806 24.266840156140525 135-139 20.58528763279214 29.53497694928843 26.03728202044498 23.842453397474443 140-144 20.21212727636582 29.372623574144484 26.13067840704423 24.284570742445467 145-149 20.62769045950546 29.352287516267893 25.698268094904396 24.321753929322256 150-151 20.4 28.549999999999997 26.3 24.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.0 22 1.0 23 3.5 24 3.0 25 2.0 26 6.5 27 16.0 28 20.0 29 21.5 30 25.5 31 37.0 32 51.0 33 57.0 34 74.5 35 93.5 36 105.0 37 118.0 38 146.5 39 175.0 40 206.0 41 225.5 42 231.5 43 241.0 44 258.5 45 271.5 46 252.5 47 235.5 48 228.0 49 187.5 50 136.5 51 117.5 52 102.5 53 89.0 54 64.0 55 44.0 56 33.5 57 25.0 58 25.5 59 16.5 60 11.0 61 11.0 62 6.5 63 4.5 64 4.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.08 90-94 0.4 95-99 0.395 100-104 0.02 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.09 135-139 0.22 140-144 0.06 145-149 0.11 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91332470892627 95.575 2 1.0608020698576974 2.0500000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0258732212160414 2.375 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGAAGATCTCGTATGC 95 2.375 TruSeq Adapter, Index 10 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.025 0.0 92-93 0.9375 0.0 0.0 0.025 0.0 94-95 1.075 0.0 0.0 0.025 0.0 96-97 1.3125 0.0 0.0 0.025 0.0 98-99 1.5375 0.0 0.0 0.025 0.0 100-101 1.7125 0.025 0.0 0.025 0.0 102-103 1.9125 0.025 0.0 0.025 0.0 104-105 2.2249999999999996 0.025 0.0 0.025 0.0 106-107 2.5999999999999996 0.025 0.0 0.025 0.0 108-109 2.8125 0.025 0.0 0.025 0.0 110-111 3.1125 0.025 0.0 0.025 0.0 112-113 3.3875 0.025 0.0 0.025 0.0 114-115 3.6624999999999996 0.025 0.0 0.025 0.0 116-117 4.1375 0.025 0.0 0.025 0.0 118-119 4.65 0.025 0.0 0.025 0.0 120-121 5.025 0.025 0.0 0.025 0.0 122-123 5.5625 0.025 0.0 0.025 0.0 124-125 6.112500000000001 0.025 0.0 0.025 0.0 126-127 6.8125 0.025 0.0 0.025 0.0 128-129 7.225 0.025 0.0 0.025 0.0 130-131 7.725 0.025 0.0 0.025 0.0 132-133 8.2125 0.025 0.0 0.025 0.0 134-135 9.0125 0.025 0.0 0.025 0.0 136-137 9.875 0.025 0.0 0.025 0.0 138-139 10.6125 0.025 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 45 0.008957279 48.333332 9 AGAGCAC 45 0.008957279 48.333332 8 >>END_MODULE SRR7169952 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169952_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.234 33.0 33.0 34.0 32.0 34.0 2 32.41925 34.0 33.0 34.0 32.0 34.0 3 32.3775 34.0 33.0 34.0 32.0 34.0 4 32.32925 34.0 33.0 34.0 32.0 34.0 5 32.201 34.0 33.0 34.0 32.0 34.0 6 36.18175 38.0 38.0 38.0 36.0 38.0 7 36.226 38.0 38.0 38.0 36.0 38.0 8 36.17575 38.0 38.0 38.0 36.0 38.0 9 36.22075 38.0 38.0 38.0 36.0 38.0 10-14 36.154250000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.1149 38.0 38.0 38.0 36.0 38.0 20-24 36.149649999999994 38.0 38.0 38.0 36.2 38.0 25-29 36.181799999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.16555000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.072 38.0 38.0 38.0 36.0 38.0 40-44 36.00965 38.0 38.0 38.0 35.8 38.0 45-49 35.881800000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.0097 38.0 38.0 38.0 35.4 38.0 55-59 36.0606 38.0 38.0 38.0 36.0 38.0 60-64 36.0058 38.0 38.0 38.0 35.8 38.0 65-69 35.7322 38.0 38.0 38.0 35.0 38.0 70-74 35.198150000000005 38.0 38.0 38.0 33.0 38.0 75-79 35.1408 38.0 38.0 38.0 32.6 38.0 80-84 35.07525 38.0 38.0 38.0 31.8 38.0 85-89 34.731049999999996 38.0 38.0 38.0 28.6 38.0 90-94 34.4257 38.0 38.0 38.0 25.8 38.0 95-99 34.72725 38.0 38.0 38.0 28.0 38.0 100-104 34.813 38.0 38.0 38.0 29.0 38.0 105-109 34.654450000000004 38.0 38.0 38.0 28.0 38.0 110-114 34.5005 38.0 38.0 38.0 26.2 38.0 115-119 34.39895 38.0 38.0 38.0 25.2 38.0 120-124 34.217650000000006 38.0 37.4 38.0 22.6 38.0 125-129 33.825 38.0 36.6 38.0 17.2 38.0 130-134 32.831 38.0 35.8 38.0 6.4 38.0 135-139 31.98105 38.0 34.8 38.0 2.0 38.0 140-144 31.1027 38.0 33.2 38.0 2.0 38.0 145-149 30.737650000000002 38.0 32.8 38.0 2.0 38.0 150-151 26.970125 35.