Starting /dee2/code/volunteer_pipeline.sh SRR7169953 current disk space = 3049059205120 free memory = 1579020120 SRR7169953 SRAfilesize e616107289e814051912d8b73d4e6d9c SRR7169953.sra SRR7169953.sra file validated SRR7169953 is paired end SRR7169953 is conventional basespace SRR7169953 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.52975 34.0 34.0 34.0 33.0 34.0 2 33.6715 34.0 34.0 34.0 33.0 34.0 3 33.70925 34.0 34.0 34.0 33.0 34.0 4 33.696 34.0 34.0 34.0 33.0 34.0 5 33.738 34.0 34.0 34.0 33.0 34.0 6 37.34225 38.0 38.0 38.0 36.0 38.0 7 37.654 38.0 38.0 38.0 37.0 38.0 8 37.6125 38.0 38.0 38.0 38.0 38.0 9 37.67175 38.0 38.0 38.0 38.0 38.0 10-14 37.6512 38.0 38.0 38.0 38.0 38.0 15-19 37.62135 38.0 38.0 38.0 38.0 38.0 20-24 37.5928 38.0 38.0 38.0 38.0 38.0 25-29 37.53035 38.0 38.0 38.0 38.0 38.0 30-34 37.4529 38.0 38.0 38.0 37.8 38.0 35-39 37.30265 38.0 38.0 38.0 37.2 38.0 40-44 36.87225 38.0 38.0 38.0 35.4 38.0 45-49 36.872 38.0 38.0 38.0 35.4 38.0 50-54 36.75675 38.0 38.0 38.0 35.0 38.0 55-59 36.74315 38.0 38.0 38.0 35.0 38.0 60-64 36.67190000000001 38.0 38.0 38.0 34.4 38.0 65-69 36.53150000000001 38.0 38.0 38.0 34.0 38.0 70-74 36.3569 38.0 38.0 38.0 34.0 38.0 75-79 35.6385 38.0 37.4 38.0 32.4 38.0 80-84 35.43875 38.0 37.0 38.0 31.6 38.0 85-89 35.3098 38.0 37.0 38.0 30.2 38.0 90-94 35.08605 38.0 36.8 38.0 29.0 38.0 95-99 34.8546 38.0 36.4 38.0 28.4 38.0 100-104 34.8662 38.0 36.2 38.0 28.6 38.0 105-109 34.6873 38.0 36.0 38.0 27.6 38.0 110-114 34.28165 38.0 35.4 38.0 25.0 38.0 115-119 33.929700000000004 38.0 35.0 38.0 22.6 38.0 120-124 33.6078 38.0 34.4 38.0 16.2 38.0 125-129 33.271550000000005 38.0 34.0 38.0 15.0 38.0 130-134 32.90435 38.0 34.0 38.0 15.0 38.0 135-139 32.209799999999994 37.8 33.2 38.0 14.2 38.0 140-144 31.378200000000003 36.2 31.0 38.0 13.4 38.0 145-149 30.582399999999996 36.0 31.0 38.0 6.4 38.0 150-151 26.027 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 2.0 12 0.0 13 5.0 14 12.0 15 8.0 16 8.0 17 4.0 18 32.0 19 51.0 20 13.0 21 16.0 22 11.0 23 18.0 24 22.0 25 13.0 26 19.0 27 32.0 28 17.0 29 40.0 30 42.0 31 66.0 32 80.0 33 122.0 34 220.0 35 380.0 36 1120.0 37 1642.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.19095477386934 14.321608040201006 12.889447236180903 34.597989949748744 2 21.825 16.825000000000003 31.125000000000004 30.225 3 20.8 18.875 26.525 33.800000000000004 4 21.7 26.3 22.475 29.525000000000002 5 23.375 30.325000000000003 24.75 21.55 6 22.325 32.875 26.0 18.8 7 15.375 30.0 37.375 17.25 8 17.525 31.374999999999996 29.9 21.2 9 17.325 27.875 33.7 21.099999999999998 10-14 18.275 31.929999999999996 27.095000000000002 22.7 15-19 18.43 30.330000000000002 27.915 23.325000000000003 20-24 18.875 30.320000000000004 28.08 22.725 25-29 18.92 30.42 27.375 23.285 30-34 18.25 31.06 27.150000000000002 23.54 35-39 17.815 29.84 27.900000000000002 24.445 40-44 18.565 30.409999999999997 27.325 23.7 45-49 19.189999999999998 29.604999999999997 28.375 22.830000000000002 50-54 19.375 29.505 27.46 23.66 55-59 19.345000000000002 29.435 28.22 23.0 60-64 18.884999999999998 29.98 27.775 23.36 65-69 19.145 31.95 26.14 22.765 70-74 19.02 31.319999999999997 26.57 23.09 75-79 18.709999999999997 31.305 26.625 23.36 80-84 18.975 30.255 27.500000000000004 23.27 85-89 19.400000000000002 29.895 26.365 24.34 90-94 19.3824441997798 29.45150635572015 27.13442097888099 