Starting /dee2/code/volunteer_pipeline.sh SRR7169954 current disk space = 3049124663296 free memory = 1482434052 SRR7169954 SRAfilesize 736bfce56535953ebfe56df699169a64 SRR7169954.sra SRR7169954.sra file validated SRR7169954 is paired end SRR7169954 is conventional basespace SRR7169954 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7765 34.0 33.0 34.0 33.0 34.0 2 33.4 34.0 34.0 34.0 33.0 34.0 3 33.408 34.0 34.0 34.0 33.0 34.0 4 33.529 34.0 34.0 34.0 33.0 34.0 5 33.53525 34.0 34.0 34.0 33.0 34.0 6 37.2715 38.0 38.0 38.0 36.0 38.0 7 37.5065 38.0 38.0 38.0 37.0 38.0 8 37.58825 38.0 38.0 38.0 38.0 38.0 9 37.58075 38.0 38.0 38.0 38.0 38.0 10-14 37.60275 38.0 38.0 38.0 38.0 38.0 15-19 37.540350000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.509750000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.493399999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.4794 38.0 38.0 38.0 38.0 38.0 35-39 37.4012 38.0 38.0 38.0 37.2 38.0 40-44 37.23485000000001 38.0 38.0 38.0 36.8 38.0 45-49 37.1514 38.0 38.0 38.0 36.0 38.0 50-54 37.1108 38.0 38.0 38.0 36.0 38.0 55-59 36.9781 38.0 38.0 38.0 36.0 38.0 60-64 37.04115 38.0 38.0 38.0 36.0 38.0 65-69 36.94545 38.0 38.0 38.0 36.0 38.0 70-74 36.87734999999999 38.0 38.0 38.0 35.4 38.0 75-79 36.724849999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.557300000000005 38.0 38.0 38.0 34.4 38.0 85-89 36.450100000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.48035 38.0 38.0 38.0 34.2 38.0 95-99 36.32745 38.0 38.0 38.0 33.8 38.0 100-104 36.152100000000004 38.0 37.6 38.0 33.4 38.0 105-109 35.95819999999999 38.0 37.2 38.0 32.8 38.0 110-114 35.65455 38.0 37.0 38.0 31.0 38.0 115-119 35.6561 38.0 37.0 38.0 31.0 38.0 120-124 35.45985 38.0 36.2 38.0 31.0 38.0 125-129 35.102 38.0 35.8 38.0 28.8 38.0 130-134 34.7149 38.0 35.2 38.0 27.2 38.0 135-139 34.21225 38.0 35.0 38.0 24.0 38.0 140-144 33.9468 38.0 35.0 38.0 22.6 38.0 145-149 33.037 38.0 34.0 38.0 14.6 38.0 150-151 29.190375000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 2.0 13 0.0 14 1.0 15 2.0 16 4.0 17 2.0 18 6.0 19 7.0 20 7.0 21 5.0 22 10.0 23 15.0 24 13.0 25 17.0 26 16.0 27 23.0 28 33.0 29 36.0 30 53.0 31 57.0 32 78.0 33 98.0 34 155.0 35 258.0 36 637.0 37 2464.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.107361963190186 12.857873210633947 11.145194274028631 35.88957055214724 2 22.5 16.900000000000002 31.6 28.999999999999996 3 20.474999999999998 21.0 26.450000000000003 32.074999999999996 4 21.625 27.950000000000003 24.05 26.375 5 20.875 33.45 24.525 21.15 6 20.674999999999997 34.575 24.975 19.775000000000002 7 14.975 27.825 39.175 18.025 8 19.125 25.900000000000002 29.349999999999998 25.624999999999996 9 17.175 25.5 32.375 24.95 10-14 19.735 30.509999999999998 25.905 23.849999999999998 15-19 19.435 28.775000000000002 27.705000000000002 24.085 20-24 20.205000000000002 29.065 27.355 23.375 25-29 19.36 29.23 27.77 23.64 30-34 19.895 28.95 27.79 23.365 35-39 20.455000000000002 28.499999999999996 26.97 24.075 40-44 20.035 28.294999999999998 28.02 23.65 45-49 19.97 28.46 27.245 24.325 50-54 20.115 28.055000000000003 27.445000000000004 24.385 55-59 20.495 28.095 27.450000000000003 23.96 60-64 20.26 27.785 27.61 24.345 65-69 20.26 29.049999999999997 26.99 23.7 70-74 20.41 28.93 26.450000000000003 24.21 75-79 20.724999999999998 28.494999999999997 26.93 23.849999999999998 80-84 20.544999999999998 28.515 27.105 23.835 85-89 20.115 28.294999999999998 27.725 23.865 90-94 20.91 28.000000000000004 27.055 24.035 95-99 20.805 28.075 27.42 23.7 100-104 20.830000000000002 28.565 26.825 23.78 105-109 20.51 28.345 26.705000000000002 24.44 110-114 20.735 28.23 27.400000000000002 23.635 115-119 21.04 28.605000000000004 26.21 24.145 120-124 20.875 28.560000000000002 26.919999999999998 23.645 125-129 