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 113.0 3 3.0 4 2.0 5 2.0 6 5.0 7 1.0 8 3.0 9 3.0 10 0.0 11 6.0 12 3.0 13 5.0 14 2.0 15 5.0 16 14.0 17 69.0 18 21.0 19 8.0 20 6.0 21 8.0 22 2.0 23 11.0 24 16.0 25 15.0 26 22.0 27 27.0 28 31.0 29 35.0 30 44.0 31 61.0 32 70.0 33 127.0 34 124.0 35 141.0 36 364.0 37 2631.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.63297600816743 19.47422154160286 15.952016334864727 23.940786115364983 2 25.309734513274336 30.24020227560051 27.939317319848296 16.510745891276866 3 22.583100735853844 29.99238771885308 29.941639177873636 17.482872367419436 4 23.798568507157462 32.464212678936605 22.00920245398773 21.7280163599182 5 26.384615384615383 34.05128205128205 21.435897435897434 18.128205128205128 6 23.936442849820605 34.64889800102512 23.347001537672988 18.06765761148129 7 20.37416709379805 24.269605330599692 35.776524859046646 19.579702716555612 8 23.449513070220398 27.75499743721169 25.75602255253716 23.039466940030753 9 24.71249680552006 24.533605928954767 27.804753386148732 22.94914387937644 10-14 24.554831426078923 28.20854928926977 26.212346692666905 21.0242725919844 15-19 24.4263813149501 27.626299001954933 27.600576190966148 20.34674349212882 20-24 24.296570137605258 28.624974327377284 26.884370507291024 20.194085027726434 25-29 24.396865235875634 28.970957332377196 26.307432259386367 20.324745172360807 30-34 24.010040469238255 27.764971056810616 28.046718918088214 20.178269555862915 35-39 23.3968270267495 27.401550546798788 27.80715715972686 21.394465266724854 40-44 25.180078205392054 27.665157439802428 27.1660835562873 19.988680798518214 45-49 24.365377683950364 27.377580969054115 27.187065547603112 21.06997579939241 50-54 24.273933309429903 27.63919479588178 28.23848793730472 19.8483839573836 55-59 24.388868959155435 28.31958181725004 27.822477322810435 19.469071900784094 60-64 23.142065284335867 29.870663108191337 27.171012112502567 19.816259494970232 65-69 23.60022539828902 29.224937247067263 27.447364376824957 19.727472977818756 70-74 24.159942804616485 28.919415790011232 26.616280257379227 20.304361147993056 75-79 24.742425788024075 28.77690502907273 26.787718045496277 19.692951137406915 80-84 23.715132318381528 28.451006437110454 28.180239092673954 19.653622151834067 85-89 24.445249056018206 28.128071173640922 27.409093260228623 20.017586510112242 90-94 24.884265279583875 28.60338101430429 26.798439531859557 19.713914174252274 95-99 24.36948944022965 28.62415419315153 27.68607750666393 19.32027885995489 100-104 24.315891770241933 28.561198915656487 27.814434044294412 19.30847526980717 105-109 23.780237802378025 28.58241082410824 27.67527675276753 19.962074620746208 110-114 23.530919905650702 28.417598195056915 28.60732232591529 19.44415957337709 115-119 24.255579958118393 28.41820317687318 27.77465651974054 19.55156034526789 120-124 25.06868830772362 28.23343848580442 27.973949323292967 18.723923883178998 125-129 24.66310050406337 28.299557658677095 27.862359839522682 19.174981997736857 130-134 25.134394434489298 28.38094234215242 27.347949826077787 19.136713397280488 135-139 24.574405241394125 28.489339992481604 27.608613930508564 19.327640835615703 140-144 24.652834504165984 28.85149485378206 27.451941403910034 19.043729238141914 145-149 25.813781441555694 28.144155569647012 27.161276685690126 18.880786303107165 150-151 25.03550677856682 28.94770819883796 26.31375080697224 19.703034215622985 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 58.0 1 33.5 2 10.0 3 7.5 4 3.0 5 1.0 6 1.5 7 2.5 8 1.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 2.5 16 2.5 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.5 23 2.0 24 2.0 25 3.5 26 3.0 27 2.5 28 5.0 29 9.0 30 12.0 31 11.5 32 19.0 33 34.0 34 41.0 35 46.0 36 71.5 37 105.5 38 134.5 39 160.0 40 171.0 41 205.5 42 258.5 43 278.5 44 283.5 45 284.5 46 274.0 47 269.5 48 239.0 49 194.0 50 171.0 51 135.5 52 101.0 53 88.5 54 75.5 55 53.5 56 36.5 57 28.5 58 24.5 59 18.0 60 12.0 61 11.5 62 10.0 63 5.0 64 1.0 65 0.5 66 1.0 67 1.