24.031628465619058 95-99 19.70872328712277 29.9784795555778 26.68034632901256 23.63245082828687 100-104 19.695 30.595 27.134999999999998 22.575 105-109 19.37 30.64 26.38 23.61 110-114 19.56 31.05 26.314999999999998 23.075000000000003 115-119 19.76598829941497 31.056552827641383 25.676283814190707 23.50117505875294 120-124 19.8399599899975 30.632658164541137 26.236559139784948 23.29082270567642 125-129 19.905 29.744999999999997 26.44 23.91 130-134 19.24173460711249 30.230580703246133 26.129145200820286 24.398539488821086 135-139 20.281084325297588 30.08402520756227 26.2778833650095 23.357007102130638 140-144 20.017005952083228 29.900465162806984 25.764017406092133 24.31851147901766 145-149 19.988995047771496 29.583312490620777 26.09174128357761 24.335951178030115 150-151 20.002500312539066 31.028878609826226 24.82810351293912 24.14051756469559 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.5 5 0.5 6 1.0 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 0.5 20 0.0 21 2.0 22 4.0 23 5.0 24 6.5 25 9.0 26 18.5 27 24.0 28 18.5 29 22.0 30 43.5 31 59.5 32 65.5 33 71.0 34 82.5 35 107.5 36 122.0 37 141.0 38 160.5 39 178.0 40 196.5 41 216.5 42 243.5 43 255.0 44 244.0 45 220.5 46 200.0 47 185.5 48 169.5 49 152.5 50 141.5 51 113.0 52 94.5 53 91.0 54 74.5 55 60.5 56 47.5 57 37.0 58 26.5 59 18.5 60 18.0 61 12.5 62 9.5 63 8.0 64 4.5 65 2.0 66 1.0 67 1.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.09 95-99 0.095 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.025 125-129 0.0 130-134 0.034999999999999996 135-139 0.03 140-144 0.034999999999999996 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 97.755155311929 93.625 2 2.0099190811798486 3.85 3 0.10441138084051162 0.3 4 0.07830853563038372 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026102845210127904 0.375 >50 0.026102845210127904 1.55 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTCTCATCTCGTATGC 62 1.55 TruSeq Adapter, Index 13 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACACTCTCATCTCGTATGCC 15 0.375 TruSeq Adapter, Index 13 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9874999999999999 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.575 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0875 0.0 0.0 0.0 0.0 108-109 2.4875 0.0 0.0 0.0 0.0 110-111 2.75 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.3375000000000004 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.475 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.275 0.0 0.0 0.0 0.0 126-127 5.825 0.0 0.0 0.0 0.0 128-129 6.525 0.0 0.0 0.0 0.0 130-131 6.887499999999999 0.0 0.0 0.0 0.0 132-133 7.425000000000001 0.0 0.0 0.0 0.0 134-135 8.05 0.0 0.0 0.0 0.0 136-137 8.649999999999999 0.0 0.0 0.0 0.0 138-139 9.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169953 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169953_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04725 34.0 33.0 34.0 33.0 34.0 2 33.132 34.0 33.0 34.0 33.0 34.0 3 33.035 34.0 33.0 34.0 33.0 34.0 4 32.866 34.0 33.0 34.0 33.0 34.0 5 33.00425 34.0 33.0 34.0 33.0 34.0 6 37.07375 38.0 38.0 38.0 38.0 38.0 7 37.1965 38.0 38.0 38.0 38.0 38.0 8 37.17275 38.0 38.0 38.0 38.0 38.0 9 37.17425 38.0 38.0 38.0 38.0 38.0 10-14 36.98545 38.0 38.0 38.0 38.0 38.0 15-19 36.8803 38.0 38.0 38.0 38.0 38.0 20-24 36.91955 38.0 38.0 38.0 38.0 38.0 