Starting /dee2/code/volunteer_pipeline.sh SRR7169956 current disk space = 3049392603136 free memory = 1579857796 SRR7169956 SRAfilesize 34687678198098505c0dca6f1a6a27fb SRR7169956.sra SRR7169956.sra file validated SRR7169956 is paired end SRR7169956 is conventional basespace SRR7169956 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169956_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0835 34.0 33.0 34.0 33.0 34.0 2 33.42125 34.0 34.0 34.0 33.0 34.0 3 33.42 34.0 34.0 34.0 33.0 34.0 4 33.49775 34.0 34.0 34.0 33.0 34.0 5 33.5115 34.0 34.0 34.0 33.0 34.0 6 37.2815 38.0 38.0 38.0 36.0 38.0 7 37.4565 38.0 38.0 38.0 37.0 38.0 8 37.55875 38.0 38.0 38.0 38.0 38.0 9 37.62875 38.0 38.0 38.0 38.0 38.0 10-14 37.6209 38.0 38.0 38.0 38.0 38.0 15-19 37.57655 38.0 38.0 38.0 38.0 38.0 20-24 37.59525 38.0 38.0 38.0 38.0 38.0 25-29 37.56905 38.0 38.0 38.0 38.0 38.0 30-34 37.587199999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.50205 38.0 38.0 38.0 37.8 38.0 40-44 37.36105 38.0 38.0 38.0 37.0 38.0 45-49 37.29665 38.0 38.0 38.0 37.0 38.0 50-54 37.25214999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.219500000000004 38.0 38.0 38.0 36.4 38.0 60-64 37.142649999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.0824 38.0 38.0 38.0 36.0 38.0 70-74 36.994299999999996 38.0 38.0 38.0 36.0 38.0 75-79 36.78945 38.0 38.0 38.0 35.8 38.0 80-84 36.77205 38.0 38.0 38.0 35.6 38.0 85-89 36.6618 38.0 38.0 38.0 35.0 38.0 90-94 36.577099999999994 38.0 38.0 38.0 34.8 38.0 95-99 36.37695000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.218900000000005 38.0 38.0 38.0 33.8 38.0 105-109 36.10385 38.0 38.0 38.0 33.8 38.0 110-114 36.011849999999995 38.0 38.0 38.0 33.2 38.0 115-119 35.7611 38.0 37.0 38.0 32.0 38.0 120-124 35.6893 38.0 37.0 38.0 32.4 38.0 125-129 35.3819 38.0 36.0 38.0 30.6 38.0 130-134 34.923249999999996 38.0 36.0 38.0 27.8 38.0 135-139 34.5733 38.0 35.2 38.0 27.0 38.0 140-144 34.421049999999994 38.0 35.0 38.0 26.0 38.0 145-149 33.618050000000004 38.0 33.4 38.0 21.4 38.0 150-151 29.589 36.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 2.0 14 0.0 15 3.0 16 3.0 17 3.0 18 8.0 19 14.0 20 4.0 21 6.0 22 9.0 23 9.0 24 7.0 25 11.0 26 17.0 27 18.0 28 27.0 29 28.0 30 33.0 31 58.0 32 58.0 33 85.0 34 154.0 35 231.0 36 570.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.44877308373387 12.952188211484946 10.346572223627625 34.252466481153554 2 23.175 14.975 32.475 29.375 3 19.725 20.075000000000003 26.075 34.125 4 23.625 28.000000000000004 22.125 26.25 5 23.9 31.775 23.525 20.8 6 21.3 34.475 23.150000000000002 21.075 7 15.024999999999999 27.05 39.225 18.7 8 18.4 26.025 29.549999999999997 26.025 9 18.625 24.9 32.0 24.474999999999998 10-14 20.315 29.459999999999997 26.56 23.665 15-19 20.474999999999998 28.555000000000003 27.125 23.845 20-24 20.200000000000003 28.439999999999998 27.389999999999997 23.97 25-29 19.675 28.985 27.200000000000003 24.14 30-34 20.205000000000002 28.199999999999996 27.439999999999998 24.154999999999998 35-39 20.455000000000002 28.425 27.065 24.055 40-44 20.419999999999998 28.49 26.955000000000002 24.135 45-49 21.055 27.810000000000002 27.339999999999996 23.794999999999998 50-54 20.135 