Starting /dee2/code/volunteer_pipeline.sh SRR7169958 current disk space = 3048985899008 free memory = 1488094184 SRR7169958 SRAfilesize ddd472cc12250b9d4bfb4cf24941d1d2 SRR7169958.sra SRR7169958.sra file validated SRR7169958 is paired end SRR7169958 is conventional basespace SRR7169958 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169958_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6795 34.0 33.0 34.0 33.0 34.0 2 33.371 34.0 34.0 34.0 33.0 34.0 3 33.34275 34.0 34.0 34.0 33.0 34.0 4 33.44125 34.0 34.0 34.0 33.0 34.0 5 33.51475 34.0 34.0 34.0 33.0 34.0 6 37.0825 38.0 37.0 38.0 36.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.50475 38.0 38.0 38.0 37.0 38.0 9 37.574 38.0 38.0 38.0 38.0 38.0 10-14 37.5389 38.0 38.0 38.0 38.0 38.0 15-19 37.5092 38.0 38.0 38.0 38.0 38.0 20-24 37.4716 38.0 38.0 38.0 37.8 38.0 25-29 37.354499999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.38705 38.0 38.0 38.0 37.2 38.0 35-39 37.34905 38.0 38.0 38.0 37.0 38.0 40-44 37.20225 38.0 38.0 38.0 36.4 38.0 45-49 37.080200000000005 38.0 38.0 38.0 36.0 38.0 50-54 37.05915 38.0 38.0 38.0 36.0 38.0 55-59 37.00685 38.0 38.0 38.0 36.0 38.0 60-64 36.9664 38.0 38.0 38.0 36.0 38.0 65-69 36.890699999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.847500000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.660849999999996 38.0 38.0 38.0 34.8 38.0 80-84 36.511649999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.427699999999994 38.0 38.0 38.0 34.0 38.0 90-94 36.43489999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.24385 38.0 38.0 38.0 33.8 38.0 100-104 35.99105 38.0 37.0 38.0 32.6 38.0 105-109 35.9342 38.0 37.0 38.0 33.0 38.0 110-114 35.6939 38.0 37.0 38.0 32.2 38.0 115-119 35.5157 38.0 36.4 38.0 31.0 38.0 120-124 35.241699999999994 38.0 36.2 38.0 29.0 38.0 125-129 35.0579 38.0 36.0 38.0 28.2 38.0 130-134 34.52925 38.0 35.4 38.0 25.8 38.0 135-139 34.18075 38.0 35.0 38.0 23.4 38.0 140-144 33.942499999999995 38.0 34.8 38.0 22.4 38.0 145-149 33.31705000000001 38.0 34.6 38.0 17.6 38.0 150-151 29.806625000000004 36.0 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 4.0 16 5.0 17 2.0 18 6.0 19 14.0 20 5.0 21 6.0 22 5.0 23 12.0 24 13.0 25 15.0 26 25.0 27 21.0 28 29.0 29 38.0 30 45.0 31 53.0 32 78.0 33 94.0 34 173.0 35 253.0 36 689.0 37 2409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.282051282051285 12.743589743589745 7.58974358974359 35.38461538461539 2 23.150000000000002 13.4 33.7 29.75 3 20.25 19.15 25.374999999999996 35.225 4 22.975 26.825 23.549999999999997 26.650000000000002 5 23.65 31.15 23.5 21.7 6 20.549999999999997 34.475 24.575 20.4 7 15.4 27.875 40.325 16.400000000000002 8 17.0 25.95 32.1 24.95 9 16.85 24.775 33.125 25.25 10-14 19.875 30.064999999999998 26.795 23.265 15-19 19.615 29.220000000000002 27.224999999999998 23.94 20-24 20.365 28.765 27.26 23.61 25-29 20.085 28.065 28.07 23.78 30-34 20.155 29.125 27.450000000000003 23.27 35-39 20.185 28.355000000000004 27.76 23.7 40-44 20.87 27.839999999999996 27.825 23.465 45-49 19.939999999999998 28.595 27.279999999999998 24.185000000000002 50-54 20.53 27.63 27.310000000000002 24.529999999999998 55-59 20.68 