25-29 36.893100000000004 38.0 38.0 38.0 38.0 38.0 30-34 36.952650000000006 38.0 38.0 38.0 38.0 38.0 35-39 36.841300000000004 38.0 38.0 38.0 38.0 38.0 40-44 36.75695 38.0 38.0 38.0 37.4 38.0 45-49 36.7353 38.0 38.0 38.0 37.2 38.0 50-54 36.85209999999999 38.0 38.0 38.0 37.2 38.0 55-59 36.8647 38.0 38.0 38.0 37.0 38.0 60-64 36.7868 38.0 38.0 38.0 37.0 38.0 65-69 36.557 38.0 38.0 38.0 36.6 38.0 70-74 36.088 38.0 38.0 38.0 36.0 38.0 75-79 36.04259999999999 38.0 38.0 38.0 35.8 38.0 80-84 35.8815 38.0 38.0 38.0 35.4 38.0 85-89 35.5649 38.0 38.0 38.0 34.2 38.0 90-94 35.47055 38.0 38.0 38.0 34.0 38.0 95-99 35.6624 38.0 38.0 38.0 34.0 38.0 100-104 35.60765 38.0 38.0 38.0 34.0 38.0 105-109 35.4879 38.0 38.0 38.0 33.8 38.0 110-114 35.33515 38.0 38.0 38.0 32.6 38.0 115-119 35.187 38.0 38.0 38.0 32.2 38.0 120-124 34.979549999999996 38.0 38.0 38.0 30.2 38.0 125-129 34.5861 38.0 37.0 38.0 27.6 38.0 130-134 33.77755 38.0 36.0 38.0 18.8 38.0 135-139 33.120200000000004 38.0 35.0 38.0 13.8 38.0 140-144 32.45269999999999 38.0 33.8 38.0 4.2 38.0 145-149 31.882050000000003 38.0 33.0 38.0 2.0 38.0 150-151 27.862875000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 32.0 3 16.0 4 3.0 5 0.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 0.0 12 2.0 13 3.0 14 4.0 15 13.0 16 13.0 17 48.0 18 29.0 19 8.0 20 8.0 21 11.0 22 9.0 23 7.0 24 6.0 25 9.0 26 10.0 27 14.0 28 26.0 29 17.0 30 39.0 31 51.0 32 78.0 33 94.0 34 103.0 35 150.0 36 415.0 37 2772.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.59077231695085 19.934804413239718 16.800401203610832 24.674022066198596 2 25.58314522197141 28.36719337848006 27.63982944569852 18.409831953850013 3 21.6515609264854 29.582074521651563 30.16112789526687 18.605236656596173 4 25.828484695168225 30.887933215279535 23.37465216291424 19.908929926637995 5 25.99396074484147 35.153497735279316 22.093608454957224 16.758933064921994 6 23.09045226130653 35.85427135678392 23.316582914572866 17.738693467336685 7 21.898543445504774 24.510296333500754 35.05775991963837 18.533400301356103 8 23.31827309236948 26.506024096385545 26.656626506024097 23.519076305220885 9 24.290379301682993 25.62170308967596 28.384827932680228 21.70308967596081 10-14 24.66811367422139 28.529604765029532 25.586795214779666 21.21548634596941 15-19 25.489402600030353 26.77930092569174 27.65946684202539 20.071829632252516 20-24 25.49682235448401 28.528195299102187 26.32906284676687 19.645919499646926 25-29 24.1233160098895 28.58872798829406 26.984207074019878 20.30374892779656 30-34 24.41397388718052 27.998185209457077 27.731007712859807 19.856833190502595 35-39 23.46840694086103 28.05180351090201 27.70779582131836 20.771993726918602 40-44 25.42355686314294 27.33590341889013 27.391701329004768 19.848838388962157 45-49 24.69974154968834 26.513961384482847 27.49201844625754 21.294278619571276 50-54 24.437607182487643 28.049026530818118 27.776656915161908 19.73670937153233 55-59 23.764373613072422 28.621141819648983 28.737139398829935 18.87734516844866 60-64 23.572837134044597 29.822521110380745 27.299388178186785 19.305253577387873 65-69 23.61391129032258 29.112903225806452 27.696572580645164 19.576612903225808 70-74 23.742343608796062 29.249924691234057 27.427452555477455 19.58027914449242 75-79 23.873851252950335 28.976045799226636 27.88630542861447 19.263797519208556 80-84 23.43269279265648 