Starting /dee2/code/volunteer_pipeline.sh SRR7169957 current disk space = 3049101340672 free memory = 959164380 SRR7169957 SRAfilesize 91689def713413eca772537f6d3586ba SRR7169957.sra SRR7169957.sra file validated SRR7169957 is paired end SRR7169957 is conventional basespace SRR7169957 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169957_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2025 34.0 34.0 34.0 33.0 34.0 2 33.56125 34.0 34.0 34.0 33.0 34.0 3 33.5855 34.0 34.0 34.0 33.0 34.0 4 33.612 34.0 34.0 34.0 33.0 34.0 5 33.57975 34.0 34.0 34.0 33.0 34.0 6 37.4775 38.0 38.0 38.0 37.0 38.0 7 37.59525 38.0 38.0 38.0 38.0 38.0 8 37.67925 38.0 38.0 38.0 38.0 38.0 9 37.67575 38.0 38.0 38.0 38.0 38.0 10-14 37.67954999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.64335 38.0 38.0 38.0 38.0 38.0 20-24 37.593650000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.58115 38.0 38.0 38.0 38.0 38.0 30-34 37.58595 38.0 38.0 38.0 38.0 38.0 35-39 37.4991 38.0 38.0 38.0 37.8 38.0 40-44 37.37575 38.0 38.0 38.0 37.0 38.0 45-49 37.263799999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3037 38.0 38.0 38.0 37.0 38.0 55-59 37.249050000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.21015 38.0 38.0 38.0 36.8 38.0 65-69 37.14675 38.0 38.0 38.0 36.0 38.0 70-74 37.09475 38.0 38.0 38.0 36.0 38.0 75-79 37.040150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9948 38.0 38.0 38.0 36.0 38.0 85-89 36.8185 38.0 38.0 38.0 35.4 38.0 90-94 36.6827 38.0 38.0 38.0 35.0 38.0 95-99 36.49830000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.47825 38.0 38.0 38.0 34.2 38.0 105-109 36.43155 38.0 38.0 38.0 34.0 38.0 110-114 36.229200000000006 38.0 38.0 38.0 33.8 38.0 115-119 36.035450000000004 38.0 37.2 38.0 33.2 38.0 120-124 35.95604999999999 38.0 37.0 38.0 33.0 38.0 125-129 35.55905 38.0 36.4 38.0 31.4 38.0 130-134 35.216049999999996 38.0 36.0 38.0 30.0 38.0 135-139 34.79045 38.0 35.6 38.0 27.8 38.0 140-144 34.55925 38.0 35.0 38.0 27.0 38.0 145-149 33.8916 38.0 35.0 38.0 22.4 38.0 150-151 30.4055 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 2.0 16 2.0 17 3.0 18 3.0 19 7.0 20 2.0 21 1.0 22 6.0 23 9.0 24 10.0 25 12.0 26 21.0 27 22.0 28 27.0 29 18.0 30 41.0 31 36.0 32 63.0 33 94.0 34 140.0 35 217.0 36 560.0 37 2701.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.52327935222672 13.13259109311741 10.602226720647772 34.7419028340081 2 22.05 17.5 33.5 26.950000000000003 3 18.7 23.375 25.8 32.125 4 20.375 32.25 23.25 24.125 5 22.125 32.725 23.724999999999998 21.425 6 19.2 35.699999999999996 24.825 20.275000000000002 7 15.325 26.974999999999998 40.150000000000006 17.549999999999997 8 18.375 26.200000000000003 28.349999999999998 27.075 9 17.25 26.075 32.225 24.45 10-14 20.025000000000002 30.145 26.290000000000003 23.54 15-19 19.855 29.080000000000002 27.41 23.655 20-24 19.525000000000002 29.42 27.01 24.044999999999998 25-29 20.34 28.77 27.185 23.705000000000002 30-34 19.735 29.25 27.495000000000005 23.52 35-39 19.785 28.585 27.305 24.325 40-44 20.12701270127013 28.657865786578657 27.557755775577558 23.657365736573656 45-49 20.237379807692307 29.10657051282051 26.888020833333332 23.768028846153847 50-54 19.586958695869587 29.017901790179017 27.432743274327432 23.962396239623963 55-59 20.68 29.03 26.724999999999998 23.565 60-64 20.46 28.470000000000002 27.32 23.75 65-69 20.18 28.33 27.500000000000004 23.990000000000002 70-74 20.14 28.485 27.345000000000002 24.03 75-79 20.23 28.299999999999997 27.150000000000002 24.32 80-84 20.126006300315016 28.616430821541076 27.316365818290915 23.941197059852993 85-89 20.36165097174915 28.39110398717692 27.4694450010018 23.77780004007213 90-94 20.257364029355585 28.581481853825274 26.85231728159244 24.308836835226703 95-99 20.48974255832663 28.655470635559134 26.603982300884955 