28.194999999999997 27.045 24.08 60-64 20.13 28.115000000000002 27.245 24.51 65-69 20.575 28.57 26.72 24.135 70-74 20.4 28.765 27.04 23.794999999999998 75-79 20.455000000000002 29.015 26.855 23.674999999999997 80-84 20.990000000000002 28.325 27.055 23.630000000000003 85-89 20.849999999999998 28.325 26.939999999999998 23.885 90-94 20.46 27.92 27.229999999999997 24.39 95-99 21.025 27.415 27.005000000000003 24.555 100-104 20.560000000000002 28.549999999999997 27.169999999999998 23.72 105-109 20.8 28.485 27.200000000000003 23.515 110-114 20.585 28.299999999999997 26.83 24.285 115-119 20.79 28.605000000000004 27.0 23.605 120-124 20.76 28.34 26.645000000000003 24.255 125-129 21.525 27.905 26.43 24.14 130-134 21.285 27.96 26.935 23.82 135-139 20.735 27.735 27.375 24.154999999999998 140-144 20.419999999999998 27.73 27.189999999999998 24.66 145-149 21.565 27.525 27.169999999999998 23.74 150-151 21.1875 28.3375 27.0 23.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.5 22 1.0 23 0.5 24 2.0 25 1.5 26 1.0 27 3.5 28 4.5 29 8.5 30 15.5 31 17.0 32 25.5 33 42.0 34 54.0 35 59.5 36 72.0 37 92.5 38 109.5 39 135.5 40 174.0 41 218.0 42 237.0 43 242.5 44 263.5 45 273.5 46 271.5 47 264.5 48 249.0 49 232.0 50 200.0 51 163.5 52 136.5 53 107.0 54 78.5 55 55.0 56 42.5 57 36.5 58 25.0 59 18.0 60 16.0 61 10.0 62 7.5 63 7.5 64 7.0 65 5.0 66 2.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74893296510167 99.325 2 0.20085362791865427 0.4 3 0.025106703489831784 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025106703489831784 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 8 0.2 TruSeq Adapter, Index 10 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.1375 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.4 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.7249999999999996 0.0 0.0 0.0 0.0 114-115 4.125 0.0 0.0 0.0 0.0 116-117 4.7375 0.0 0.0 0.0125 0.0 118-119 5.3 0.0 0.0 0.025 0.0 120-121 5.675 0.0 0.0 0.025 0.0 122-123 6.0125 0.0 0.0 0.025 0.0 124-125 6.5125 0.0 0.0 0.025 0.0 126-127 6.949999999999999 0.0 0.0 0.025 0.0 128-129 7.5625 0.0 0.0 0.025 0.0 130-131 8.149999999999999 0.0 0.0 0.025 0.0 132-133 8.675 0.0 0.0 0.025 0.0 134-135 9.2125 0.0 0.0 0.025 0.0 136-137 9.9875 0.0 0.0 0.025 0.0 138-139 10.65 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169958 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169958_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.28 33.0 33.0 34.0 30.0 34.0 2 31.92475 34.0 33.0 34.0 31.0 34.0 3 31.98825 34.0 33.0 34.0 31.0 34.0 4 31.58575 34.0 33.0 34.0 31.0 34.0 5 31.58025 34.0 33.0 34.0 31.0 34.0 6 36.02575 38.0 38.0 38.0 34.0 38.0 7 35.9335 38.0 38.0 38.0 34.0 38.0 8 35.99625 38.0 38.0 38.0 34.0 38.0 9 36.04675 38.0 38.0 38.0 35.0 38.0 10-14 35.950149999999994 38.0 38.0 38.0 35.2 38.0 15-19 35.5503 38.0 38.0 38.0 33.8 38.0 20-24 35.740899999999996 38.0 38.0 38.0 34.0 38.0 25-29 35.870099999999994 38.0 38.0 38.0 34.6 38.0 30-34 35.9486 38.0 38.0 38.0 35.2 38.0 35-39 35.755250000000004 38.0 38.0 38.0 34.4 38.0 40-44 35.56195 38.0 38.0 38.0 33.8 38.0 45-49 35.427350000000004 38.0 38.0 38.0 33.0 38.0 50-54 35.7664 38.0 38.0 38.0 