27.465 27.750000000000004 24.65 55-59 20.5 28.18 27.155 24.165 60-64 20.875 28.005000000000003 26.83 24.29 65-69 20.990000000000002 28.875 26.314999999999998 23.82 70-74 20.849999999999998 28.315 26.85 23.985 75-79 20.62 28.84 26.57 23.97 80-84 20.71 28.835 26.36 24.095 85-89 20.523078461769266 28.059208881332196 27.33410011501725 24.083612541881283 90-94 21.319847786901665 27.62367314239936 26.847586621269777 24.2088924494292 95-99 20.858188380369942 28.126723144017244 27.094089929319765 23.92099854629305 100-104 20.995 28.42 26.68 23.905 105-109 20.575 28.32 26.924999999999997 24.18 110-114 20.885 28.835 26.575 23.705000000000002 115-119 21.310000000000002 28.050000000000004 26.63 24.01 120-124 21.235 28.194999999999997 26.715 23.855 125-129 21.83 27.894999999999996 26.365 23.91 130-134 21.385 28.32 26.375 23.919999999999998 135-139 21.46751362977042 27.939778922622914 26.49427299554844 24.09843445205822 140-144 21.755 27.634999999999998 26.565 24.044999999999998 145-149 22.105 27.939999999999998 26.0 23.955000000000002 150-151 21.3875 27.6375 26.325 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 4.5 27 6.5 28 6.5 29 7.0 30 14.0 31 21.5 32 21.5 33 27.0 34 43.5 35 60.5 36 72.0 37 82.5 38 111.5 39 147.0 40 172.5 41 193.0 42 224.0 43 251.0 44 272.5 45 273.5 46 263.5 47 260.5 48 248.0 49 226.0 50 188.0 51 159.5 52 141.5 53 121.0 54 91.5 55 66.0 56 49.0 57 37.0 58 33.0 59 31.5 60 18.0 61 9.0 62 9.0 63 5.5 64 3.5 65 4.0 66 3.5 67 1.0 68 2.5 69 3.5 70 3.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.015 90-94 0.13999999999999999 95-99 0.255 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.034999999999999996 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62235649546828 98.925 2 0.35246727089627394 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025176233635448138 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGTAGCATCTCGTATGC 15 0.375 TruSeq Adapter, Index 22 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.7 0.0 0.0 0.0 0.0 106-107 2.0 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.5125 0.0 0.0 0.0 0.0 116-117 3.8875 0.0 0.0 0.0 0.0 118-119 4.3875 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.1875 0.0 0.0 0.0 0.0 124-125 5.574999999999999 0.0 0.0 0.0 0.0 126-127 6.1 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.0375 0.0 0.0 0.0 0.0 132-133 7.6375 0.0 0.0 0.0 0.0 134-135 8.399999999999999 0.0 0.0 0.0 0.0 136-137 9.2 0.0 0.0 0.0 0.0 138-139 9.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169956 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169956_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.0845 33.0 33.0 34.0 32.0 34.0 2 32.43775 34.0 33.0 34.0 32.0 34.0 3 32.37625 34.0 33.0 34.0 32.0 34.0 4 32.0805 34.0 33.0 34.0 32.0 34.0 5 31.9565 34.0 33.0 34.0 32.0 34.0 6 36.29125 38.0 38.0 38.0 35.0 38.0 7 36.398 38.0 38.0 38.0 35.0 38.0 8 36.452 38.0 38.0 38.0 36.0 38.0 9 36.517 38.0 38.0 38.0 36.0 38.0 10-14 36.33785 38.0 38.0 38.0 36.0 38.0 15-19 36.18675 38.0 38.0 38.0 36.0 38.0 20-24 36.225 38.0 38.0 38.0 36.0 38.0 25-29 36.298899999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.2889 38.0 38.0 38.0 36.0 38.0 35-39 36.1577 38.0 