24.250804505229283 100-104 20.68068068068068 28.273273273273276 27.137137137137135 23.90890890890891 105-109 20.641032051602583 27.74638731936597 27.266363318165908 24.34621731086554 110-114 20.28115463504928 28.365601080594327 27.525138826354496 23.8281054580019 115-119 20.582058205820584 28.247824782478247 27.062706270627064 24.107410741074105 120-124 20.53 28.275 26.58 24.615000000000002 125-129 20.990000000000002 28.01 26.93 24.07 130-134 20.63698733036206 28.288847713956635 26.861635535079376 24.212529420601932 135-139 20.977371933169433 27.610255381064675 26.752295419196226 24.660077266569665 140-144 20.905539417008914 27.752178703796453 26.595211860162276 24.747070019032353 145-149 20.956765412329865 27.667133706965576 26.63130504403523 24.744795836669336 150-151 20.3125 28.1 26.437500000000004 25.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 1.5 25 3.5 26 5.0 27 6.0 28 8.5 29 9.5 30 14.0 31 27.0 32 35.5 33 35.5 34 44.5 35 67.5 36 84.0 37 105.5 38 134.5 39 158.5 40 188.0 41 221.5 42 238.5 43 243.0 44 254.5 45 270.5 46 283.0 47 269.5 48 248.5 49 216.0 50 172.0 51 140.0 52 125.0 53 103.0 54 64.5 55 51.0 56 45.5 57 29.0 58 20.0 59 20.0 60 16.5 61 13.0 62 9.5 63 4.0 64 3.0 65 1.5 66 0.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.16 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.18 90-94 0.53 95-99 0.5599999999999999 100-104 0.1 105-109 0.005 110-114 0.055 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.155 135-139 0.345 140-144 0.16999999999999998 145-149 0.08 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.2375 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.3375 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.175 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 4.987500000000001 0.0 0.0 0.0 0.0 126-127 5.4125 0.0 0.0 0.0 0.0 128-129 5.825 0.0 0.0 0.0 0.0 130-131 6.4375 0.0 0.0 0.0 0.0 132-133 6.9875 0.0 0.0 0.0 0.0 134-135 7.525 0.0 0.0 0.0 0.0 136-137 7.9624999999999995 0.0 0.0 0.0 0.0 138-139 8.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACCTT 10 0.006830828 145.0 3 AGATCGG 45 0.008957279 48.333332 145 >>END_MODULE SRR7169957 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169957_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3555 33.0 33.0 34.0 32.0 34.0 2 32.4735 34.0 33.0 34.0 32.0 34.0 3 32.47125 34.0 33.0 34.0 32.0 34.0 4 32.243 34.0 33.0 34.0 32.0 34.0 5 32.2815 34.0 33.0 34.0 32.0 34.0 6 36.428 38.0 38.0 38.0 36.0 38.0 7 36.43875 38.0 38.0 38.0 36.0 38.0 8 36.5355 38.0 38.0 38.0 37.0 38.0 9 36.4115 38.0 38.0 38.0 36.0 38.0 10-14 36.42785000000001 38.0 38.0 38.0 36.8 38.0 15-19 36.20555 38.0 38.0 38.0 36.0 38.0 20-24 36.3849 38.0 38.0 38.0 36.6 38.0 25-29 36.3801 38.0 38.0 38.0 36.8 38.0 30-34 36.3712 38.0 38.0 38.0 36.6 38.0 35-39 36.33024999999999 38.0 38.0 38.0 36.6 38.0 40-44 36.1952 38.0 38.0 38.0 36.2 38.0 45-49 36.1178 38.0 38.0 38.0 36.0 38.0 50-54 36.260000000000005 38.0 38.0 38.0 36.2 38.0 55-59 36.25995 38.0 38.0 38.0 36.0 38.0 60-64 36.243449999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.19495 38.0 38.0 38.0 36.0 38.0 70-74 36.13785 38.0 38.0 38.0 35.6 38.0 75-79 36.10835 38.0 38.0 38.0 35.4 38.0 80-84 35.9605 38.0 38.0 38.0 34.6 38.0 85-89 35.6757 38.0 38.0 38.0 34.0 38.0 90-94 35.3614 38.0 38.0 38.0 32.4 38.0 95-99 35.609950000000005 38.0 38.0 38.0 33.2 38.0 100-104 35.579899999999995 38.0 38.0 38.0 33.4 38.0 105-109 35.40319999999999 38.0 38.0 38.0 32.2 38.0 110-114 35.315250000000006 38.0 38.0 38.0 32.0 38.0 115-119 35.1494 38.0 38.0 38.0 30.2 38.0 120-124 34.92495 38.0 37.4 38.0 28.2 38.0 125-129 34.5137 38.0 36.6 38.0 25.4 38.0 130-134 33.77595 38.0 36.0 38.0 17.8 38.0 135-139 32.940250000000006 38.0 35.0 38.0 13.4 38.0 140-144 32.257 38.0 33.0 38.0 4.2 38.0 145-149 31.7545 38.0 33.4 38.0 2.0 38.0 150-151 27.811125 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 83.0 3 9.0 4 4.0 5 4.0 6 1.0 7 1.0 8 4.0 9 4.0 10 3.0 11 2.0 12 6.0 13 0.0 14 5.0 15 4.0 16 2.0 17 3.0 18 4.0 19 7.0 20 9.0 21 8.0 22 8.0 23 14.0 24 19.0 25 17.0 26 18.0 27 42.0 28 27.0 29 30.0 30 48.0 31 69.0 32 71.0 33 96.0 34 135.0 35 153.0 36 413.0 37 2677.