21.25 27.860000000000003 26.6 24.29 130-134 20.64 28.13 26.55 24.68 135-139 20.89 28.299999999999997 26.895000000000003 23.915 140-144 21.205 28.07 26.495 24.23 145-149 21.654999999999998 28.215 26.08 24.05 150-151 20.0625 28.962500000000002 26.5875 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.0 25 3.5 26 7.0 27 8.0 28 7.0 29 11.5 30 17.0 31 20.5 32 24.5 33 32.0 34 48.5 35 66.5 36 79.5 37 110.0 38 136.0 39 151.0 40 183.5 41 203.0 42 238.5 43 265.0 44 252.5 45 261.5 46 278.5 47 260.5 48 237.0 49 217.5 50 178.5 51 145.5 52 122.0 53 101.0 54 78.0 55 57.5 56 43.0 57 32.0 58 28.5 59 22.0 60 15.0 61 13.0 62 8.5 63 3.5 64 4.0 65 5.0 66 3.0 67 0.5 68 2.5 69 4.0 70 2.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.3015075376884422 0.6 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.02512562814070352 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCACGATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4874999999999998 0.0 0.0 0.0 0.0 106-107 1.7375 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0875000000000004 0.0 0.0 0.0 0.0 118-119 3.5374999999999996 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.0875 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.5125 0.0 0.0 0.0 0.0 130-131 5.9375 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 6.8875 0.0 0.0 0.0 0.0 136-137 7.3375 0.0 0.0 0.0 0.0 138-139 7.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCATTTG 10 0.006832588 144.9875 145 GAGATGA 10 0.006832588 144.9875 9 >>END_MODULE SRR7169954 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169954_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.65875 33.0 33.0 34.0 31.0 34.0 2 32.1005 34.0 33.0 34.0 31.0 34.0 3 32.2195 34.0 33.0 34.0 32.0 34.0 4 32.11175 34.0 33.0 34.0 32.0 34.0 5 31.94925 34.0 33.0 34.0 32.0 34.0 6 36.15 38.0 38.0 38.0 35.0 38.0 7 36.173 38.0 38.0 38.0 35.0 38.0 8 36.13025 38.0 38.0 38.0 35.0 38.0 9 36.2335 38.0 38.0 38.0 36.0 38.0 10-14 36.16705 38.0 38.0 38.0 36.0 38.0 15-19 35.948899999999995 38.0 38.0 38.0 35.2 38.0 20-24 36.08945 38.0 38.0 38.0 35.4 38.0 25-29 36.14535 38.0 38.0 38.0 35.8 38.0 30-34 36.206199999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.083600000000004 38.0 38.0 38.0 36.0 38.0 40-44 35.949749999999995 38.0 38.0 38.0 35.4 38.0 45-49 35.81325 38.0 38.0 38.0 34.4 38.0 50-54 35.992000000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.0006 38.0 38.0 38.0 35.0 38.0 60-64 35.943 38.0 38.0 38.0 35.0 38.0 65-69 35.9249 38.0 38.0 38.0 34.8 38.0 70-74 35.75795 38.0 38.0 38.0 34.0 38.0 75-79 35.71285 38.0 38.0 38.0 34.0 38.0 80-84 35.701550000000005 38.0 38.0 38.0 34.0 38.0 85-89 35.39735 38.0 38.0 38.0 33.4 38.0 90-94 34.874 38.0 38.0 38.0 28.6 38.0 95-99 35.2593 38.0 38.0 38.0 30.2 38.0 100-104 35.2734 38.0 38.0 38.0 31.0 38.0 105-109 35.17915000000001 38.0 38.0 38.0 30.8 38.0 110-114 34.90090000000001 38.0 37.6 38.0 29.0 38.0 115-119 34.74935000000001 38.0 37.0 38.0 27.2 38.0 120-124 34.48530000000001 38.0 37.0 38.0 25.0 38.0 125-129 34.141650000000006 38.0 36.2 38.0 22.6 38.0 130-134 32.9692 38.0 35.2 38.0 11.4 38.0 135-139 31.8276 38.0 34.2 38.0 2.0 38.0 140-144 30.82525 38.0 33.0 38.0 2.0 38.0 145-149 30.428949999999997 38.0 31.2 38.0 2.0 38.0 150-151 26.86825 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 105.0 3 4.0 4 2.0 5 2.0 6 5.0 7 2.0 8 3.0 9 1.0 10 2.0 11 5.0 12 4.0 13 3.0 14 6.0 15 7.0 16 5.0 17 10.0 18 7.0 19 7.0 20 8.0 21 13.0 22 11.0 23 12.0 24 16.0 25 25.0 26 28.0 27 25.0 28 39.0 29 41.0 30 56.0 31 70.0 32 113.0 33 135.0 34 130.0 35 178.0 36 425.0 37 2495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.27272727272727 21.61038961038961 14.675324675324674 26.441558441558442 2 26.53061224489796 26.656588561350464 29.57923910304863 17.233560090702948 3 21.461187214611872 