34.2 38.0 55-59 35.67405 38.0 38.0 38.0 33.8 38.0 60-64 35.67695 38.0 38.0 38.0 34.0 38.0 65-69 35.6118 38.0 38.0 38.0 33.8 38.0 70-74 35.46495 38.0 38.0 38.0 33.0 38.0 75-79 35.396550000000005 38.0 38.0 38.0 32.6 38.0 80-84 35.4012 38.0 38.0 38.0 32.8 38.0 85-89 34.7508 38.0 38.0 38.0 28.2 38.0 90-94 34.3608 38.0 38.0 38.0 25.4 38.0 95-99 34.7491 38.0 37.8 38.0 27.4 38.0 100-104 35.02045 38.0 38.0 38.0 29.4 38.0 105-109 34.96255000000001 38.0 38.0 38.0 30.0 38.0 110-114 34.5929 38.0 37.4 38.0 26.4 38.0 115-119 34.44025 38.0 37.2 38.0 25.6 38.0 120-124 34.208749999999995 38.0 36.2 38.0 23.2 38.0 125-129 33.63360000000001 38.0 35.6 38.0 17.8 38.0 130-134 32.380849999999995 38.0 34.8 38.0 6.6 38.0 135-139 31.156799999999997 38.0 33.4 38.0 2.0 38.0 140-144 30.170499999999997 38.0 31.6 38.0 2.0 38.0 145-149 29.681400000000004 38.0 29.8 38.0 2.0 38.0 150-151 26.096625 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 115.0 3 22.0 4 1.0 5 1.0 6 3.0 7 0.0 8 2.0 9 3.0 10 4.0 11 3.0 12 3.0 13 5.0 14 3.0 15 9.0 16 9.0 17 10.0 18 6.0 19 9.0 20 13.0 21 16.0 22 11.0 23 26.0 24 19.0 25 20.0 26 27.0 27 27.0 28 34.0 29 58.0 30 61.0 31 87.0 32 104.0 33 140.0 34 143.0 35 173.0 36 448.0 37 2385.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.92969569779643 22.875131164742918 13.483735571878281 24.711437565582372 2 27.369758576874204 27.141041931385008 27.623888182973317 17.86531130876747 3 21.26951625287945 27.92423854619913 29.587919119529047 21.218326081392373 4 24.700988039521583 32.94331773270931 23.868954758190327 18.486739469578783 5 24.960917144346016 35.77384054194893 21.547681083897864 17.717561229807192 6 21.428571428571427 36.81515616999488 23.04147465437788 18.714797747055812 7 21.70125544452985 21.80374071227261 35.58800922367409 20.906994619523445 8 21.20051085568327 27.07535121328225 29.01660280970626 22.707535121328227 9 23.137957512157666 24.648067571026363 28.589710775531096 23.624264141284872 10-14 23.83499639954737 28.93735212426705 25.95411994650756 21.273531529678017 15-19 23.656081361560812 27.962847654628476 26.805728518057286 21.575342465753426 20-24 23.145859085290482 28.579522043675322 26.998351874742482 21.276266996291717 25-29 24.531009738595593 28.559712967708865 26.324961558175296 20.584315735520246 30-34 24.097560975609756 27.337612323491655 27.71245186136072 20.85237483953787 35-39 23.86867333264612 27.83218224925265 26.832285331409132 21.466859086692093 40-44 23.96248899020776 27.848298015646854 27.511527900108803 20.67768509403658 45-49 23.83494893992017 28.344824011196927 27.3858275879944 20.434399460888496 50-54 23.956247111384997 28.408565706362655 27.17095465516356 20.46423252708879 55-59 24.397900370522848 27.33635240839852 27.66055990119391 20.605187319884728 60-64 23.533648898950403 28.020168759003912 27.752623996707143 20.69355834533855 65-69 23.961759868421055 27.230674342105267 28.150699013157894 20.656866776315788 70-74 24.20907840440165 27.602017423200365 26.995771562484077 21.193132609913903 75-79 23.327388535031847 27.979617834394904 28.15796178343949 20.53503184713376 80-84 23.599938515140646 27.816775119126913 27.57595941999283 