Starting /dee2/code/volunteer_pipeline.sh SRR7169955 current disk space = 3049053474816 free memory = 1485130676 SRR7169955 SRAfilesize e92ad6376d9063eb23feb72394b681ba SRR7169955.sra SRR7169955.sra file validated SRR7169955 is paired end SRR7169955 is conventional basespace SRR7169955 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12575 34.0 33.0 34.0 33.0 34.0 2 33.424 34.0 34.0 34.0 33.0 34.0 3 33.464 34.0 34.0 34.0 33.0 34.0 4 33.484 34.0 34.0 34.0 33.0 34.0 5 33.48 34.0 34.0 34.0 33.0 34.0 6 37.158 38.0 38.0 38.0 36.0 38.0 7 37.487 38.0 38.0 38.0 37.0 38.0 8 37.49375 38.0 38.0 38.0 37.0 38.0 9 37.46475 38.0 38.0 38.0 38.0 38.0 10-14 37.50020000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.475550000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.493399999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.45315000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.451550000000005 38.0 38.0 38.0 37.6 38.0 35-39 37.40505 38.0 38.0 38.0 37.4 38.0 40-44 37.2731 38.0 38.0 38.0 37.0 38.0 45-49 37.135200000000005 38.0 38.0 38.0 36.2 38.0 50-54 37.147000000000006 38.0 38.0 38.0 36.2 38.0 55-59 37.07265 38.0 38.0 38.0 36.0 38.0 60-64 37.08235 38.0 38.0 38.0 36.0 38.0 65-69 36.977549999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.97245 38.0 38.0 38.0 36.0 38.0 75-79 36.852 38.0 38.0 38.0 35.6 38.0 80-84 36.765649999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.633050000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.42 38.0 38.0 38.0 34.0 38.0 95-99 36.18695 38.0 38.0 38.0 33.8 38.0 100-104 36.147349999999996 38.0 38.0 38.0 33.2 38.0 105-109 36.124199999999995 38.0 37.6 38.0 33.4 38.0 110-114 36.05055 38.0 37.4 38.0 33.2 38.0 115-119 35.788599999999995 38.0 37.0 38.0 32.2 38.0 120-124 35.6029 38.0 36.8 38.0 30.6 38.0 125-129 35.44305 38.0 36.0 38.0 31.0 38.0 130-134 34.81715 38.0 35.6 38.0 27.8 38.0 135-139 34.40015 38.0 35.0 38.0 24.8 38.0 140-144 34.33795 38.0 35.0 38.0 25.6 38.0 145-149 33.51095 38.0 34.8 38.0 19.2 38.0 150-151 29.52325 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 3.0 16 2.0 17 2.0 18 5.0 19 7.0 20 8.0 21 4.0 22 6.0 23 13.0 24 9.0 25 15.0 26 19.0 27 23.0 28 33.0 29 34.0 30 45.0 31 51.0 32 75.0 33 104.0 34 140.0 35 238.0 36 615.0 37 2545.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.207070707070706 12.878787878787879 8.686868686868687 35.22727272727273 2 23.549999999999997 14.35 32.824999999999996 29.275000000000002 3 19.925 17.625 24.75 37.7 4 22.400000000000002 26.6 23.925 27.075 5 23.95 30.225 23.724999999999998 22.1 6 20.125 34.4 24.025 21.45 7 15.825 28.025 38.574999999999996 17.575 8 17.424999999999997 26.75 30.825000000000003 25.0 9 18.099999999999998 26.3 31.525 24.075 10-14 19.93 29.79 27.235 23.044999999999998 15-19 20.28 28.165000000000003 27.365000000000002 24.19 20-24 19.919999999999998 28.665000000000003 27.54 23.875 25-29 19.935 29.285 26.584999999999997 24.195 30-34 19.75 29.630000000000003 26.529999999999998 24.09 35-39 20.135 29.075 27.065 23.724999999999998 40-44 20.419999999999998 28.82 27.35 23.41 45-49 20.29123298638911 28.512810248198562 27.37189751801441 23.82405924739792 50-54 20.165 28.389999999999997 27.185 24.26 55-59 20.78 28.95 