38.0 38.0 35.4 38.0 40-44 35.96894999999999 38.0 38.0 38.0 35.0 38.0 45-49 35.853500000000004 38.0 38.0 38.0 34.4 38.0 50-54 36.12835 38.0 38.0 38.0 35.2 38.0 55-59 36.085950000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.0252 38.0 38.0 38.0 34.8 38.0 65-69 35.8737 38.0 38.0 38.0 34.0 38.0 70-74 35.8251 38.0 38.0 38.0 34.2 38.0 75-79 35.7055 38.0 38.0 38.0 33.6 38.0 80-84 35.616 38.0 38.0 38.0 33.2 38.0 85-89 35.298649999999995 38.0 38.0 38.0 32.0 38.0 90-94 34.821299999999994 38.0 38.0 38.0 28.6 38.0 95-99 35.17595 38.0 38.0 38.0 29.4 38.0 100-104 35.1572 38.0 38.0 38.0 29.8 38.0 105-109 35.0632 38.0 38.0 38.0 29.6 38.0 110-114 34.847699999999996 38.0 37.2 38.0 28.0 38.0 115-119 34.54665000000001 38.0 36.8 38.0 25.6 38.0 120-124 34.3024 38.0 36.0 38.0 24.2 38.0 125-129 33.752250000000004 38.0 35.6 38.0 19.4 38.0 130-134 32.8048 38.0 34.2 38.0 11.2 38.0 135-139 31.4269 38.0 33.0 38.0 2.0 38.0 140-144 30.537650000000003 38.0 31.0 38.0 2.0 38.0 145-149 29.708849999999995 38.0 29.4 38.0 2.0 38.0 150-151 25.226125 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 70.0 3 18.0 4 4.0 5 1.0 6 5.0 7 3.0 8 0.0 9 2.0 10 2.0 11 7.0 12 2.0 13 9.0 14 4.0 15 5.0 16 6.0 17 19.0 18 5.0 19 9.0 20 10.0 21 23.0 22 17.0 23 17.0 24 19.0 25 26.0 26 28.0 27 32.0 28 43.0 29 54.0 30 50.0 31 79.0 32 96.0 33 137.0 34 153.0 35 206.0 36 455.0 37 2384.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.064845545059995 21.72581056931325 14.960428899668113 25.248914985958642 2 27.821257258268112 26.93764200959354 27.896995708154503 17.34410502398384 3 20.93377315402182 29.358030956609998 29.73864501395585 19.96955087541233 4 24.512820512820515 33.38461538461539 22.28205128205128 19.82051282051282 5 24.485596707818928 36.16255144032922 21.32201646090535 18.029835390946502 6 22.08977935582044 35.32843012934314 23.81435455237129 18.76743596246513 7 20.424671385237612 22.522750252780586 37.23458038422649 19.817997977755308 8 23.13131313131313 26.111111111111114 25.808080808080806 24.949494949494948 9 21.258847320525785 26.567239635995954 28.488372093023255 23.685540950455007 10-14 24.147741706040744 28.049585937103082 26.373012244068484 21.429660112787687 15-19 23.620399203634694 27.004951758640054 27.709428761039355 21.665220276685897 20-24 23.687690742624618 27.797558494404882 27.187182095625634 21.327568667344863 25-29 23.809523809523807 28.205909229363385 26.835211696618945 21.149355264493856 30-34 23.461245235069885 27.593392630241425 27.796696315120712 21.14866581956798 35-39 23.59527687296417 27.67711726384365 26.928949511400653 21.798656351791532 40-44 23.82754564516954 28.133790211220784 26.758042244156904 21.280621899452772 45-49 23.918939665319073 27.286218719615167 27.869607491940023 20.925234123125737 50-54 23.72760947886538 27.203531739990865 27.56888415283909 21.499974628304663 55-59 23.97803538743136 27.913361805979253 27.01342281879195 21.095179987797437 60-64 23.320097739767867 28.24272042353899 26.807167582976994 21.630014253716148 65-69 24.060226868101125 27.656544076504403 27.559896230734015 20.723332824660464 70-74 24.32733158001214 27.72607728100344 27.240542180861826 20.706048958122597 75-79 24.125732767333737 