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.92356687898089 21.273885350318473 13.605095541401274 25.197452229299362 2 26.842238541402885 27.753861737148643 29.27323373005824 16.130665991390224 3 21.326893746822574 29.486527707168275 30.935434672089478 18.251143873919677 4 24.11057077041208 32.17302277962631 24.264141284873304 19.452265165088303 5 23.084806559057135 36.740968485780165 21.8293620292083 18.344862925954395 6 22.61601223865375 36.053034166241716 22.437531871494134 18.893421723610405 7 20.570991588070353 21.463165944430283 36.986999745093044 20.97884272240632 8 22.26751592356688 24.43312101910828 26.751592356687897 26.547770700636942 9 22.916135610502167 25.26127963293398 28.06525618149375 23.7573285750701 10-14 23.92891793902875 28.310269110963592 25.700862993412656 22.059949956595005 15-19 23.605766764147557 28.084757067364425 27.238212508337185 21.071263660150837 20-24 23.55464759959142 28.08988764044944 27.002042900919303 21.353421859039837 25-29 23.74438546345447 28.384034299714166 26.908942425479786 20.962637811351573 30-34 23.7837561896983 28.06166726223901 26.69865740977079 21.455919138291897 35-39 23.183143251674935 27.770674576791286 27.504730731857002 21.541451439676777 40-44 23.41047878072561 27.90065171652897 27.187355673012775 21.501513829732644 45-49 23.895304080061585 27.400564536823197 27.713625866050805 20.99050551706441 50-54 23.550428746427112 28.455492037566355 26.857901184156795 21.136178031849735 55-59 24.314526423283127 27.730405922900182 27.648710748021443 20.30635690579525 60-64 23.682867061466204 27.4760057177864 28.073310189912192 20.767817030835207 65-69 24.06954216376058 27.281533598450086 27.572142347302947 21.076781890486387 70-74 23.950391379485616 27.859103385178408 27.34573548846193 20.844769746874046 75-79 24.047606937592185 27.47062712985097 27.943644779004117 20.53812115355272 80-84 24.17257381814473 27.77296139527768 27.681166811158143 20.37329797541945 85-89 24.4666597959394 27.635782747603834 27.321446975162324 20.576110481294446 90-94 24.325723456023194 27.540508360511467 27.72687270280064 20.4068954806647 95-99 24.456938410426783 27.620751341681576 27.794531050345007 20.127779197546637 100-104 24.417715712756742 27.07813057438459 28.10254319351715 20.401610519341524 105-109 24.197922529806068 27.733715396817278 28.12771836463184 19.94064370874482 110-114 24.65711361310133 27.46161719549642 27.824974411463664 20.05629477993859 115-119 24.710621589924024 27.5202692366529 27.41318647697721 20.355922696445873 120-124 24.578252032520325 27.428861788617887 27.428861788617887 20.5640243902439 125-129 25.21051550626412 27.659683713288146 27.243787225302935 19.886013555144793 130-134 25.188521156263093 27.346041055718473 27.497905320485966 19.967532467532468 135-139 24.533815013547255 28.321734048770118 26.897944004675132 20.246506933007492 140-144 25.26829791800815 26.990770551620518 27.8815196394076 19.859411890963727 145-149 25.01307941822748 27.639426598304905 27.34644763000942 20.0010463534582 150-151 25.401929260450164 27.369774919614148 27.331189710610932 19.89710610932476 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 59.0 1 32.5 2 3.5 3 1.5 4 1.5 5 1.5 6 1.0 7 0.5 8 2.0 9 2.0 10 0.5 11 0.0 12 1.0 13 1.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.0 27 3.5 28 5.5 29 5.5 30 4.0 31 12.0 32 18.5 33 23.5 34 30.0 35 40.0 36 57.5 37 81.5 38 117.5 39 145.5 40 171.0 41 208.0 42 255.0 43 281.5 44 290.5 45 291.5 46 273.5 47 264.5 48 237.0 49 212.5 50 184.5 51 157.5 52 140.5 53 107.5 54 81.0 55 56.5 56 42.0 57 30.0 58 19.0 59 12.5 60 8.5 61 7.0 62 5.5 63 4.5 64 5.0 65 4.5 66 3.5 67 2.