26.795 23.474999999999998 60-64 20.424999999999997 28.345 27.250000000000004 23.98 65-69 20.73 27.865000000000002 27.58 23.825 70-74 20.45 28.525 27.485 23.54 75-79 21.085 27.955000000000002 26.845000000000002 24.115000000000002 80-84 20.715 28.375 27.155 23.755000000000003 85-89 20.744148829765955 28.060612122424484 27.110422084416886 24.084816963392676 90-94 20.432210188527876 28.224027276373846 27.181107099879664 24.162655435218614 95-99 20.86772699818804 28.045097644453392 27.325347292128043 23.76182806523052 100-104 21.35236664162284 28.830453293263208 26.381167042324066 23.43601302278988 105-109 21.221061053052654 28.55642782139107 26.401320066003297 23.821191059552977 110-114 20.949664765335736 28.499949964975485 26.358450915640947 24.191934354047834 115-119 21.305 27.975 26.865 23.855 120-124 20.955 28.015 26.700000000000003 24.33 125-129 20.73 28.595 26.395000000000003 24.279999999999998 130-134 21.52889245585875 27.954454253611555 26.58005617977528 23.936597110754416 135-139 21.182514101531023 27.377115229653505 26.868452860596292 24.57191780821918 140-144 21.358297359702842 27.69300271057123 26.5836763377171 24.365023592008832 145-149 21.419620031079255 28.121710361421627 26.246929670660187 24.21173993683894 150-151 20.710355177588795 27.52626313156578 26.613306653326664 25.15007503751876 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.0 23 2.0 24 1.0 25 3.0 26 2.5 27 5.0 28 10.5 29 13.5 30 16.0 31 17.5 32 26.0 33 40.0 34 51.0 35 57.5 36 74.0 37 88.5 38 121.0 39 162.0 40 181.0 41 194.0 42 202.0 43 253.5 44 288.5 45 281.0 46 265.0 47 254.5 48 243.5 49 208.5 50 176.0 51 151.0 52 133.5 53 118.5 54 87.5 55 60.5 56 51.5 57 41.0 58 33.5 59 22.5 60 14.5 61 11.0 62 8.0 63 5.0 64 4.5 65 4.5 66 3.0 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.08 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.02 90-94 0.27999999999999997 95-99 0.66 100-104 0.17500000000000002 105-109 0.005 110-114 0.06999999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.32 135-139 0.72 140-144 0.38999999999999996 145-149 0.255 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.6040775232821546 1.2 3 0.0 0.0 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.175 0.0 0.0 0.0 0.0 108-109 2.4375 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.3875 0.0 0.0 0.0 0.0 116-117 3.5999999999999996 0.0 0.0 0.0 0.0 118-119 3.8875 0.0 0.0 0.0 0.0 120-121 4.3375 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 5.2125 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.325 0.0 0.0 0.0 0.0 130-131 6.775 0.0 0.0 0.0 0.0 132-133 7.275 0.0 0.0 0.0 0.0 134-135 7.699999999999999 0.0 0.0 0.0 0.0 136-137 8.1875 0.0 0.0 0.0 0.0 138-139 8.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCTTG 10 0.006830828 145.0 145 GGCAGCA 10 0.006830828 145.0 2 AAAAAAA 50 0.0013298223 17.4 35-39 >>END_MODULE SRR7169955 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169955_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.117 33.0 33.0 34.0 32.0 34.0 2 32.20825 34.0 33.0 34.0 32.0 34.0 3 32.1765 34.0 33.0 34.0 31.0 34.0 4 31.761 34.0 33.0 34.0 31.0 34.0 5 31.82825 34.0 33.0 34.0 31.0 34.0 6 35.89525 38.0 38.0 38.0 34.0 38.0 7 35.98975 38.0 38.0 38.0 