28.98068290714682 27.765168709335754 19.82145559086095 85-89 24.593589155582734 28.26784895275952 27.498343780257862 19.64021811139989 90-94 23.69385884509624 28.15969039617069 28.439759649658825 19.706691109074242 95-99 23.661815801399868 28.78291958306058 27.99234603957903 19.562918575960524 100-104 23.725657927841795 28.189000150958588 28.465757560509235 19.619584360690386 105-109 23.36420374471512 28.920877793436684 28.045097644453392 19.669820817394807 110-114 23.883083446918068 29.33010247867131 27.81059114543894 18.97622292897168 115-119 24.41047815375333 28.588667102418423 27.899844134948964 19.101010608879278 120-124 24.140181754280263 27.93091329015414 28.56855952201637 19.360345433549227 125-129 24.209511241942852 28.828097244074506 28.208902197634877 18.753489316347764 130-134 24.70254957507082 28.80762297192892 27.81354622714396 18.676281225856297 135-139 24.68288625493866 29.330422125181947 27.20939904346018 18.777292576419214 140-144 24.755376484747003 29.03040133954267 27.60713725079797 18.607084924912353 145-149 25.040950040950037 28.603603603603606 27.57985257985258 18.775593775593777 150-151 25.814218730198963 28.41211506779876 27.32226587251299 18.451400329489292 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 4.0 2 2.0 3 2.5 4 2.5 5 2.5 6 2.5 7 2.0 8 2.0 9 0.5 10 0.0 11 0.5 12 1.5 13 1.5 14 1.5 15 1.0 16 1.5 17 2.0 18 0.5 19 1.5 20 1.5 21 0.0 22 1.5 23 1.5 24 1.0 25 3.0 26 4.5 27 8.0 28 8.5 29 9.0 30 17.5 31 17.5 32 24.5 33 38.0 34 53.5 35 71.0 36 87.0 37 112.5 38 139.0 39 166.0 40 205.0 41 241.0 42 267.0 43 270.0 44 267.5 45 260.5 46 242.5 47 227.0 48 211.0 49 189.0 50 158.0 51 130.0 52 103.0 53 89.0 54 79.0 55 66.0 56 50.5 57 36.5 58 28.0 59 23.5 60 16.0 61 9.0 62 10.0 63 10.0 64 4.5 65 1.0 66 0.5 67 2.0 68 1.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.325 3 0.7000000000000001 4 1.175 5 0.65 6 0.5 7 0.44999999999999996 8 0.4 9 0.475 10-14 0.9450000000000001 15-19 1.155 20-24 0.8699999999999999 25-29 0.905 30-34 0.815 35-39 1.165 40-44 1.43 45-49 1.335 50-54 0.8699999999999999 55-59 0.86 60-64 1.115 65-69 0.8 70-74 0.41000000000000003 75-79 0.43499999999999994 80-84 0.865 85-89 1.8849999999999998 90-94 1.81 95-99 0.705 100-104 0.635 105-109 0.66 110-114 0.955 115-119 0.555 120-124 0.415 125-129 1.485 130-134 2.9250000000000003 135-139 3.82 140-144 4.445 145-149 2.32 150-151 1.3625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.86124152321335 93.8 2 1.9300991131977048 3.6999999999999997 3 0.10432968179447052 0.3 4 0.05216484089723526 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02608242044861763 0.375 >50 0.02608242044861763 1.625 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 65 1.625 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6749999999999998 0.0 0.0 0.0 0.0 104-105 1.925 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.5875 0.0 0.0 0.0 0.0 110-111 2.875 0.0 0.0 0.0 0.0 112-113 3.15 0.0 0.0 0.0 0.0 114-115 3.4625000000000004 0.0 0.0 0.0 0.0 116-117 3.7750000000000004 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.9125 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.75 0.0 0.0 0.0 0.0 132-133 7.262499999999999 0.0 0.0 0.0 0.0 134-135 7.85 0.0 0.0 0.0 0.0 136-137 8.475 0.0 0.0 0.0 0.0 138-139 9.