Starting /dee2/code/volunteer_pipeline.sh SRR7169960 current disk space = 3049647529984 free memory = 1581260080 SRR7169960 SRAfilesize 449e23ba7df6c95beeb3980d0fb8b33c SRR7169960.sra SRR7169960.sra file validated SRR7169960 is paired end SRR7169960 is conventional basespace SRR7169960 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169960_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.012 34.0 34.0 34.0 33.0 34.0 2 33.42275 34.0 34.0 34.0 33.0 34.0 3 33.44775 34.0 34.0 34.0 33.0 34.0 4 33.53825 34.0 34.0 34.0 33.0 34.0 5 33.54525 34.0 34.0 34.0 33.0 34.0 6 37.30375 38.0 38.0 38.0 36.0 38.0 7 37.529 38.0 38.0 38.0 37.0 38.0 8 37.64225 38.0 38.0 38.0 38.0 38.0 9 37.66375 38.0 38.0 38.0 38.0 38.0 10-14 37.6248 38.0 38.0 38.0 38.0 38.0 15-19 37.64444999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.59455 38.0 38.0 38.0 38.0 38.0 25-29 37.5773 38.0 38.0 38.0 38.0 38.0 30-34 37.52085 38.0 38.0 38.0 38.0 38.0 35-39 37.47175 38.0 38.0 38.0 37.6 38.0 40-44 37.33235 38.0 38.0 38.0 37.0 38.0 45-49 37.26090000000001 38.0 38.0 38.0 36.8 38.0 50-54 37.1687 38.0 38.0 38.0 36.4 38.0 55-59 37.141949999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.141349999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.0951 38.0 38.0 38.0 36.0 38.0 70-74 36.987 38.0 38.0 38.0 36.0 38.0 75-79 36.8348 38.0 38.0 38.0 35.4 38.0 80-84 36.712599999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.675149999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.67715 38.0 38.0 38.0 34.8 38.0 95-99 36.4572 38.0 38.0 38.0 34.0 38.0 100-104 36.24285 38.0 38.0 38.0 34.0 38.0 105-109 36.17595 38.0 37.6 38.0 33.8 38.0 110-114 35.8878 38.0 37.2 38.0 32.4 38.0 115-119 35.754650000000005 38.0 37.0 38.0 32.0 38.0 120-124 35.56335 38.0 36.4 38.0 31.0 38.0 125-129 35.227549999999994 38.0 36.0 38.0 29.6 38.0 130-134 34.86635 38.0 35.4 38.0 27.8 38.0 135-139 34.3598 38.0 35.0 38.0 25.4 38.0 140-144 33.9655 38.0 35.0 38.0 22.6 38.0 145-149 33.2467 38.0 34.4 38.0 18.2 38.0 150-151 29.354999999999997 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 5.0 17 0.0 18 5.0 19 12.0 20 7.0 21 7.0 22 4.0 23 7.0 24 11.0 25 12.0 26 22.0 27 25.0 28 19.0 29 29.0 30 39.0 31 48.0 32 73.0 33 96.0 34 140.0 35 252.0 36 653.0 37 2528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.11988823977648 13.79222758445517 8.026416052832106 34.06146812293625 2 22.85 14.224999999999998 32.9 30.025000000000002 3 19.975 17.599999999999998 26.950000000000003 35.475 4 22.625 25.25 22.55 29.575000000000003 5 23.525 30.049999999999997 24.675 21.75 6 21.224999999999998 33.425 23.7 21.65 7 14.374999999999998 29.15 38.824999999999996 17.65 8 17.925 27.400000000000002 30.975 23.7 9 17.599999999999998 24.525 34.925 22.95 10-14 20.165 29.39 27.27 23.175 15-19 20.119999999999997 28.51 27.51 23.86 20-24 19.7 28.655 27.779999999999998 23.865 25-29 20.225 29.43 27.355 22.99 30-34 19.33 29.145 27.105 24.42 35-39 20.255000000000003 28.08 27.939999999999998 23.724999999999998 40-44 20.075000000000003 28.115000000000002 27.625 24.185000000000002 45-49 20.544999999999998 28.505000000000003 27.284999999999997 23.665 50-54 19.855 28.21 27.689999999999998 24.245 55-59 19.919999999999998 28.18 27.26 24.64 60-64 20.45 28.110000000000003 27.045 24.395 65-69 19.950000000000003 28.455000000000002 27.6 23.995 70-74 20.755000000000003 28.060000000000002 27.065 24.12 75-79 20.275000000000002 28.21 27.165 24.349999999999998 80-84 20.54 