35.0 38.0 8 35.9615 38.0 38.0 38.0 35.0 38.0 9 35.83325 38.0 38.0 38.0 34.0 38.0 10-14 35.84855 38.0 38.0 38.0 34.2 38.0 15-19 35.631150000000005 38.0 38.0 38.0 34.0 38.0 20-24 35.815 38.0 38.0 38.0 34.4 38.0 25-29 35.8777 38.0 38.0 38.0 34.8 38.0 30-34 35.910250000000005 38.0 38.0 38.0 35.0 38.0 35-39 35.802350000000004 38.0 38.0 38.0 34.4 38.0 40-44 35.63735 38.0 38.0 38.0 34.0 38.0 45-49 35.58705 38.0 38.0 38.0 34.0 38.0 50-54 35.7933 38.0 38.0 38.0 34.4 38.0 55-59 35.80885 38.0 38.0 38.0 34.4 38.0 60-64 35.727599999999995 38.0 38.0 38.0 34.0 38.0 65-69 35.70145 38.0 38.0 38.0 33.8 38.0 70-74 35.64309999999999 38.0 38.0 38.0 33.8 38.0 75-79 35.5899 38.0 38.0 38.0 33.6 38.0 80-84 35.404250000000005 38.0 38.0 38.0 33.0 38.0 85-89 34.9741 38.0 38.0 38.0 29.8 38.0 90-94 34.62035 38.0 38.0 38.0 27.0 38.0 95-99 35.0287 38.0 38.0 38.0 29.0 38.0 100-104 35.04565 38.0 38.0 38.0 30.0 38.0 105-109 34.82535 38.0 37.4 38.0 28.4 38.0 110-114 34.7906 38.0 37.2 38.0 27.8 38.0 115-119 34.5113 38.0 36.8 38.0 25.4 38.0 120-124 34.369550000000004 38.0 36.6 38.0 24.8 38.0 125-129 33.865700000000004 38.0 35.8 38.0 19.0 38.0 130-134 32.85425 38.0 35.0 38.0 11.4 38.0 135-139 31.623200000000004 38.0 34.0 38.0 2.0 38.0 140-144 30.83915 38.0 32.4 38.0 2.0 38.0 145-149 30.061150000000005 38.0 31.4 38.0 2.0 38.0 150-151 26.39325 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 128.0 3 5.0 4 4.0 5 0.0 6 2.0 7 4.0 8 1.0 9 1.0 10 1.0 11 4.0 12 3.0 13 4.0 14 5.0 15 1.0 16 2.0 17 9.0 18 7.0 19 8.0 20 10.0 21 15.0 22 13.0 23 15.0 24 25.0 25 20.0 26 31.0 27 32.0 28 39.0 29 41.0 30 65.0 31 71.0 32 95.0 33 149.0 34 151.0 35 180.0 36 462.0 37 2397.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.43006903605216 22.142674507798517 13.551521350038353 25.87573510611097 2 27.370030581039757 26.911314984709477 28.6697247706422 17.04892966360856 3 21.534526854219948 28.516624040920718 29.82097186700767 20.127877237851663 4 24.527813712807244 33.402328589909445 22.2509702457956 19.81888745148771 5 24.520973588814083 34.619368203003624 21.957534955981355 18.90212325220093 6 20.91823574929069 37.477431003353104 23.62651534691772 17.977817900438485 7 21.1394689352926 22.119102861562258 36.71049239494715 20.030935808197988 8 22.439024390243905 25.10911424903723 27.62516046213094 24.826700898587934 9 21.972631035373098 26.878388845855927 28.65995352439969 22.48902659437129 10-14 23.98781243544722 28.59429869861599 25.883082007849616 21.534806858087173 15-19 24.02080624187256 27.74512353706112 27.19895968790637 21.035110533159948 20-24 24.01383725733168 28.32507228418009 26.714167699297807 20.946922759190418 25-29 23.193190611297396 27.70698994067578 27.93396956409595 21.165849883930875 30-34 23.86088033438258 27.571082099179524 27.38015377470458 21.18788379173332 35-39 23.847187758478082 27.067824648469806 27.471050454921425 21.613937138130687 40-44 23.542239991692195 27.61306402201568 27.68056493068176 21.164131055610362 45-49 24.0 27.574578469520105 27.185473411154344 21.239948119325554 50-54 23.93285618660213 27.75861181195613 27.459966016168064 20.848565985273673 55-59 23.730211932140463 27.185066776671995 27.99979374000928 21.08492755117826 60-64 23.961069056079097 