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGAGA 10 0.0067991135 145.20253 7 CACCACT 10 0.0067991135 145.20253 1 TCTTCGA 10 0.0067991135 145.20253 2 AATGAGA 25 9.109211E-4 86.0325 5 >>END_MODULE Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457038 spots for SRR7169953.sra Written 457038 spots for SRR7169953.sra Read 457056 spots for SRR7169953.sra Written 457056 spots for SRR7169953.sra SRR ids: ['SRR7169953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kldx9i7w SRR7169953.sra spots: 9140778 blocks: [[1, 457038], [457039, 914076], [914077, 1371114], [1371115, 1828152], [1828153, 2285190], [2285191, 2742228], [2742229, 3199266], [3199267, 3656304], [3656305, 4113342], [4113343, 4570380], [4570381, 5027418], [5027419, 5484456], [5484457, 5941494], [5941495, 6398532], [6398533, 6855570], [6855571, 7312608], [7312609, 7769646], [7769647, 8226684], [8226685, 8683722], [8683723, 9140778]] SRR7169953 file size 3077487 SRR7169953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169953 SRR7169953_1.fastq SRR7169953_2.fastq Input file: SRR7169953_1.fastq Paired file: SRR7169953_2.fastq trimmed: SRR7169953-trimmed-pair1.fastq, SRR7169953-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:02:39 2025 >> started Wed Feb 12 05:02:49 2025 >> done (9.546s) 9140778 read pairs processed; of these: 24902 ( 0.27%) short read pairs filtered out after trimming by size control 139878 ( 1.53%) empty read pairs filtered out after trimming by size control 8975998 (98.20%) read pairs available; of these: 5249133 (58.48%) trimmed read pairs available after processing 3726865 (41.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 9 0.00% 21 5 0.00% 22 11 0.00% 23 18 0.00% 24 11 0.00% 25 16 0.00% 26 6 0.00% 27 11 0.00% 28 10 0.00% 29 3 0.00% 30 14 0.00% 31 15 0.00% 32 12 0.00% 33 13 0.00% 34 22 0.00% 35 10 0.00% 36 16 0.00% 37 22 0.00% 38 22 0.00% 39 15 0.00% 40 35 0.00% 41 29 0.00% 42 22 0.00% 43 43 0.00% 44 66 0.00% 45 63 0.00% 46 63 0.00% 47 87 0.00% 48 70 0.00% 49 75 0.00% 50 113 0.00% 51 125 0.00% 52 158 0.00% 53 172 0.00% 54 162 0.00% 55 155 0.00% 56 179 0.00% 57 229 0.00% 58 253 0.00% 59 244 0.00% 60 225 0.00% 61 268 0.00% 62 334 0.00% 63 400 0.00% 64 531 0.01% 65 647 0.01% 66 1153 0.01% 67 1877 0.02% 68 3531 0.04% 69 5835 0.07% 70 7727 0.09% 71 4560 0.05% 72 2823 0.03% 73 2244 0.03% 74 1846 0.02% 75 1871 0.02% 76 1812 0.02% 77 1771 0.02% 78 1840 0.02% 79 1938 0.02% 80 2119 0.02% 81 2336 0.03% 82 2737 0.03% 83 3226 0.04% 84 4509 0.05% 85 5243 0.06% 86 5468 0.06% 87 6108 0.07% 88 6824 0.08% 89 7422 0.08% 90 7823 0.09% 91 8037 0.09% 92 8279 0.09% 93 8685 0.10% 94 9114 0.10% 95 9927 0.11% 96 10659 0.12% 97 11129 0.12% 98 11582 0.13% 99 11899 0.13% 100 12283 0.14% 101 12692 0.14% 102 13927 0.16% 103 14482 0.16% 104 15508 0.17% 105 16511 0.18% 106 17164 0.19% 107 18139 0.20% 108 18856 0.21% 109 19353 0.22% 110 20197 0.23% 111 20293 0.23% 112 20726 0.23% 113 21884 0.24% 114 22735 0.25% 115 23832 0.27% 116 24564 0.27% 117 25406 0.28% 118 26350 0.29% 119 26833 0.30% 120 27347 0.30% 121 28253 0.31% 122 29151 0.32% 123 30822 0.34% 124 32160 0.36% 125 33166 0.37% 126 34634 0.39% 127 36284 0.40% 128 37133 0.41% 129 38522 0.43% 130 39618 0.44% 131 41344 0.46% 132 42710 0.48% 133 44835 0.50% 134 46767 0.52% 135 49241 0.55% 136 52226 0.58% 137 55269 0.62% 138 59097 0.66% 139 63096 0.70% 140 66550 0.74% 141 71293 0.79% 142 77633 0.86% 143 86503 0.96% 144 98084 1.09% 145 113252 1.26% 146 140420 1.56% 147 190846 2.13% 148 281382 3.13% 149 528268 5.89% 150 2192524 24.43% 151 3726865 41.52% 8975998 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=7.22 fanout-score-rank=17 prefix-density=0.23 prefix-fanout=4.7 sequence=CAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=268.33 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=22.4 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=17.22 fanout-score-rank=8 prefix-density=0.35 prefix-fanout=7.