27.041641398827572 28.08772993733576 20.744895896502932 80-84 24.01886218436264 27.385660683500657 27.629043707534734 20.96643342460197 85-89 24.51569806279225 27.35214017779148 27.30589383895997 20.8262679204563 90-94 24.252939043969132 27.489771609094205 27.075457040758195 21.181832306178467 95-99 23.826476122666936 28.149315974164672 27.49326145552561 20.53094644764278 100-104 24.472018232463917 27.20688781970119 27.44998733856673 20.87110660926817 105-109 24.482530641306006 27.076234552204646 27.36611910695214 21.075115699537204 110-114 24.324737539496482 27.555804709000103 27.04617266333707 21.073285088166344 115-119 25.01016466761537 27.307379548688758 27.03801585688148 20.644439926814393 120-124 25.140087838861124 27.37644505022969 27.204805896309757 20.278661214599424 125-129 25.260523089497344 27.75847977114834 26.588680016346544 20.392317123007764 130-134 25.861707700366683 27.36511262441069 26.75222629649031 20.02095337873232 135-139 26.116489276354493 27.400117665935714 26.22880676044285 20.25458629726694 140-144 25.75370742571568 27.513716117116626 26.519637134010537 20.21293932315715 145-149 25.55084523996441 27.372167268540327 27.026744125189722 20.050243366305544 150-151 27.433175597902544 26.35886942064203 26.755339557488174 19.45261542396726 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 38.0 1 19.5 2 1.0 3 0.5 4 1.5 5 4.0 6 3.5 7 1.5 8 1.5 9 1.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 0.5 16 1.0 17 1.0 18 0.5 19 2.0 20 3.0 21 3.0 22 2.5 23 1.0 24 1.5 25 4.0 26 4.5 27 5.0 28 8.0 29 10.0 30 8.0 31 8.5 32 9.0 33 10.0 34 29.0 35 50.0 36 57.5 37 81.0 38 115.5 39 141.0 40 188.0 41 219.5 42 241.0 43 271.0 44 288.0 45 288.0 46 280.5 47 264.5 48 228.0 49 220.0 50 202.5 51 148.0 52 113.0 53 100.0 54 82.5 55 61.0 56 42.0 57 33.0 58 25.0 59 22.0 60 18.0 61 7.5 62 8.0 63 7.0 64 4.5 65 4.0 66 4.0 67 5.5 68 3.0 69 2.0 70 1.5 71 1.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.075 2 0.975 3 1.4749999999999999 4 2.5 5 2.8000000000000003 6 1.425 7 1.0999999999999999 8 1.0 9 1.0999999999999999 10-14 1.585 15-19 2.0549999999999997 20-24 1.7000000000000002 25-29 1.51 30-34 1.625 35-39 1.76 40-44 2.235 45-49 2.2950000000000004 50-54 1.465 55-59 1.66 60-64 1.78 65-69 1.7049999999999998 70-74 1.1400000000000001 75-79 1.06 80-84 1.39 85-89 2.6950000000000003 90-94 3.4549999999999996 95-99 1.685 100-104 1.275 105-109 1.685 110-114 1.8900000000000001 115-119 1.6199999999999999 120-124 0.955 125-129 2.12 130-134 4.55 135-139 6.515 140-144 7.954999999999999 145-149 4.465 150-151 2.2624999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64421855146125 98.02499999999999 2 0.2795425667090216 0.5499999999999999 3 0.025412960609911054 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05082592121982211 1.35 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 39 0.975 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.3 0.0 0.0 0.0 0.0 110-111 2.7750000000000004 0.0 0.0 0.0 0.0 112-113 3.1624999999999996 0.0 0.0 0.0 0.0 114-115 3.4875 0.0 0.0 0.0 0.0 116-117 3.8625 0.0 0.0 0.0 0.0 118-119 4.35 0.0 0.0 0.0 0.0 120-121 4.75 0.0 0.0 0.0 0.0 122-123 5.1375 0.0 0.0 0.0 0.0 124-125 5.5125 0.0 0.0 0.0 0.0 126-127 6.0 0.0 0.0 0.0 0.0 128-129 6.5375 0.0 0.0 0.0 0.0 130-131 6.8875 0.0 0.0 0.0 0.0 132-133 7.4375 0.0 0.0 0.0 0.0 134-135 8.149999999999999 0.0 0.0 0.0 0.0 136-137 8.837499999999999 0.0 0.0 0.0 0.0 138-139 9.