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.0500000000000003 2 1.125 3 1.4749999999999999 4 2.1999999999999997 5 2.5 6 2.45 7 2.45 8 2.45 9 2.175 10-14 2.565 15-19 2.81 20-24 2.62 25-29 2.385 30-34 2.395 35-39 2.6149999999999998 40-44 2.82 45-49 2.895 50-54 2.385 55-59 2.435 60-64 2.58 65-69 2.395 70-74 2.09 75-79 1.97 80-84 2.13 85-89 3.335 90-94 3.875 95-99 2.46 100-104 2.245 105-109 2.44 110-114 2.4899999999999998 115-119 2.105 120-124 1.73 125-129 2.79 130-134 5.13 135-139 6.895 140-144 8.185 145-149 5.38 150-151 3.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.58118759852864 93.8 2 1.2348922753547031 2.35 3 0.0788229111928534 0.22499999999999998 4 0.0 0.0 5 0.02627430373095113 0.125 6 0.02627430373095113 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02627430373095113 1.125 >50 0.02627430373095113 2.225 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 89 2.225 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 45 1.125 No Hit NGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3625 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.3499999999999996 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.9125 0.0 0.0 0.0 0.0 112-113 3.1500000000000004 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.975 0.0 0.0 0.0 0.0 118-119 4.475 0.0 0.0 0.0 0.0 120-121 4.8625 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.8625 0.0 0.0 0.0 0.0 126-127 6.525 0.0 0.0 0.0 0.0 128-129 6.9125 0.0 0.0 0.0 0.0 130-131 7.3625 0.0 0.0 0.0 0.0 132-133 7.824999999999999 0.0 0.0 0.0 0.0 134-135 8.600000000000001 0.0 0.0 0.0 0.0 136-137 9.350000000000001 0.0 0.0 0.0 0.0 138-139 10.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 45 0.00926116 47.91561 9 AGAGCGT 45 0.00926116 47.91561 8 AAAAAAA 345 8.0075864E-5 6.2498627 60-64 >>END_MODULE Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716216 spots for SRR7169952.sra Written 716216 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra Read 716199 spots for SRR7169952.sra Written 716199 spots for SRR7169952.sra SRR ids: ['SRR7169952.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8yy6gou_ SRR7169952.sra spots: 14323997 blocks: [[1, 716199], [716200, 1432398], [1432399, 2148597], [2148598, 2864796], [2864797, 3580995], [3580996, 4297194], [4297195, 5013393], [5013394, 5729592], [5729593, 6445791], [6445792, 7161990], [7161991, 7878189], [7878190, 8594388], [8594389, 9310587], [9310588, 10026786], [10026787, 10742985], [10742986, 11459184], [11459185, 12175383], [12175384, 12891582], [12891583, 13607781], [13607782, 14323997]] SRR7169952 file size 4832232 SRR7169952 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169952 SRR7169952_1.fastq SRR7169952_2.fastq Input file: SRR7169952_1.fastq Paired file: SRR7169952_2.fastq trimmed: SRR7169952-trimmed-pair1.fastq, SRR7169952-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:17:03 2025 >> started Wed Feb 12 05:17:20 2025 >> done (16.658s) 14323997 read pairs processed; of these: 27623 ( 0.19%) short read pairs filtered out after trimming by size control 338235 ( 2.36%) empty read pairs filtered out after trimming by size control 13958139 (97.45%) read pairs available; of these: 6497183 (46.55%) trimmed read pairs available after processing 7460956 (53.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 14 0.00% 20 13 0.00% 21 11 0.00% 22 11 0.00% 23 12 0.00% 24 14 0.00% 25 21 0.00% 26 10 0.00% 27 16 0.00% 28 22 0.00% 29 26 0.00% 30 31 0.00% 31 18 0.00% 32 34 0.00% 33 29 0.00% 34 25 0.00% 35 28 0.00% 36 36 0.00% 37 43 0.00% 38 42 0.00% 39 42 0.00% 40 56 0.00% 41 64 0.00% 42 61 0.00% 43 68 0.00% 44 129 0.00% 45 170 0.00% 46 171 0.00% 47 164 0.00% 48 188 0.00% 49 219 0.00% 50 212 0.00% 51 243 0.00% 52 263 0.00% 53 281 0.00% 54 321 0.00% 55 320 0.00% 56 344 0.00% 57 395 0.00% 58 451 0.00% 59 433 0.00% 60 554 0.00% 61 580 0.00% 62 618 0.00% 63 758 0.01% 64 933 0.01% 65 1152 0.01% 66 1512 0.01% 67 1420 0.01% 68 1595 0.01% 69 2431 0.02% 70 4606 0.03% 71 3521 0.03% 72 2756 0.02% 73 2683 0.02% 