21.007326945739614 85-89 24.017535619226553 27.822138719273525 27.801262982099058 20.359062679400868 90-94 23.99494177775436 27.667421887349175 27.709573739396177 20.62806259550029 95-99 23.897266972052087 28.004529311853414 27.896443460806015 20.201760255288487 100-104 24.661260521453503 28.171833299117228 27.16074727981934 20.006158899609936 105-109 24.498405185718696 28.336248585245393 26.808313612511576 20.357032616524336 110-114 24.109447599380484 28.074341765616932 27.687145069695408 20.129065565307176 115-119 25.421211655656272 28.02785886208839 26.44543452655298 20.105494955702362 120-124 24.98347653668209 26.95103970715339 27.225583405358687 20.839900350805838 125-129 25.02716407098877 28.05401769545196 26.7190976354323 20.199720598126973 130-134 25.887343607367235 27.482145733770068 26.65521129785749 19.97529936100521 135-139 25.557887759611138 27.828104286345557 26.88356164383562 19.73044631020769 140-144 25.69885820349851 28.348051071488833 26.047584228584284 19.905506496428373 145-149 26.094411402239725 27.44467663291004 26.678454696458232 19.782457268392008 150-151 27.07225321053314 27.16305616811519 27.033337657283695 18.731352964067973 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 65.0 1 33.5 2 3.5 3 5.5 4 5.5 5 4.5 6 2.5 7 1.5 8 3.0 9 3.5 10 2.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.0 16 0.5 17 1.0 18 1.5 19 1.0 20 1.0 21 2.5 22 2.5 23 2.5 24 4.0 25 4.5 26 6.5 27 5.5 28 3.0 29 5.5 30 7.5 31 10.5 32 24.5 33 30.5 34 29.0 35 48.0 36 71.5 37 93.5 38 121.0 39 150.5 40 175.5 41 204.5 42 239.0 43 267.0 44 276.0 45 267.5 46 272.5 47 275.5 48 253.0 49 219.0 50 185.5 51 145.5 52 122.0 53 104.5 54 72.0 55 46.5 56 33.5 57 32.5 58 27.0 59 16.0 60 8.5 61 5.0 62 3.5 63 5.0 64 5.0 65 2.5 66 3.0 67 2.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.7 2 1.625 3 2.325 4 3.85 5 4.05 6 2.35 7 2.4250000000000003 8 2.125 9 2.325 10-14 2.79 15-19 3.64 20-24 2.92 25-29 2.45 30-34 2.625 35-39 2.9899999999999998 40-44 3.495 45-49 3.5450000000000004 50-54 2.635 55-59 2.8400000000000003 60-64 2.82 65-69 2.7199999999999998 70-74 1.855 75-79 1.875 80-84 2.415 85-89 4.195 90-94 5.1049999999999995 95-99 2.855 100-104 2.58 105-109 2.81 110-114 3.15 115-119 2.365 120-124 1.6549999999999998 125-129 3.3649999999999998 130-134 6.885 135-139 9.48 140-144 11.105 145-149 6.6850000000000005 150-151 3.6374999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.56454918032787 97.175 2 0.2817622950819672 0.5499999999999999 3 0.025614754098360656 0.075 4 0.025614754098360656 0.1 5 0.0 0.0 6 0.05122950819672131 0.3 7 0.025614754098360656 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025614754098360656 1.625 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 65 1.625 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.7250000000000001 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.175 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.6625 0.0 0.0 0.0 0.0 104-105 2.0875000000000004 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.775 0.0 0.0 0.0 0.0 110-111 3.225 0.0 0.0 0.0 0.0 112-113 3.6625 0.0 0.0 0.0 0.0 114-115 4.025 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.175 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 5.8375 0.0 0.0 0.0 0.0 124-125 6.25 0.0 0.0 0.0 0.0 126-127 6.7 0.0 0.0 0.0 0.0 128-129 7.25 0.0 0.0 0.0 0.0 130-131 7.7375 0.0 0.0 0.0 0.0 132-133 8.162500000000001 0.0 0.0 0.0 0.0 134-135 8.675 0.0 0.0 0.0 0.0 136-137 9.325 0.0 0.0 0.0 0.0 138-139 9.