28.16 26.86 24.44 85-89 20.645 28.050000000000004 27.334999999999997 23.97 90-94 20.64 28.410000000000004 26.705000000000002 24.245 95-99 20.335 27.85 27.279999999999998 24.535 100-104 20.91 28.345 26.490000000000002 24.255 105-109 20.94 28.265 26.99 23.805 110-114 21.32 28.244999999999997 26.424999999999997 24.01 115-119 20.880000000000003 28.355000000000004 26.724999999999998 24.04 120-124 21.959999999999997 28.294999999999998 25.740000000000002 24.005000000000003 125-129 21.54 27.955000000000002 26.755000000000003 23.75 130-134 21.565 28.21 25.765 24.46 135-139 20.979999999999997 28.37 26.35 24.3 140-144 20.96 28.810000000000002 25.979999999999997 24.25 145-149 20.91 28.76 26.155 24.175 150-151 20.8 29.4 25.974999999999998 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 3.0 26 7.5 27 7.0 28 6.0 29 12.5 30 15.0 31 21.0 32 32.0 33 40.0 34 47.5 35 60.0 36 77.5 37 97.5 38 117.0 39 148.0 40 187.5 41 211.5 42 212.0 43 230.5 44 269.5 45 279.5 46 266.0 47 255.5 48 244.5 49 221.0 50 188.5 51 147.5 52 120.0 53 100.5 54 89.0 55 70.5 56 48.5 57 45.5 58 33.0 59 18.5 60 17.0 61 15.0 62 10.5 63 8.0 64 5.5 65 4.5 66 3.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57254211717374 99.0 2 0.4023133014835303 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025144581342720643 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATATAATCTCGTATGC 8 0.2 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.825 0.0 0.0 0.0 0.0 90-91 0.975 0.0 0.0 0.0 0.0 92-93 1.2 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.5125 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.4625000000000004 0.0 0.0 0.0 0.0 108-109 3.925 0.0 0.0 0.0 0.0 110-111 4.5 0.0 0.0 0.0 0.0 112-113 5.0375 0.0 0.0 0.0 0.0 114-115 5.525 0.0 0.0 0.0 0.0 116-117 5.8625 0.0 0.0 0.0 0.0 118-119 6.6 0.0 0.0 0.0 0.0 120-121 7.0875 0.0 0.0 0.0 0.0 122-123 7.762499999999999 0.0 0.0 0.0 0.0 124-125 8.5375 0.0 0.0 0.0 0.0 126-127 9.175 0.0 0.0 0.0 0.0 128-129 9.825 0.0 0.0 0.0 0.0 130-131 10.4375 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 12.024999999999999 0.0 0.0 0.0 0.0 136-137 12.675 0.0 0.0 0.0 0.0 138-139 13.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTCA 10 0.006830828 145.0 4 CTTTCTT 10 0.006830828 145.0 6 >>END_MODULE SRR7169960 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169960_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.965 33.0 33.0 34.0 32.0 34.0 2 32.54825 34.0 33.0 34.0 32.0 34.0 3 32.58125 34.0 33.0 34.0 32.0 34.0 4 32.46175 34.0 33.0 34.0 32.0 34.0 5 32.4015 34.0 33.0 34.0 32.0 34.0 6 36.6325 38.0 38.0 38.0 36.0 38.0 7 36.58925 38.0 38.0 38.0 37.0 38.0 8 36.671 38.0 38.0 38.0 37.0 38.0 9 36.6695 38.0 38.0 38.0 37.0 38.0 10-14 36.606199999999994 38.0 38.0 38.0 37.0 38.0 15-19 36.3779 38.0 38.0 38.0 36.4 38.0 20-24 36.53240000000001 38.0 38.0 38.0 36.8 38.0 25-29 36.53675 38.0 38.0 38.0 36.6 38.0 30-34 36.63715 38.0 38.0 38.0 37.0 38.0 35-39 36.51754999999999 38.0 38.0 38.0 36.8 38.0 40-44 36.36395 38.0 38.0 38.0 36.4 38.0 45-49 36.1965 38.0 38.0 38.0 36.2 38.0 50-54 36.467699999999994 38.0 38.0 38.0 36.2 38.0 55-59 36.4354 38.0 38.0 38.0 36.4 38.0 60-64 36.359 38.0 38.0 38.0 36.0 38.0 65-69 36.3505 38.0 38.0 38.0 36.0 38.0 70-74 36.29025 38.0 38.0 38.0 36.0 38.0 75-79 36.20455 38.0 38.0 38.0 35.0 38.0 80-84 36.116499999999995 38.0 38.0 38.0 35.0 38.0 85-89 35.806799999999996 38.0 38.0 38.0 34.4 38.0 90-94 35.376549999999995 38.0 38.0 38.0 32.4 38.0 95-99 35.73485 38.0 38.0 38.0 33.8 38.0 100-104 35.763099999999994 38.0 38.0 38.0 34.0 38.0 105-109 35.62615 38.0 38.0 38.0 33.2 38.0 110-114 35.47485 38.0 38.0 38.0 33.0 38.0 115-119 35.28875000000001 38.0 38.0 38.0 31.2 38.0 120-124 35.00035 38.0 37.4 38.0 29.4 38.0 125-129 34.5226 38.0 36.2 38.0 26.0 38.0 130-134 33.5609 38.0 35.8 38.0 17.0 38.0 135-139 32.4896 38.0 35.0 38.0 6.4 38.0 140-144 31.567149999999998 38.0 33.8 38.0 2.0 38.0 145-149 31.0286 38.0 32.8 38.0 2.0 38.0 150-151 27.45875 35.