29.299847792998477 29.781836631151698 19.45712836123795 4 24.8014347937484 33.64078913656162 22.290545734050728 19.26723033563925 5 23.756763720690543 36.45967534140686 21.540839989693378 18.242720948209225 6 21.770273727295983 36.096188283448456 23.458685085699667 18.674852903555898 7 19.150025601638504 22.19662058371736 38.325652841781874 20.327700972862264 8 22.659846547314576 24.21994884910486 26.138107416879798 26.982097186700766 9 22.28177641653905 26.186830015313934 29.096477794793262 22.434915773353755 10-14 24.074548154216373 28.07843940402437 26.14817469663612 21.698837745123136 15-19 22.945170249974282 27.48174056167061 27.43544902787779 22.137640160477318 20-24 23.350409836065573 28.57069672131147 26.997950819672127 21.08094262295082 25-29 23.815607911279194 28.619614657331223 26.8053355138754 20.75944191751418 30-34 23.90415857770512 28.026974558087257 26.887708184326147 21.181158679881477 35-39 23.828064962344385 27.634612428915418 27.311849992315178 21.225472616425023 40-44 23.46797015693337 28.25829688705943 27.527656290198095 20.746076665809106 45-49 23.453037250759955 27.868514606625794 27.312071719305475 21.366376423308775 50-54 23.703476168535296 28.607996723493574 27.42538268571136 20.263144422259767 55-59 23.923395975216344 27.610220697424342 27.927697270725588 20.538686056633722 60-64 23.800738007380073 27.83927839278393 27.444649446494463 20.915334153341533 65-69 23.66509819967267 27.521481178396073 27.42430441898527 21.389116202945992 70-74 24.14442860052964 27.179669993888776 27.94866571603178 20.727235689549804 75-79 23.916353669678205 27.464216830778604 27.84996447061212 20.769465028931073 80-84 24.63242801715336 27.552583214212785 27.322850724933634 20.492138043700226 85-89 24.08668730650155 27.801857585139317 27.280701754385966 20.83075335397317 90-94 24.314337756960708 27.358834244080143 27.728337236533957 20.59849076242519 95-99 24.126464419092443 27.579679746252623 27.497825753312526 20.796030081342405 100-104 23.97568202717891 27.648922039440073 27.689792581996524 20.68560335138449 105-109 23.632362724527916 27.936134281766545 27.511386315951075 20.920116677754468 110-114 24.88977750435763 28.15543935199426 27.23777299292525 19.717010150722857 115-119 24.185004074979624 27.97473512632437 27.32273838630807 20.517522412387937 120-124 24.591077125639337 27.95867726743303 26.73317465944194 20.717070947485695 125-129 24.537322640345465 28.249023236685172 27.184865309479743 20.028788813489616 130-134 25.178978628625977 27.915362995174203 27.0350532958583 19.87060508034152 135-139 25.07454594741122 28.045540796963948 27.010029818378968 19.869883437245868 140-144 25.49623357343157 27.26123054929345 26.81035904767141 20.432176829603563 145-149 25.362625727898358 28.046585494970884 26.749602964531498 19.84118581259926 150-151 25.054746876207652 28.172098415560992 26.330027051397654 20.4431276568337 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 48.0 1 29.5 2 6.0 3 2.5 4 4.0 5 4.5 6 4.0 7 3.0 8 2.5 9 2.0 10 2.0 11 1.5 12 1.5 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 1.0 21 0.0 22 0.0 23 2.0 24 2.0 25 1.5 26 3.0 27 3.5 28 3.0 29 3.0 30 7.0 31 12.5 32 14.5 33 19.5 34 33.5 35 52.0 36 64.5 37 78.5 38 119.5 39 155.5 40 181.0 41 215.5 42 241.0 43 253.0 44 291.0 45 309.0 46 276.0 47 262.5 48 256.0 49 217.0 50 177.0 51 145.0 52 117.0 53 105.5 54 79.5 55 49.0 56 37.5 57 29.5 58 20.0 59 18.0 60 14.5 61 8.5 62 6.5 63 5.5 64 3.5 65 3.0 66 4.0 67 2.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.75 2 0.775 3 1.4500000000000002 4 2.4250000000000003 5 2.9749999999999996 6 2.275 7 2.35 8 2.25 9 2.0500000000000003 10-14 2.3449999999999998 15-19 2.79 20-24 2.4 25-29 2.165 30-34 2.13 35-39 2.405 40-44 2.825 45-49 2.955 50-54 2.335 55-59 2.355 60-64 2.44 65-69 2.2399999999999998 70-74 1.82 75-79 1.49 80-84 2.06 85-89 3.1 90-94 3.925 95-99 2.265 100-104 2.13 105-109 2.2950000000000004 110-114 2.4699999999999998 115-119 1.8399999999999999 120-124 1.265 125-129 2.74 130-134 5.715 135-139 7.775 140-144 9.065 145-149 5.55 150-151 2.