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.875 2 1.275 3 1.6500000000000001 4 2.325 5 2.4250000000000003 6 1.95 7 1.925 8 1.875 9 1.925 10-14 2.085 15-19 2.545 20-24 2.1 25-29 2.04 30-34 2.0549999999999997 35-39 2.235 40-44 2.565 45-49 2.5749999999999997 50-54 2.04 55-59 2.075 60-64 2.06 65-69 1.9300000000000002 70-74 1.63 75-79 1.695 80-84 1.955 85-89 2.97 90-94 3.415 95-99 2.175 100-104 1.8950000000000002 105-109 2.2849999999999997 110-114 2.3 115-119 1.9449999999999998 120-124 1.6 125-129 2.62 130-134 4.52 135-139 5.885 140-144 6.819999999999999 145-149 4.43 150-151 2.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64358452138494 97.85000000000001 2 0.2545824847250509 0.5 3 0.0 0.0 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.02545824847250509 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02545824847250509 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 51 1.275 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 3.0 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.6624999999999996 0.0 0.0 0.0 0.0 120-121 3.95 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.737500000000001 0.0 0.0 0.0 0.0 126-127 5.137499999999999 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 6.075 0.0 0.0 0.0 0.0 132-133 6.575 0.0 0.0 0.0 0.0 134-135 7.0 0.0 0.0 0.0 0.0 136-137 7.449999999999999 0.0 0.0 0.0 0.0 138-139 8.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATATAT 10 0.0069465647 144.1875 5 AGATCGG 40 0.0049262354 56.176952 145 >>END_MODULE Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618665 spots for SRR7169957.sra Written 618665 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra Read 618662 spots for SRR7169957.sra Written 618662 spots for SRR7169957.sra SRR ids: ['SRR7169957.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3gf7l7eb SRR7169957.sra spots: 12373243 blocks: [[1, 618662], [618663, 1237324], [1237325, 1855986], [1855987, 2474648], [2474649, 3093310], [3093311, 3711972], [3711973, 4330634], [4330635, 4949296], [4949297, 5567958], [5567959, 6186620], [6186621, 6805282], [6805283, 7423944], [7423945, 8042606], [8042607, 8661268], [8661269, 9279930], [9279931, 9898592], [9898593, 10517254], [10517255, 11135916], [11135917, 11754578], [11754579, 12373243]] SRR7169957 file size 4171185 SRR7169957 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169957 SRR7169957_1.fastq SRR7169957_2.fastq Input file: SRR7169957_1.fastq Paired file: SRR7169957_2.fastq trimmed: SRR7169957-trimmed-pair1.fastq, SRR7169957-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 04:57:13 2025 >> started Wed Feb 12 04:57:27 2025 >> done (13.409s) 12373243 read pairs processed; of these: 25345 ( 0.20%) short read pairs filtered out after trimming by size control 52438 ( 0.42%) empty read pairs filtered out after trimming by size control 12295460 (99.37%) read pairs available; of these: 5941277 (48.32%) trimmed read pairs available after processing 6354183 (51.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 7 0.00% 21 7 0.00% 22 3 0.00% 23 10 0.00% 24 10 0.00% 25 6 0.00% 26 8 0.00% 27 9 0.00% 28 11 0.00% 29 16 0.00% 30 11 0.00% 31 13 0.00% 32 19 0.00% 33 13 0.00% 34 20 0.00% 35 15 0.00% 36 29 0.00% 37 24 0.00% 38 28 0.00% 39 32 0.00% 40 39 0.00% 41 44 0.00% 42 40 0.00% 43 56 0.00% 44 56 0.00% 45 63 0.00% 46 76 0.00% 47 67 0.00% 48 79 0.00% 49 88 0.00% 50 121 0.00% 51 148 0.00% 52 167 0.00% 53 147 0.00% 54 178 0.00% 55 186 0.00% 56 209 0.00% 57 235 0.00% 58 264 0.00% 59 293 0.00% 60 342 0.00% 61 384 0.00% 62 457 0.00% 63 576 0.00% 64 611 0.00% 65 635 0.01% 66 707 0.01% 67 852 0.01% 