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAATT 10 0.0068961848 144.46753 4 >>END_MODULE Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039484 spots for SRR7169958.sra Written 1039484 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra Read 1039471 spots for SRR7169958.sra Written 1039471 spots for SRR7169958.sra SRR ids: ['SRR7169958.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v_qb0vl8 SRR7169958.sra spots: 20789433 blocks: [[1, 1039471], [1039472, 2078942], [2078943, 3118413], [3118414, 4157884], [4157885, 5197355], [5197356, 6236826], [6236827, 7276297], [7276298, 8315768], [8315769, 9355239], [9355240, 10394710], [10394711, 11434181], [11434182, 12473652], [12473653, 13513123], [13513124, 14552594], [14552595, 15592065], [15592066, 16631536], [16631537, 17671007], [17671008, 18710478], [18710479, 19749949], [19749950, 20789433]] SRR7169958 file size 7023156 SRR7169958 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169958 SRR7169958_1.fastq SRR7169958_2.fastq Input file: SRR7169958_1.fastq Paired file: SRR7169958_2.fastq trimmed: SRR7169958-trimmed-pair1.fastq, SRR7169958-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:21:10 2025 >> started Wed Feb 12 05:21:32 2025 >> done (22.265s) 20789433 read pairs processed; of these: 41775 ( 0.20%) short read pairs filtered out after trimming by size control 92161 ( 0.44%) empty read pairs filtered out after trimming by size control 20655497 (99.36%) read pairs available; of these: 10182182 (49.30%) trimmed read pairs available after processing 10473315 (50.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 2 0.00% 22 7 0.00% 23 9 0.00% 24 8 0.00% 25 7 0.00% 26 8 0.00% 27 9 0.00% 28 11 0.00% 29 14 0.00% 30 25 0.00% 31 22 0.00% 32 23 0.00% 33 19 0.00% 34 27 0.00% 35 27 0.00% 36 18 0.00% 37 35 0.00% 38 29 0.00% 39 37 0.00% 40 51 0.00% 41 60 0.00% 42 69 0.00% 43 59 0.00% 44 83 0.00% 45 83 0.00% 46 116 0.00% 47 142 0.00% 48 124 0.00% 49 148 0.00% 50 195 0.00% 51 197 0.00% 52 245 0.00% 53 243 0.00% 54 260 0.00% 55 266 0.00% 56 346 0.00% 57 344 0.00% 58 409 0.00% 59 472 0.00% 60 586 0.00% 61 614 0.00% 62 718 0.00% 63 860 0.00% 64 908 0.00% 65 1021 0.00% 66 1136 0.01% 67 1306 0.01% 68 1452 0.01% 69 2086 0.01% 70 2640 0.01% 71 2387 0.01% 72 2411 0.01% 73 2802 0.01% 74 3045 0.01% 75 3322 0.02% 76 3628 0.02% 77 3978 0.02% 78 4371 0.02% 79 5078 0.02% 80 5683 0.03% 81 6259 0.03% 82 7252 0.04% 83 8112 0.04% 84 10778 0.05% 85 12353 0.06% 86 13240 0.06% 87 13763 0.07% 88 14378 0.07% 89 15324 0.07% 90 16464 0.08% 91 17440 0.08% 92 18723 0.09% 93 20252 0.10% 94 21977 0.11% 95 23514 0.11% 96 24928 0.12% 97 25838 0.13% 98 26672 0.13% 99 27971 0.14% 100 29396 0.14% 101 31002 0.15% 102 32646 0.16% 103 34658 0.17% 104 36027 0.17% 105 38356 0.19% 106 39729 0.19% 107 41293 0.20% 108 42865 0.21% 109 