74 2590 0.02% 75 2875 0.02% 76 3182 0.02% 77 3376 0.02% 78 3729 0.03% 79 4127 0.03% 80 4538 0.03% 81 5169 0.04% 82 5835 0.04% 83 6415 0.05% 84 8382 0.06% 85 9725 0.07% 86 10174 0.07% 87 10969 0.08% 88 11632 0.08% 89 12331 0.09% 90 12984 0.09% 91 13392 0.10% 92 14327 0.10% 93 15363 0.11% 94 16367 0.12% 95 17650 0.13% 96 18252 0.13% 97 18879 0.14% 98 19160 0.14% 99 19843 0.14% 100 21266 0.15% 101 21894 0.16% 102 23517 0.17% 103 24460 0.18% 104 25896 0.19% 105 26976 0.19% 106 28557 0.20% 107 28602 0.20% 108 28795 0.21% 109 30195 0.22% 110 30588 0.22% 111 31821 0.23% 112 33219 0.24% 113 35203 0.25% 114 36217 0.26% 115 37920 0.27% 116 38789 0.28% 117 39553 0.28% 118 39578 0.28% 119 39265 0.28% 120 40452 0.29% 121 41489 0.30% 122 43478 0.31% 123 45543 0.33% 124 46565 0.33% 125 48631 0.35% 126 49704 0.36% 127 50662 0.36% 128 52228 0.37% 129 53148 0.38% 130 54286 0.39% 131 55201 0.40% 132 57471 0.41% 133 60008 0.43% 134 62833 0.45% 135 65308 0.47% 136 68769 0.49% 137 70975 0.51% 138 74855 0.54% 139 79135 0.57% 140 82805 0.59% 141 87660 0.63% 142 93029 0.67% 143 99504 0.71% 144 113076 0.81% 145 123702 0.89% 146 143565 1.03% 147 184661 1.32% 148 275583 1.97% 149 487040 3.49% 150 2762062 19.79% 151 7460956 53.45% 13958139 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.46 fanout-score-rank=14 prefix-density=0.29 prefix-fanout=5.3 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=212.47 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=10.5 sequence=ATAGCAGCAAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTAAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=20.80 fanout-score-rank=7 prefix-density=0.43 prefix-fanout=8.3 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=232.58 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=14.0 sequence=AGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGAAGCTTGCTTCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGC SRR7169952 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:18:03 Started mapping on | Feb 12 05:18:04 Finished on | Feb 12 05:19:37 Mapping speed, Million of reads per hour | 540.32 Number of input reads | 13958139 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 13144159 Uniquely mapped reads % | 94.17% Average mapped length | 290.41 Number of splices: Total | 10832631 Number of splices: Annotated (sjdb) | 10608236 Number of splices: GT/AG | 10668863 Number of splices: GC/AG | 125927 Number of splices: AT/AC | 9551 Number of splices: Non-canonical | 28290 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240056 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 24294 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.87% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 596894 596894 596894 N_multimapping 240056 240056 240056 N_noFeature 320431 12951428 398119 N_ambiguous 170630 625 55300 UnstrandedReadsAssigned:12653098 PositiveStrandReadsAssigned:192106 NegativeStrandReadsAssigned:12690740 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169952 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169952-trimmed-pair1.fastq SRR7169952-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,958,139 reads, 12,666,720 reads pseudoaligned [quant] estimated average fragment length: 219.059 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7169952.ke.tsv 34699 SRR7169952.se.tsv 87100 total ==> SRR7169952.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.94 301 11.9589 Potri.005G024800.1.v4.1 1035 816.941 40 3.50149 Potri.004G059700.1.v4.1 961 742.947 10 0.962556 Potri.007G009000.2.v4.1 1416 1197.94 0 0 Potri.003G141000.2.v4.1 2943 2724.94 197.195 5.17513 Potri.016G087400.1.v4.1 270 89.5754 1501.51 1198.74 Potri.015G069301.1.v4.1 564 348.481 0 0 Potri.010G195200.1.v4.1 1773 1554.94 13 0.597879 Potri.012G127500.1.v4.1 977 758.947 6196 583.826 ==> SRR7169952.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1067 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169952 completed mapping pipeline successfully