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=55.88 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=12.1 sequence=TTGAAAAATTAGCGGATGACTTGTGGCTGGGGGTGAAAGGCCAATCAAACCGGGAGATAGCTGGTTCTCCCCGAAAGCTATTTAGGTAGCGCCTCGTGAATTCATCTCCGGGGGTAGAGCACTGTTTCGGCAAGGGGGTCATCCCGACTTACCAACCCGATGCAAACTGCGAATACCGGAGAATGTTATCACGGGAGACACACGGCGGGTGCTAACGTCCGTCGTGAAGAGGGAAACAACCCAGACCGCCAGCTAAGGTCCCAAAGTCATGGTTAAGTGGGAAACGATGTGGGAAGGCCCAGACAGCCAGGATGTTGGCTTAGAAGCAGCCATCATTTAAAGAAAGCGTAATAGCTCACTGGTCGAGTCGGCCTGCGCGGAAGATGTAACGGGGCTAAACCATGCACCGAAGCTGCGGCAGCGACGCTTATGCGTTGTTGGGTAGGGGAGCGTTCTGTAAGCCTGCGAAGGTGTGCTGTGAGGCATGCTGGAGGTATCAGAAGTGCGAATG SRR7169953 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:03:35 Started mapping on | Feb 12 05:03:35 Finished on | Feb 12 05:04:50 Mapping speed, Million of reads per hour | 430.85 Number of input reads | 8975998 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 8194534 Uniquely mapped reads % | 91.29% Average mapped length | 290.71 Number of splices: Total | 6103258 Number of splices: Annotated (sjdb) | 5980146 Number of splices: GT/AG | 6004466 Number of splices: GC/AG | 72326 Number of splices: AT/AC | 5894 Number of splices: Non-canonical | 20572 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.04% Deletion average length | 2.82 Insertion rate per base | 0.03% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 158240 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 28573 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.52% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 642944 642944 642944 N_multimapping 158240 158240 158240 N_noFeature 202892 8086846 243445 N_ambiguous 98604 682 31062 UnstrandedReadsAssigned:7893038 PositiveStrandReadsAssigned:107006 NegativeStrandReadsAssigned:7920027 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169953 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169953-trimmed-pair1.fastq SRR7169953-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,975,998 reads, 7,929,488 reads pseudoaligned [quant] estimated average fragment length: 217.36 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,244 rounds 52401 SRR7169953.ke.tsv 34699 SRR7169953.se.tsv 87100 total ==> SRR7169953.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.64 140 8.72551 Potri.005G024800.1.v4.1 1035 818.64 44 6.03518 Potri.004G059700.1.v4.1 961 744.65 9 1.35713 Potri.007G009000.2.v4.1 1416 1199.64 0 0 Potri.003G141000.2.v4.1 2943 2726.64 102 4.20052 Potri.016G087400.1.v4.1 270 86.3304 984.538 1280.56 Potri.015G069301.1.v4.1 564 349.562 0 0 Potri.010G195200.1.v4.1 1773 1556.64 23 1.65909 Potri.012G127500.1.v4.1 977 760.645 3231 476.964 ==> SRR7169953.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 706 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR7169953 completed mapping pipeline successfully