Starting /dee2/code/volunteer_pipeline.sh SRR7169959 current disk space = 3049920888832 free memory = 1582703852 SRR7169959 SRAfilesize dd7fbbc24d3c810f94e51b04f85a38c7 SRR7169959.sra SRR7169959.sra file validated SRR7169959 is paired end SRR7169959 is conventional basespace SRR7169959 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169959_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.868 34.0 33.0 34.0 33.0 34.0 2 33.372 34.0 34.0 34.0 33.0 34.0 3 33.352 34.0 34.0 34.0 33.0 34.0 4 33.43025 34.0 34.0 34.0 33.0 34.0 5 33.4345 34.0 34.0 34.0 33.0 34.0 6 37.094 38.0 37.0 38.0 36.0 38.0 7 37.39125 38.0 38.0 38.0 37.0 38.0 8 37.501 38.0 38.0 38.0 37.0 38.0 9 37.59375 38.0 38.0 38.0 38.0 38.0 10-14 37.556799999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.5172 38.0 38.0 38.0 38.0 38.0 20-24 37.51455 38.0 38.0 38.0 38.0 38.0 25-29 37.4364 38.0 38.0 38.0 37.6 38.0 30-34 37.44275 38.0 38.0 38.0 37.6 38.0 35-39 37.39585 38.0 38.0 38.0 37.4 38.0 40-44 37.20295 38.0 38.0 38.0 36.6 38.0 45-49 37.1574 38.0 38.0 38.0 36.0 38.0 50-54 37.05975 38.0 38.0 38.0 36.0 38.0 55-59 36.993199999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.00105 38.0 38.0 38.0 36.0 38.0 65-69 36.936400000000006 38.0 38.0 38.0 35.6 38.0 70-74 36.80875 38.0 38.0 38.0 34.8 38.0 75-79 36.64095 38.0 38.0 38.0 34.8 38.0 80-84 36.5458 38.0 38.0 38.0 34.2 38.0 85-89 36.41535 38.0 38.0 38.0 34.0 38.0 90-94 36.368849999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.2867 38.0 38.0 38.0 34.0 38.0 100-104 36.10809999999999 38.0 37.4 38.0 33.4 38.0 105-109 36.02040000000001 38.0 37.2 38.0 33.4 38.0 110-114 35.7084 38.0 37.0 38.0 32.0 38.0 115-119 35.45715 38.0 36.2 38.0 30.6 38.0 120-124 35.20445 38.0 36.0 38.0 29.0 38.0 125-129 35.026050000000005 38.0 35.8 38.0 28.0 38.0 130-134 34.6015 38.0 35.2 38.0 26.4 38.0 135-139 34.25005 38.0 35.0 38.0 24.2 38.0 140-144 33.9661 38.0 35.0 38.0 23.0 38.0 145-149 33.3652 38.0 34.4 38.0 18.6 38.0 150-151 29.548875000000002 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 6.0 16 4.0 17 3.0 18 6.0 19 8.0 20 6.0 21 4.0 22 4.0 23 17.0 24 14.0 25 18.0 26 17.0 27 19.0 28 25.0 29 37.0 30 54.0 31 57.0 32 63.0 33 114.0 34 159.0 35 283.0 36 661.0 37 2415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.03869653767821 13.314663951120162 9.037678207739308 36.60896130346232 2 23.525 14.549999999999999 31.324999999999996 30.599999999999998 3 20.200000000000003 19.375 25.624999999999996 34.8 4 23.825 25.35 21.95 28.875 5 22.75 29.675 24.7 22.875 6 19.975 34.65 24.2 21.175 7 15.25 28.875 37.875 18.0 8 17.675 27.750000000000004 29.7 24.875 9 16.525000000000002 26.25 33.800000000000004 23.425 10-14 19.895 29.99 26.775 23.34 15-19 19.525000000000002 28.694999999999997 27.275 24.505 20-24 19.5 28.98 27.245 24.275 25-29 19.259999999999998 29.104999999999997 27.589999999999996 24.044999999999998 30-34 20.150000000000002 28.395 27.045 24.41 35-39 20.09 29.18 26.775 23.955000000000002 40-44 19.8 28.449999999999996 27.810000000000002 23.94 45-49 19.915 28.610000000000003 27.205000000000002 24.27 50-54 19.885 28.485 27.365000000000002 24.265 55-59 20.18 28.999999999999996 26.845000000000002 23.974999999999998 60-64 20.22 28.105000000000004 27.58 24.095 65-69 20.72 28.349999999999998 27.29 23.64 70-74 20.655 28.775000000000002 26.650000000000002 23.919999999999998 75-79 20.465 28.125 27.07 24.34 80-84 21.224999999999998 28.235 26.995 23.544999999999998 85-89 20.215 27.694999999999997 28.084999999999997 24.005000000000003 90-94 20.705000000000002 27.779999999999998 26.979999999999997 24.535 95-99 20.54 27.275 27.74 24.445 100-104 20.74 27.38 27.35 24.529999999999998 105-109 20.64 27.6 27.395000000000003 