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644092 spots for SRR7169956.sra Written 644092 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra Read 644078 spots for SRR7169956.sra Written 644078 spots for SRR7169956.sra SRR ids: ['SRR7169956.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4kv5smo9 SRR7169956.sra spots: 12881574 blocks: [[1, 644078], [644079, 1288156], [1288157, 1932234], [1932235, 2576312], [2576313, 3220390], [3220391, 3864468], [3864469, 4508546], [4508547, 5152624], [5152625, 5796702], [5796703, 6440780], [6440781, 7084858], [7084859, 7728936], [7728937, 8373014], [8373015, 9017092], [9017093, 9661170], [9661171, 10305248], [10305249, 10949326], [10949327, 11593404], [11593405, 12237482], [12237483, 12881574]] SRR7169956 file size 4343442 SRR7169956 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169956 SRR7169956_1.fastq SRR7169956_2.fastq Input file: SRR7169956_1.fastq Paired file: SRR7169956_2.fastq trimmed: SRR7169956-trimmed-pair1.fastq, SRR7169956-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:38:29 2025 >> started Wed Feb 12 05:38:42 2025 >> done (13.908s) 12881574 read pairs processed; of these: 25932 ( 0.20%) short read pairs filtered out after trimming by size control 99785 ( 0.77%) empty read pairs filtered out after trimming by size control 12755857 (99.02%) read pairs available; of these: 6287928 (49.29%) trimmed read pairs available after processing 6467929 (50.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 10 0.00% 20 11 0.00% 21 9 0.00% 22 16 0.00% 23 12 0.00% 24 15 0.00% 25 15 0.00% 26 14 0.00% 27 11 0.00% 28 19 0.00% 29 12 0.00% 30 20 0.00% 31 22 0.00% 32 11 0.00% 33 21 0.00% 34 22 0.00% 35 23 0.00% 36 31 0.00% 37 26 0.00% 38 29 0.00% 39 28 0.00% 40 30 0.00% 41 55 0.00% 42 55 0.00% 43 53 0.00% 44 72 0.00% 45 85 0.00% 46 99 0.00% 47 119 0.00% 48 114 0.00% 49 126 0.00% 50 161 0.00% 51 190 0.00% 52 197 0.00% 53 227 0.00% 54 229 0.00% 55 252 0.00% 56 272 0.00% 57 296 0.00% 58 325 0.00% 59 418 0.00% 60 388 0.00% 61 478 0.00% 62 562 0.00% 63 686 0.01% 64 748 0.01% 65 858 0.01% 66 1031 0.01% 67 1124 0.01% 68 1293 0.01% 69 1939 0.02% 70 3476 0.03% 71 2451 0.02% 72 2068 0.02% 73 2223 0.02% 74 2333 0.02% 75 2527 0.02% 76 2632 0.02% 77 2846 0.02% 78 3064 0.02% 79 3487 0.03% 80 3922 0.03% 81 4308 0.03% 82 5085 0.04% 83 5669 0.04% 84 7079 0.06% 85 8142 0.06% 86 8425 0.07% 87 8706 0.07% 88 9415 0.07% 89 9707 0.08% 90 10465 0.08% 91 11132 0.09% 92 12160 0.10% 93 12921 0.10% 94 13812 0.11% 95 14810 0.12% 96 15271 0.12% 97 16011 0.13% 98 16187 0.13% 99 16688 0.13% 100 17892 0.14% 101 18412 0.14% 102 19779 0.16% 103 20968 0.16% 104 22034 0.17% 105 23514 0.18% 106 23757 0.19% 107 24245 0.19% 108 24411 0.19% 109 25762 0.20% 110 25848 0.20% 111 26874 0.21% 112 28820 0.23% 113 29952 0.23% 114 31417 0.25% 115 32674 0.26% 116 33447 0.26% 117 34399 0.27% 118 34799 0.27% 119 34927 0.27% 120 35808 0.28% 121 36543 0.29% 122 37854 0.30% 123 