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51604686704025 97.675 2 0.2547121752419766 0.5 3 0.025471217524197655 0.075 4 0.07641365257259297 0.3 5 0.05094243504839531 0.25 6 0.025471217524197655 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05094243504839531 1.05 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 31 0.775 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 11 0.27499999999999997 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit NCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.11249999999999999 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0499999999999998 0.0 0.0 0.0 0.0 102-103 1.175 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.85 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.4 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.9625000000000004 0.0 0.0 0.0 0.0 118-119 3.3625 0.0 0.0 0.0 0.0 120-121 3.5999999999999996 0.0 0.0 0.0 0.0 122-123 3.9375 0.0 0.0 0.0 0.0 124-125 4.2625 0.0 0.0 0.0 0.0 126-127 4.6375 0.0 0.0 0.0 0.0 128-129 5.2625 0.0 0.0 0.0 0.0 130-131 5.5875 0.0 0.0 0.0 0.0 132-133 6.0625 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.8875 0.0 0.0 0.0 0.0 138-139 7.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTTTG 10 0.0068043815 145.14102 1 >>END_MODULE Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764120 spots for SRR7169954.sra Written 764120 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra Read 764101 spots for SRR7169954.sra Written 764101 spots for SRR7169954.sra SRR ids: ['SRR7169954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aqm8w_7r SRR7169954.sra spots: 15282039 blocks: [[1, 764101], [764102, 1528202], [1528203, 2292303], [2292304, 3056404], [3056405, 3820505], [3820506, 4584606], [4584607, 5348707], [5348708, 6112808], [6112809, 6876909], [6876910, 7641010], [7641011, 8405111], [8405112, 9169212], [9169213, 9933313], [9933314, 10697414], [10697415, 11461515], [11461516, 12225616], [12225617, 12989717], [12989718, 13753818], [13753819, 14517919], [14517920, 15282039]] SRR7169954 file size 5156881 SRR7169954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169954 SRR7169954_1.fastq SRR7169954_2.fastq Input file: SRR7169954_1.fastq Paired file: SRR7169954_2.fastq trimmed: SRR7169954-trimmed-pair1.fastq, SRR7169954-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:50:04 2025 >> started Wed Feb 12 04:50:21 2025 >> done (17.608s) 15282039 read pairs processed; of these: 33827 ( 0.22%) short read pairs filtered out after trimming by size control 59674 ( 0.39%) empty read pairs filtered out after trimming by size control 15188538 (99.39%) read pairs available; of these: 7280064 (47.93%) trimmed read pairs available after processing 7908474 (52.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 8 0.00% 21 3 0.00% 22 5 0.00% 23 10 0.00% 24 7 0.00% 25 8 0.00% 26 11 0.00% 27 12 0.00% 28 13 0.00% 29 13 0.00% 30 17 0.00% 31 12 0.00% 32 16 0.00% 33 22 0.00% 34 18 0.00% 35 16 0.00% 36 20 0.00% 37 13 0.00% 38 36 0.00% 39 41 0.00% 40 29 0.00% 41 36 0.00% 42 40 0.00% 43 51 0.00% 44 57 0.00% 45 50 0.00% 46 57 0.00% 47 62 0.00% 48 73 0.00% 49 83 0.00% 50 103 0.00% 51 137 0.00% 52 141 0.00% 53 175 0.00% 54 157 0.00% 55 186 0.00% 56 221 0.00% 57 233 0.00% 58 255 0.00% 59 290 0.00% 60 359 0.00% 61 426 0.00% 62 454 0.00% 63 556 0.00% 64 620 0.00% 65 621 0.00% 66 740 0.00% 67 868 0.01% 68 1035 0.01% 69 1238 0.01% 70 1679 0.01% 71 1751 0.01% 72 1675 0.01% 73 1825 0.01% 74 1936 0.01% 75 2210 0.01% 76 2345 