27.246511148874813 27.854163448169317 20.93825634687677 65-69 24.12427344272414 26.881333264749756 27.632323440152256 21.36206985237385 70-74 24.7125555725893 27.451581583116152 27.06832234656855 20.767540497725996 75-79 23.653276091178572 27.496677910661347 27.951548604722475 20.898497393437594 80-84 23.314809097458063 27.729751981064116 27.431305958629203 21.524132962848615 85-89 24.427281740854774 27.438292542921257 27.25043051714241 20.883995199081564 90-94 24.000630351420916 27.509586594526446 27.593633450648735 20.8961496034039 95-99 23.89956602603844 27.676172762967553 28.104980367844597 20.31928084314941 100-104 24.70080641019056 27.79803790641533 27.484719297344494 20.01643638604962 105-109 24.54301352886502 27.38304244552308 27.703191159764533 20.37075286584736 110-114 24.859224053314048 27.437102856847652 26.992819135196573 20.71085395464173 115-119 25.023084025854107 26.613316918026058 27.444341848773984 20.91925720734585 120-124 24.47367079573839 27.84319722689504 27.501656726308816 20.181475251057755 125-129 24.47870854245356 27.40207999172143 26.988151290940138 21.131060174884876 130-134 25.51753499015486 27.885689957958597 26.672343142993988 19.924431908892554 135-139 24.644162076675574 27.419970551344274 27.80716583955936 20.12870153242079 140-144 25.744269538801433 27.84313725490196 26.318696492681582 20.093896713615024 145-149 25.780667164020038 27.67771501651924 26.6599168709368 19.881700948523925 150-151 26.95201037613489 26.53696498054475 26.666666666666668 19.844357976653697 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 80.0 1 41.5 2 2.5 3 2.5 4 3.5 5 3.0 6 2.5 7 4.0 8 4.0 9 2.5 10 2.5 11 2.5 12 2.5 13 2.0 14 0.5 15 0.5 16 1.5 17 1.0 18 0.5 19 0.5 20 1.5 21 2.5 22 1.5 23 2.0 24 3.5 25 4.5 26 2.5 27 2.5 28 3.5 29 4.0 30 8.5 31 12.5 32 16.5 33 24.0 34 27.5 35 38.5 36 60.0 37 77.5 38 114.0 39 158.0 40 180.0 41 201.5 42 228.0 43 256.0 44 274.5 45 294.5 46 296.0 47 263.0 48 240.0 49 221.0 50 184.0 51 147.5 52 126.5 53 100.5 54 72.0 55 54.5 56 46.5 57 35.0 58 20.5 59 13.0 60 10.0 61 10.0 62 12.0 63 9.0 64 5.0 65 6.0 66 4.5 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.225 2 1.9 3 2.25 4 3.375 5 3.45 6 3.075 7 3.025 8 2.625 9 3.175 10-14 3.18 15-19 3.875 20-24 3.16 25-29 3.075 30-34 3.105 35-39 3.2800000000000002 40-44 3.705 45-49 3.6249999999999996 50-54 2.895 55-59 3.0349999999999997 60-64 2.905 65-69 2.795 70-74 2.155 75-79 2.17 80-84 2.83 85-89 4.185 90-94 4.8149999999999995 95-99 3.2199999999999998 100-104 2.6550000000000002 105-109 3.17 110-114 3.215 115-119 2.53 120-124 1.915 125-129 3.3649999999999998 130-134 6.045 135-139 8.315 140-144 9.475 145-149 6.17 150-151 3.6249999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.40934771443246 96.775 2 0.46224961479198773 0.8999999999999999 3 0.025680534155110426 0.075 4 0.05136106831022085 0.2 5 0.0 0.0 6 0.025680534155110426 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025680534155110426 1.9 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 76 1.9 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 1.85 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.6624999999999996 0.0 0.0 0.0 0.0 112-113 3.025 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.4749999999999996 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.199999999999999 0.0 0.0 0.0 0.0 122-123 4.45 0.0 0.0 0.0 0.0 124-125 5.025 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.987500000000001 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.8875 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.699999999999999 0.0 0.0 0.0 0.0 138-139 8.