24.365000000000002 110-114 20.06 28.744999999999997 26.900000000000002 24.295 115-119 20.875 28.895 26.400000000000002 23.830000000000002 120-124 20.835 28.555000000000003 26.200000000000003 24.41 125-129 20.955 27.939999999999998 27.065 24.04 130-134 21.52 28.49 26.22 23.77 135-139 21.105 28.435 26.395000000000003 24.065 140-144 20.91 28.835 25.715 24.54 145-149 21.490000000000002 27.810000000000002 26.13 24.57 150-151 20.962500000000002 27.35 26.75 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 5.5 27 9.0 28 9.5 29 9.5 30 18.0 31 26.5 32 28.5 33 34.5 34 46.5 35 67.0 36 95.0 37 99.5 38 114.5 39 152.5 40 176.0 41 200.5 42 232.0 43 251.0 44 255.0 45 262.0 46 268.0 47 253.5 48 233.0 49 200.0 50 163.5 51 148.5 52 136.0 53 118.5 54 90.5 55 65.5 56 51.5 57 37.0 58 28.0 59 22.5 60 18.5 61 16.5 62 12.0 63 12.5 64 7.5 65 3.0 66 4.0 67 4.0 68 3.0 69 2.0 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49584068565667 98.675 2 0.45374338290899924 0.8999999999999999 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 14 0.35000000000000003 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5249999999999999 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.4500000000000002 0.0 0.0 0.0 0.0 102-103 1.625 0.0 0.0 0.0 0.0 104-105 1.7375 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.825 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.987500000000001 0.0 0.0 0.0 0.0 124-125 5.375 0.0 0.0 0.0 0.0 126-127 5.824999999999999 0.0 0.0 0.0 0.0 128-129 6.375 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.4625 0.0 0.0 0.0 0.0 134-135 8.0875 0.0 0.0 0.0 0.0 136-137 8.625 0.0 0.0 0.0 0.0 138-139 9.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGCA 10 0.006830828 145.0 8 AAGGCGG 10 0.006830828 145.0 2 >>END_MODULE SRR7169959 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169959_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.57725 33.0 33.0 34.0 31.0 34.0 2 32.24225 34.0 33.0 34.0 31.0 34.0 3 32.2865 34.0 33.0 34.0 31.0 34.0 4 31.91125 34.0 33.0 34.0 31.0 34.0 5 31.8675 34.0 33.0 34.0 31.0 34.0 6 36.30625 38.0 38.0 38.0 34.0 38.0 7 36.3075 38.0 38.0 38.0 35.0 38.0 8 36.312 38.0 38.0 38.0 35.0 38.0 9 36.404 38.0 38.0 38.0 36.0 38.0 10-14 36.3178 38.0 38.0 38.0 36.0 38.0 15-19 36.012750000000004 38.0 38.0 38.0 34.8 38.0 20-24 36.1985 38.0 38.0 38.0 35.6 38.0 25-29 36.27470000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.3069 38.0 38.0 38.0 36.0 38.0 35-39 36.19595 38.0 38.0 38.0 35.6 38.0 40-44 35.99245 38.0 38.0 38.0 34.8 38.0 45-49 35.83945 38.0 38.0 38.0 34.0 38.0 50-54 36.0869 38.0 38.0 38.0 34.8 38.0 55-59 36.09745 38.0 38.0 38.0 34.8 38.0 60-64 36.013850000000005 38.0 38.0 38.0 34.2 38.0 65-69 35.946999999999996 38.0 38.0 38.0 34.0 38.0 70-74 35.8699 38.0 38.0 38.0 34.0 38.0 75-79 35.789750000000005 38.0 38.0 38.0 34.0 38.0 80-84 35.724000000000004 38.0 38.0 38.0 33.8 38.0 85-89 34.9969 38.0 38.0 38.0 29.6 38.0 90-94 34.629200000000004 38.0 38.0 38.0 27.6 38.0 95-99 35.10215 38.0 38.0 38.0 28.4 38.0 100-104 35.274950000000004 38.0 38.0 38.0 31.0 38.0 105-109 35.124700000000004 38.0 38.0 38.0 30.2 38.0 110-114 34.87114999999999 38.0 37.4 38.0 28.4 38.0 115-119 34.759949999999996 38.0 37.0 38.0 27.6 38.0 120-124 34.552 38.0 36.8 38.0 26.8 38.0 125-129 33.8621 38.0 35.4 38.0 18.4 38.0 130-134 32.53805 38.0 34.8 38.0 8.8 38.0 135-139 31.571500000000004 38.0 33.8 38.0 2.0 38.0 140-144 30.721150000000005 38.0 32.6 38.0 2.0 38.0 145-149 30.1637 38.0 31.2 38.0 2.0 38.0 150-151 26.14975 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 78.0 3 14.0 4 5.0 5 2.0 6 3.0 7 0.0 8 2.0 9 0.0 10 3.0 11 2.0 12 6.0 13 10.0 14 2.0 15 4.0 16 11.0 17 13.0 18 8.0 19 3.0 20 7.0 21 15.0 22 10.0 23 20.0 24 21.0 25 25.0 26 28.0 27 27.0 28 42.0 29 62.0 30 64.0 31 69.0 32 129.0 33 157.0 34 123.0 35 217.0 36 436.0 37 2382.