0.02% 77 2606 0.02% 78 2762 0.02% 79 3259 0.02% 80 3430 0.02% 81 4106 0.03% 82 4641 0.03% 83 5387 0.04% 84 7052 0.05% 85 8392 0.06% 86 8673 0.06% 87 9154 0.06% 88 9203 0.06% 89 9808 0.06% 90 10190 0.07% 91 10836 0.07% 92 11740 0.08% 93 13159 0.09% 94 13657 0.09% 95 14601 0.10% 96 15187 0.10% 97 15739 0.10% 98 16142 0.11% 99 16446 0.11% 100 17161 0.11% 101 18121 0.12% 102 19661 0.13% 103 21122 0.14% 104 21835 0.14% 105 23185 0.15% 106 23855 0.16% 107 24259 0.16% 108 24856 0.16% 109 25505 0.17% 110 25856 0.17% 111 27500 0.18% 112 28687 0.19% 113 30728 0.20% 114 31639 0.21% 115 33389 0.22% 116 34347 0.23% 117 35006 0.23% 118 35489 0.23% 119 35980 0.24% 120 36771 0.24% 121 37807 0.25% 122 40125 0.26% 123 41492 0.27% 124 43456 0.29% 125 45413 0.30% 126 47131 0.31% 127 48853 0.32% 128 49629 0.33% 129 51069 0.34% 130 52786 0.35% 131 54187 0.36% 132 57056 0.38% 133 60006 0.40% 134 63192 0.42% 135 66826 0.44% 136 70482 0.46% 137 74464 0.49% 138 80003 0.53% 139 84747 0.56% 140 89259 0.59% 141 95769 0.63% 142 105208 0.69% 143 113543 0.75% 144 127703 0.84% 145 146360 0.96% 146 175262 1.15% 147 224517 1.48% 148 325435 2.14% 149 622507 4.10% 150 3371572 22.20% 151 7908474 52.07% 15188538 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.81 fanout-score-rank=39 prefix-density=0.15 prefix-fanout=2.7 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=240.96 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=27.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=19.69 fanout-score-rank=12 prefix-density=0.42 prefix-fanout=7.7 sequence=TGCTGAGATCATTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=281.04 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=27.9 sequence=AAGAAGAAGAAG SRR7169954 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:51:02 Started mapping on | Feb 12 04:51:02 Finished on | Feb 12 04:52:26 Mapping speed, Million of reads per hour | 650.94 Number of input reads | 15188538 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14219559 Uniquely mapped reads % | 93.62% Average mapped length | 292.10 Number of splices: Total | 12945801 Number of splices: Annotated (sjdb) | 12716011 Number of splices: GT/AG | 12750274 Number of splices: GC/AG | 155296 Number of splices: AT/AC | 10844 Number of splices: Non-canonical | 29387 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282308 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 125722 % of reads mapped to too many loci | 0.83% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 712764 712764 712764 N_multimapping 282308 282308 282308 N_noFeature 321614 14055119 397661 N_ambiguous 147730 1676 58013 UnstrandedReadsAssigned:13750215 PositiveStrandReadsAssigned:162764 NegativeStrandReadsAssigned:13763885 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169954 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169954-trimmed-pair1.fastq SRR7169954-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,188,538 reads, 13,792,897 reads pseudoaligned [quant] estimated average fragment length: 231.601 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR7169954.ke.tsv 34699 SRR7169954.se.tsv 87100 total ==> SRR7169954.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.4 293 11.5574 Potri.005G024800.1.v4.1 1035 804.399 76 6.66128 Potri.004G059700.1.v4.1 961 730.438 11 1.06176 Potri.007G009000.2.v4.1 1416 1185.4 0 0 Potri.003G141000.2.v4.1 2943 2712.4 302 7.84998 Potri.016G087400.1.v4.1 270 85.5541 1686 1389.42 Potri.015G069301.1.v4.1 564 337.555 0 0 Potri.010G195200.1.v4.1 1773 1542.4 59 2.69694 Potri.012G127500.1.v4.1 977 746.427 6155 581.375 ==> SRR7169954.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1720 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169954 completed mapping pipeline successfully