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTAAG 10 0.006864033 144.71794 1 >>END_MODULE Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773566 spots for SRR7169955.sra Written 773566 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra Read 773549 spots for SRR7169955.sra Written 773549 spots for SRR7169955.sra SRR ids: ['SRR7169955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_za1cvt5x SRR7169955.sra spots: 15470997 blocks: [[1, 773549], [773550, 1547098], [1547099, 2320647], [2320648, 3094196], [3094197, 3867745], [3867746, 4641294], [4641295, 5414843], [5414844, 6188392], [6188393, 6961941], [6961942, 7735490], [7735491, 8509039], [8509040, 9282588], [9282589, 10056137], [10056138, 10829686], [10829687, 11603235], [11603236, 12376784], [12376785, 13150333], [13150334, 13923882], [13923883, 14697431], [14697432, 15470997]] SRR7169955 file size 5220912 SRR7169955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169955 SRR7169955_1.fastq SRR7169955_2.fastq Input file: SRR7169955_1.fastq Paired file: SRR7169955_2.fastq trimmed: SRR7169955-trimmed-pair1.fastq, SRR7169955-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:09:55 2025 >> started Wed Feb 12 05:10:11 2025 >> done (16.014s) 15470997 read pairs processed; of these: 20873 ( 0.13%) short read pairs filtered out after trimming by size control 50077 ( 0.32%) empty read pairs filtered out after trimming by size control 15400047 (99.54%) read pairs available; of these: 7529179 (48.89%) trimmed read pairs available after processing 7870868 (51.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 3 0.00% 21 8 0.00% 22 11 0.00% 23 9 0.00% 24 5 0.00% 25 5 0.00% 26 10 0.00% 27 13 0.00% 28 13 0.00% 29 16 0.00% 30 14 0.00% 31 18 0.00% 32 16 0.00% 33 29 0.00% 34 18 0.00% 35 23 0.00% 36 33 0.00% 37 29 0.00% 38 38 0.00% 39 24 0.00% 40 30 0.00% 41 53 0.00% 42 43 0.00% 43 55 0.00% 44 67 0.00% 45 77 0.00% 46 88 0.00% 47 96 0.00% 48 104 0.00% 49 145 0.00% 50 169 0.00% 51 174 0.00% 52 178 0.00% 53 228 0.00% 54 222 0.00% 55 226 0.00% 56 250 0.00% 57 278 0.00% 58 309 0.00% 59 355 0.00% 60 426 0.00% 61 440 0.00% 62 535 0.00% 63 628 0.00% 64 623 0.00% 65 752 0.00% 66 885 0.01% 67 1095 0.01% 68 1269 0.01% 69 1945 0.01% 70 2447 0.02% 71 1767 0.01% 72 1830 0.01% 73 2001 0.01% 74 2047 0.01% 75 2305 0.01% 76 2541 0.02% 77 2721 0.02% 78 3167 0.02% 79 3345 0.02% 80 3804 0.02% 81 4203 0.03% 82 4895 0.03% 83 5501 0.04% 84 6714 0.04% 85 7853 0.05% 86 8513 0.06% 87 8829 0.06% 88 9528 0.06% 89 9936 0.06% 90 10717 0.07% 91 11367 0.07% 92 12099 0.08% 93 13164 0.09% 94 13945 0.09% 95 15123 0.10% 96 16055 0.10% 97 17207 0.11% 98 17520 0.11% 99 17976 0.12% 100 19010 0.12% 101 19796 0.13% 102 20850 0.14% 103 22293 0.14% 104 23270 0.15% 105 24769 0.16% 106 25904 0.17% 107 26625 0.17% 108 27572 0.18% 109 28496 