68 989 0.01% 69 1229 0.01% 70 1482 0.01% 71 1498 0.01% 72 1698 0.01% 73 1828 0.01% 74 1956 0.02% 75 2142 0.02% 76 2175 0.02% 77 2317 0.02% 78 2569 0.02% 79 2859 0.02% 80 3291 0.03% 81 3793 0.03% 82 4314 0.04% 83 5064 0.04% 84 6500 0.05% 85 7224 0.06% 86 7278 0.06% 87 7652 0.06% 88 8012 0.07% 89 8369 0.07% 90 8843 0.07% 91 9621 0.08% 92 10504 0.09% 93 11487 0.09% 94 12195 0.10% 95 12646 0.10% 96 13044 0.11% 97 13517 0.11% 98 13463 0.11% 99 13968 0.11% 100 14829 0.12% 101 15661 0.13% 102 16985 0.14% 103 18187 0.15% 104 18886 0.15% 105 20061 0.16% 106 20347 0.17% 107 20573 0.17% 108 20810 0.17% 109 21380 0.17% 110 21943 0.18% 111 22705 0.18% 112 24152 0.20% 113 25655 0.21% 114 27096 0.22% 115 28310 0.23% 116 28934 0.24% 117 29365 0.24% 118 29465 0.24% 119 29714 0.24% 120 30322 0.25% 121 31105 0.25% 122 32241 0.26% 123 35051 0.29% 124 36142 0.29% 125 38206 0.31% 126 39301 0.32% 127 39966 0.33% 128 40463 0.33% 129 41185 0.33% 130 42575 0.35% 131 43887 0.36% 132 45681 0.37% 133 48869 0.40% 134 51700 0.42% 135 54659 0.44% 136 57440 0.47% 137 60315 0.49% 138 64413 0.52% 139 68342 0.56% 140 70696 0.57% 141 76879 0.63% 142 83751 0.68% 143 91676 0.75% 144 102984 0.84% 145 118890 0.97% 146 144330 1.17% 147 180811 1.47% 148 264582 2.15% 149 504487 4.10% 150 2734325 22.24% 151 6354183 51.68% 12295460 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=38 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=265.93 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=28.5 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=44 prefix-density=0.19 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=236.30 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=25.2 sequence=GAAGAAGAAGAAA SRR7169957 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 04:58:09 Started mapping on | Feb 12 04:58:09 Finished on | Feb 12 04:59:26 Mapping speed, Million of reads per hour | 574.85 Number of input reads | 12295460 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11515000 Uniquely mapped reads % | 93.65% Average mapped length | 291.71 Number of splices: Total | 10816995 Number of splices: Annotated (sjdb) | 10634834 Number of splices: GT/AG | 10655543 Number of splices: GC/AG | 130996 Number of splices: AT/AC | 8933 Number of splices: Non-canonical | 21523 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217813 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 53169 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 580685 580685 580685 N_multimapping 217813 217813 217813 N_noFeature 214686 11377904 276460 N_ambiguous 121464 627 45782 UnstrandedReadsAssigned:11178850 PositiveStrandReadsAssigned:136469 NegativeStrandReadsAssigned:11192758 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169957 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169957-trimmed-pair1.fastq SRR7169957-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,295,460 reads, 11,157,431 reads pseudoaligned [quant] estimated average fragment length: 229.781 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR7169957.ke.tsv 34699 SRR7169957.se.tsv 87100 total ==> SRR7169957.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.22 200 9.31877 Potri.005G024800.1.v4.1 1035 806.219 22 2.2749 Potri.004G059700.1.v4.1 961 732.258 21 2.39082 Potri.007G009000.2.v4.1 1416 1187.22 0 0 Potri.003G141000.2.v4.1 2943 2714.22 169.028 5.19165 Potri.016G087400.1.v4.1 270 87.0194 1360 1302.91 Potri.015G069301.1.v4.1 564 339.922 0 0 Potri.010G195200.1.v4.1 1773 1544.22 21 1.13371 Potri.012G127500.1.v4.1 977 748.231 5474 609.904 ==> SRR7169957.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 795 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 203 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169957 completed mapping pipeline successfully