40121 0.31% 124 42060 0.33% 125 43138 0.34% 126 45099 0.35% 127 45607 0.36% 128 47221 0.37% 129 47990 0.38% 130 49637 0.39% 131 50529 0.40% 132 52683 0.41% 133 55456 0.43% 134 58387 0.46% 135 62064 0.49% 136 64930 0.51% 137 67718 0.53% 138 72398 0.57% 139 77016 0.60% 140 81992 0.64% 141 86655 0.68% 142 92556 0.73% 143 100028 0.78% 144 110289 0.86% 145 124054 0.97% 146 147518 1.16% 147 188018 1.47% 148 260069 2.04% 149 491636 3.85% 150 2789034 21.86% 151 6467929 50.71% 12755857 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=43 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=105.07 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=17.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.30 fanout-score-rank=25 prefix-density=0.30 prefix-fanout=3.6 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.12 sequence-density-rank=12 fanout-score=65.82 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=15.0 sequence=TGTTGGTGGTGG SRR7169956 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:39:25 Started mapping on | Feb 12 05:39:25 Finished on | Feb 12 05:40:42 Mapping speed, Million of reads per hour | 596.38 Number of input reads | 12755857 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 11862691 Uniquely mapped reads % | 93.00% Average mapped length | 290.82 Number of splices: Total | 11010087 Number of splices: Annotated (sjdb) | 10820380 Number of splices: GT/AG | 10850602 Number of splices: GC/AG | 127095 Number of splices: AT/AC | 9388 Number of splices: Non-canonical | 23002 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247085 % of reads mapped to multiple loci | 1.94% Number of reads mapped to too many loci | 181948 % of reads mapped to too many loci | 1.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.44% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 664168 664168 664168 N_multimapping 247085 247085 247085 N_noFeature 229828 11707597 294193 N_ambiguous 135028 721 43851 UnstrandedReadsAssigned:11497835 PositiveStrandReadsAssigned:154373 NegativeStrandReadsAssigned:11524647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169956 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169956-trimmed-pair1.fastq SRR7169956-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,755,857 reads, 11,578,971 reads pseudoaligned [quant] estimated average fragment length: 221.388 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,234 rounds 52401 SRR7169956.ke.tsv 34699 SRR7169956.se.tsv 87100 total ==> SRR7169956.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.61 240 10.7732 Potri.005G024800.1.v4.1 1035 814.612 28 2.77356 Potri.004G059700.1.v4.1 961 740.635 6 0.653699 Potri.007G009000.2.v4.1 1416 1195.61 0 0 Potri.003G141000.2.v4.1 2943 2722.61 226.036 6.69921 Potri.016G087400.1.v4.1 270 89.5976 1573 1416.65 Potri.015G069301.1.v4.1 564 346.739 0 0 Potri.010G195200.1.v4.1 1773 1552.61 22 1.14338 Potri.012G127500.1.v4.1 977 756.63 2986 318.447 ==> SRR7169956.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 808 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 234 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169956 completed mapping pipeline successfully