0.19% 110 28844 0.19% 111 29778 0.19% 112 30904 0.20% 113 32281 0.21% 114 34030 0.22% 115 35124 0.23% 116 36752 0.24% 117 38057 0.25% 118 38758 0.25% 119 39335 0.26% 120 40118 0.26% 121 41310 0.27% 122 42522 0.28% 123 43756 0.28% 124 45818 0.30% 125 47330 0.31% 126 49337 0.32% 127 51511 0.33% 128 52777 0.34% 129 54526 0.35% 130 56561 0.37% 131 57594 0.37% 132 59918 0.39% 133 62543 0.41% 134 65675 0.43% 135 68936 0.45% 136 72634 0.47% 137 77714 0.50% 138 83740 0.54% 139 90849 0.59% 140 96146 0.62% 141 103497 0.67% 142 111355 0.72% 143 120301 0.78% 144 134431 0.87% 145 153834 1.00% 146 184922 1.20% 147 240821 1.56% 148 340577 2.21% 149 637575 4.14% 150 3406895 22.12% 151 7870868 51.11% 15400047 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=195.53 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.6 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.50 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=3.9 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.14 sequence-density-rank=6 fanout-score=48.16 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=12.7 sequence=TGTTGGTGGTGG SRR7169955 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:10:58 Started mapping on | Feb 12 05:10:58 Finished on | Feb 12 05:12:17 Mapping speed, Million of reads per hour | 701.77 Number of input reads | 15400047 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 14572169 Uniquely mapped reads % | 94.62% Average mapped length | 291.72 Number of splices: Total | 13415123 Number of splices: Annotated (sjdb) | 13190636 Number of splices: GT/AG | 13222754 Number of splices: GC/AG | 151412 Number of splices: AT/AC | 11584 Number of splices: Non-canonical | 29373 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268774 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 90768 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577541 577541 577541 N_multimapping 268774 268774 268774 N_noFeature 284880 14376825 376360 N_ambiguous 159076 963 54541 UnstrandedReadsAssigned:14128213 PositiveStrandReadsAssigned:194381 NegativeStrandReadsAssigned:14141268 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169955 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169955-trimmed-pair1.fastq SRR7169955-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,400,047 reads, 14,116,726 reads pseudoaligned [quant] estimated average fragment length: 226.734 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,276 rounds 52401 SRR7169955.ke.tsv 34699 SRR7169955.se.tsv 87100 total ==> SRR7169955.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.27 239 9.37645 Potri.005G024800.1.v4.1 1035 809.266 19 1.65084 Potri.004G059700.1.v4.1 961 735.283 0 0 Potri.007G009000.2.v4.1 1416 1190.27 0 0 Potri.003G141000.2.v4.1 2943 2717.27 255 6.59859 Potri.016G087400.1.v4.1 270 87.0569 1572 1269.67 Potri.015G069301.1.v4.1 564 342.14 0 0 Potri.010G195200.1.v4.1 1773 1547.27 22 0.999771 Potri.012G127500.1.v4.1 977 751.277 4574 428.094 ==> SRR7169955.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1093 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 299 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169955 completed mapping pipeline successfully