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.591916558018255 20.547588005215122 14.810951760104302 26.049543676662324 2 27.585335018963335 26.85208596713021 27.787610619469028 17.774968394437423 3 21.86389029964449 26.96800406297613 30.75165058405282 20.416455053326562 4 24.626481195260176 31.96805770221535 23.57032457496136 19.83513652756311 5 24.858027878162105 35.389778007227676 21.94114610221993 17.811048012390295 6 21.448538754764932 36.569250317662004 23.684879288437102 18.297331639135958 7 22.038637519064565 21.96237925775292 36.88357905439756 19.115404168784952 8 22.84263959390863 26.31979695431472 26.16751269035533 24.67005076142132 9 21.61544323088646 25.654051308102616 29.71805943611887 23.01244602489205 10-14 24.440479225082846 27.73387713484578 26.39816466989549 21.427478970175887 15-19 24.0203379384726 27.779775050074466 27.091572081557185 21.10831492989574 20-24 24.470636256951884 27.62896066125823 26.44012449614776 21.460278585642126 25-29 23.473175692855328 27.887109077040428 27.21586575133486 21.423849478769387 30-34 24.054177911298947 27.358826824176386 27.638881816793116 20.948113447731554 35-39 23.481368044920877 27.289433384379784 27.53445635528331 21.694742215416028 40-44 24.683122081387594 27.377225842869606 27.592754143788166 20.346897931954636 45-49 23.771839671120247 27.733812949640285 27.183967112024664 21.3103802672148 50-54 23.59470468431772 28.24338085539715 27.35234215885947 20.80957230142566 55-59 24.24165179709406 28.049961763956155 26.907978587815446 20.800407851134338 60-64 23.807339449541285 27.77777777777778 27.477064220183482 20.93781855249745 65-69 24.289208193213085 27.59604606134719 27.37185366350759 20.742892081932133 70-74 24.642748555792036 26.978818283166113 27.267659876355527 21.110773284686328 75-79 23.577688839353563 28.213182025431887 27.240488373271187 20.968640761943362 80-84 24.319788435131972 27.41189035243859 27.427147434267408 20.84117377816203 85-89 24.238972872230274 27.707599917167116 27.391799544419133 20.661627666183474 90-94 24.235454022688067 27.685712792095774 26.99566103821423 21.08317214700193 95-99 24.157991426821802 27.995509287609714 27.275974688711983 20.5705245968565 100-104 25.0623504860793 27.485112230874943 27.551280093652974 19.901257189392783 105-109 24.575623183973082 27.741244838660347 27.12953050925218 20.55360146811439 110-114 24.887548558576977 26.74810877121243 27.78061746064199 20.583725209568595 115-119 24.766165107767385 27.765351769011794 27.074013826758847 20.394469296461974 120-124 25.040469445568597 27.99473897207608 27.23593686766491 19.728854714690407 125-129 25.03977418527072 27.729022324865284 27.25173210161663 19.97947138824737 130-134 25.740149094781685 27.598509052183175 26.900958466453673 19.76038338658147 135-139 25.281970250095355 27.526834849888303 27.28709202855119 19.904102871465156 140-144 26.236559139784948 27.69782189137028 26.247587537910118 19.818031430934656 145-149 25.61829954357287 28.054346672327778 26.716909033011362 19.610444751087993 150-151 26.79167736963781 26.663241715900334 26.778833804264064 19.766247110197792 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 45.0 1 24.5 2 3.5 3 4.0 4 4.0 5 1.5 6 0.5 7 1.0 8 1.0 9 1.0 10 2.0 11 2.0 12 0.5 13 0.5 14 1.5 15 1.5 16 0.5 17 1.0 18 1.5 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.5 25 3.0 26 3.0 27 3.5 28 5.5 29 8.0 30 12.0 31 18.5 32 22.0 33 25.5 34 31.5 35 39.0 36 59.0 37 76.5 38 98.5 39 139.0 40 167.5 41 203.5 42 261.5 43 286.0 44 286.0 45 289.0 46 284.0 47 265.5 48 234.0 49 209.5 50 174.5 51 137.0 52 124.5 