43955 0.21% 110 44663 0.22% 111 46338 0.22% 112 48087 0.23% 113 50419 0.24% 114 52706 0.26% 115 55350 0.27% 116 57947 0.28% 117 59827 0.29% 118 60428 0.29% 119 61617 0.30% 120 62916 0.30% 121 64152 0.31% 122 65376 0.32% 123 68469 0.33% 124 71553 0.35% 125 74160 0.36% 126 76998 0.37% 127 79085 0.38% 128 81378 0.39% 129 83789 0.41% 130 85931 0.42% 131 88444 0.43% 132 91461 0.44% 133 95872 0.46% 134 98761 0.48% 135 104139 0.50% 136 109709 0.53% 137 115704 0.56% 138 123239 0.60% 139 130997 0.63% 140 138027 0.67% 141 147983 0.72% 142 156883 0.76% 143 168200 0.81% 144 184982 0.90% 145 208358 1.01% 146 246321 1.19% 147 320956 1.55% 148 434335 2.10% 149 813788 3.94% 150 4303379 20.83% 151 10473315 50.70% 20655497 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=262.69 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=28.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=31 prefix-density=0.39 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=302.77 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=28.4 sequence=AAGAAGAAGAAG SRR7169958 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:22:14 Started mapping on | Feb 12 05:22:14 Finished on | Feb 12 05:24:24 Mapping speed, Million of reads per hour | 572.00 Number of input reads | 20655497 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 19433386 Uniquely mapped reads % | 94.08% Average mapped length | 290.50 Number of splices: Total | 18858122 Number of splices: Annotated (sjdb) | 18554854 Number of splices: GT/AG | 18576267 Number of splices: GC/AG | 225860 Number of splices: AT/AC | 15662 Number of splices: Non-canonical | 40333 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382246 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 57000 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 873041 873041 873041 N_multimapping 382246 382246 382246 N_noFeature 354662 19215538 468817 N_ambiguous 175907 1070 71491 UnstrandedReadsAssigned:18902817 PositiveStrandReadsAssigned:216778 NegativeStrandReadsAssigned:18893078 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7169958 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169958-trimmed-pair1.fastq SRR7169958-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,655,497 reads, 18,825,509 reads pseudoaligned [quant] estimated average fragment length: 218.723 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52401 SRR7169958.ke.tsv 34699 SRR7169958.se.tsv 87100 total ==> SRR7169958.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.28 336 9.51372 Potri.005G024800.1.v4.1 1035 817.277 66 4.11647 Potri.004G059700.1.v4.1 961 743.287 4 0.274318 Potri.007G009000.2.v4.1 1416 1198.28 0 0 Potri.003G141000.2.v4.1 2943 2725.28 439.121 8.21341 Potri.016G087400.1.v4.1 270 90.3533 1705 961.903 Potri.015G069301.1.v4.1 564 349.543 0 0 Potri.010G195200.1.v4.1 1773 1555.28 48 1.5732 Potri.012G127500.1.v4.1 977 759.282 9644 647.447 ==> SRR7169958.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 592 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 401 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169958 completed mapping pipeline successfully