53 111.5 54 84.0 55 57.0 56 44.0 57 38.0 58 28.0 59 19.5 60 17.0 61 13.5 62 9.5 63 9.5 64 5.5 65 2.0 66 3.0 67 2.5 68 1.5 69 2.0 70 2.0 71 1.0 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 4.125 2 1.125 3 1.55 4 2.9499999999999997 5 3.15 6 1.625 7 1.6500000000000001 8 1.5 9 1.575 10-14 1.925 15-19 2.645 20-24 2.005 25-29 1.675 30-34 1.805 35-39 2.0500000000000003 40-44 2.565 45-49 2.7 50-54 1.7999999999999998 55-59 1.925 60-64 1.9 65-69 1.87 70-74 1.3299999999999998 75-79 1.3050000000000002 80-84 1.685 85-89 3.42 90-94 4.3549999999999995 95-99 2.02 100-104 1.765 105-109 1.915 110-114 2.18 115-119 1.6400000000000001 120-124 1.16 125-129 2.5749999999999997 130-134 6.1 135-139 8.235000000000001 140-144 9.325 145-149 5.79 150-151 2.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54105048444671 97.6 2 0.33146353901070885 0.65 3 0.05099439061703213 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025497195308516064 0.2 9 0.0 0.0 >10 0.05099439061703213 1.4000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 45 1.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 11 0.27499999999999997 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.525 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.625 0.0 0.0 0.0 0.0 114-115 2.8375 0.0 0.0 0.0 0.0 116-117 3.2 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.7125 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.4625 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.375 0.0 0.0 0.0 0.0 132-133 6.775 0.0 0.0 0.0 0.0 134-135 7.3375 0.0 0.0 0.0 0.0 136-137 7.8 0.0 0.0 0.0 0.0 138-139 8.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832058 spots for SRR7169959.sra Written 832058 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra Read 832048 spots for SRR7169959.sra Written 832048 spots for SRR7169959.sra SRR ids: ['SRR7169959.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_grinf0vx SRR7169959.sra spots: 16640970 blocks: [[1, 832048], [832049, 1664096], [1664097, 2496144], [2496145, 3328192], [3328193, 4160240], [4160241, 4992288], [4992289, 5824336], [5824337, 6656384], [6656385, 7488432], [7488433, 8320480], [8320481, 9152528], [9152529, 9984576], [9984577, 10816624], [10816625, 11648672], [11648673, 12480720], [12480721, 13312768], [13312769, 14144816], [14144817, 14976864], [14976865, 15808912], [15808913, 16640970]] SRR7169959 file size 5617378 SRR7169959 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169959 SRR7169959_1.fastq SRR7169959_2.fastq Input file: SRR7169959_1.fastq Paired file: SRR7169959_2.fastq trimmed: SRR7169959-trimmed-pair1.fastq, SRR7169959-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:04:39 2025 >> started Wed Feb 12 06:04:58 2025 >> done (18.454s) 16640970 read pairs processed; of these: 33191 ( 0.20%) short read pairs filtered out after trimming by size control 119659 ( 0.72%) empty read pairs filtered out after trimming by size control 16488120 (99.08%) read pairs available; of these: 7969411 (48.33%) trimmed read pairs available after processing 8518709 (51.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 9 0.00% 20 5 0.00% 21 6 0.00% 22 8 0.00% 23 6 0.00% 24 8 0.00% 25 9 0.00% 26 8 0.00% 27 5 0.00% 28 8 0.00% 29 8 0.00% 30 13 0.00% 31 10 0.00% 32 10 0.00% 33 12 0.00% 34 24 0.00% 35 30 0.00% 36 26 0.00% 37 16 0.00% 38 31 0.00% 39 25 0.00% 40 35 0.00% 41 41 0.00% 42 44 0.00% 43 46 0.00% 44 55 0.00% 45 67 0.00% 46 108 0.00% 47 95 0.00% 48 119 0.00% 49 126 0.00% 50 131 0.00% 51 153 0.00% 52 164 0.00% 53 195 0.00% 54 194 0.00% 55 220 0.00% 56 219 0.00% 57 254 0.00% 58 273 0.00% 59 358 0.00% 60 401 0.00% 61 433 0.00% 62 453 0.00% 63 569 0.00% 64 663 0.00% 65 755 0.00% 66 837 0.01% 67 892 0.01% 68 1046 0.01% 69 1400 0.01% 70 2004 0.01% 71 1728 0.01% 72 1756 0.01% 73 1958 0.01% 74 2193 0.01% 75 2353 0.01% 76 2698 0.02% 77 2809 0.02% 78 3154 0.02% 79 3540 0.02% 80 3925 0.02% 81 4536 0.03% 82 5201 0.03% 83 5794 0.04% 84 7778 0.05% 85 9179 0.06% 86 9571 0.06% 87 10260 0.06% 88 10877 0.07% 89 11153 0.07% 90 11926 0.07% 91 12799 0.08% 92 13733 0.08% 93 14799 0.09% 94 15884 0.10% 95 16824 0.10% 96 17767 0.11% 97 19223 0.12% 98 19747 0.12% 99 20424 0.12% 100 21449 0.13% 101 22616 0.14% 102 23702 0.14% 103 25270 0.15% 104 26791 0.16% 105 28069 0.17% 106 29589 0.18% 107 30340 0.18% 108 31248 0.19% 109 32413 0.20% 110 33235 0.20% 111 34127 0.21% 112 35879 0.22% 113 37485 0.23% 114 39298 0.24% 115 41120 0.25% 116 42725 0.26% 117 44566 0.27% 118 45758 0.28% 119 46147 0.28% 120 47194 0.29% 121 48570 0.29% 122 49746 0.30% 123 51121 0.31% 124 54225 0.33% 125 56111 0.34% 126 58735 0.36% 127 60344 0.37% 128 61902 0.38% 129 64239 0.39% 130 66042 0.40% 131 67698 0.41% 132 71014 0.43% 133 73430 0.45% 134 76411 0.46% 135 80614 0.49% 136 83850 0.51% 137 89386 0.54% 138 95717 0.58% 139 102225 0.62% 140 106830 0.65% 141 115128 0.70% 142 122440 0.74% 143 130898 0.79% 144 144787 0.88% 145 162778 0.99% 146 192627 1.17% 147 250191 1.52% 148 339594 2.06% 149 640066 3.88% 150 3457452 20.97% 151 8518709 51.67% 16488120 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.48 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=252.90 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=17.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=14 fanout-score=261.52 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=26.7 sequence=AAGAAGAAGAAG SRR7169959 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:05:39 Started mapping on | Feb 12 06:05:40 Finished on | Feb 12 06:07:31 Mapping speed, Million of reads per hour | 534.75 Number of input reads | 16488120 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15301149 Uniquely mapped reads % | 92.80% Average mapped length | 291.17 Number of splices: Total | 14208411 Number of splices: Annotated (sjdb) | 13956938 Number of splices: GT/AG | 13996393 Number of splices: GC/AG | 170998 Number of splices: AT/AC | 11515 Number of splices: Non-canonical | 29505 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 294992 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 205669 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916782 916782 916782 N_multimapping 294992 294992 294992 N_noFeature 315752 15118911 402109 N_ambiguous 157210 820 60867 UnstrandedReadsAssigned:14828187 PositiveStrandReadsAssigned:181418 NegativeStrandReadsAssigned:14838173 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169959 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169959-trimmed-pair1.fastq SRR7169959-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,488,120 reads, 14,898,431 reads pseudoaligned [quant] estimated average fragment length: 219.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR7169959.ke.tsv 34699 SRR7169959.se.tsv 87100 total ==> SRR7169959.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.96 253 8.1256 Potri.005G024800.1.v4.1 1035 816.958 51 3.60884 Potri.004G059700.1.v4.1 961 742.958 8 0.622477 Potri.007G009000.2.v4.1 1416 1197.96 0 0 Potri.003G141000.2.v4.1 2943 2724.96 214.029 4.54057 Potri.016G087400.1.v4.1 270 88.2558 1727.5 1131.55 Potri.015G069301.1.v4.1 564 348.598 0 0 Potri.010G195200.1.v4.1 1773 1554.96 22 0.817902 Potri.012G127500.1.v4.1 977 758.958 8745 666.1 ==> SRR7169959.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 711 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169959 completed mapping pipeline successfully