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 68.0 3 8.0 4 2.0 5 1.0 6 4.0 7 3.0 8 1.0 9 1.0 10 1.0 11 1.0 12 3.0 13 1.0 14 7.0 15 7.0 16 2.0 17 9.0 18 8.0 19 10.0 20 13.0 21 6.0 22 9.0 23 12.0 24 11.0 25 23.0 26 27.0 27 37.0 28 33.0 29 35.0 30 52.0 31 62.0 32 84.0 33 130.0 34 133.0 35 151.0 36 452.0 37 2593.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.70550245414621 20.821493154223713 13.949883750968741 25.52312064066133 2 29.305135951661633 26.208459214501513 26.73716012084592 17.749244712990937 3 21.654439666076396 27.92815583101442 29.041234505438908 21.376169997470278 4 23.76590330788804 33.12977099236642 22.544529262086513 20.559796437659035 5 25.818833162743093 35.5424769703173 22.185261003070625 16.45342886386899 6 22.823051535922822 37.01447067783701 22.366082762122367 17.796395024117796 7 21.72808132147395 22.43964421855146 37.30622617534943 18.52604828462516 8 23.598071555442782 24.435422481603656 27.099720883024613 24.866785079928952 9 23.593512417638117 25.063355296502788 28.05372529143436 23.289406994424734 10-14 24.84879288437103 28.78780177890724 25.67217280813215 20.69123252858958 15-19 23.674532638676066 28.031463888037596 26.88221473082031 21.411788742466033 20-24 23.766405534642384 28.14121477261166 26.701597314070607 21.39078237867535 25-29 24.240271929379535 28.085840393688805 26.34062198772259 21.33326568920907 30-34 23.953948369427398 28.122939595273117 26.895572348734593 21.027539686564893 35-39 23.9049702396093 27.90354581065269 26.529989316782824 21.66149463295518 40-44 24.201543257192498 27.2522867801114 26.99167049925903 21.554499463437068 45-49 24.576314576826583 27.929957503456045 26.45025856330961 21.043469356407762 50-54 23.832749072803942 28.212162780064016 26.44922013920642 21.50586800792562 55-59 24.156161041073606 27.63318422122814 27.409516063440424 20.801138674257828 60-64 24.270955264898976 28.291516107689958 27.660440734897453 19.777087892513613 65-69 24.494667343829356 28.12087353986795 26.942610462163536 20.441848654139157 70-74 24.71380812481005 27.22621821497315 27.256610272515445 20.80336338770135 75-79 24.253769098451887 27.972275624810276 27.28928463017302 20.48467064656481 80-84 24.79703673635072 27.506596306068605 27.283336716054396 20.413030241526283 85-89 24.715238583889175 27.629553617239612 27.352488455618268 20.30271934325295 90-94 24.102670040799463 27.650673965811084 27.645509476837265 20.601146516552188 95-99 24.376238630011688 27.298135067838814 27.587783932110373 20.73784237003913 100-104 24.73630831643002 27.170385395537526 27.368154158215006 20.725152129817445 105-109 24.954296160877515 27.32581759089986 27.310582977859028 20.409303270363598 110-114 24.973270200091648 28.206303141387913 26.745074079731175 20.075352578789268 115-119 25.33313066828799 27.896843491918734 27.101383188934484 19.668642650858793 120-124 25.011371102238844 27.91731945216556 27.0733309748825 19.997978470713093 125-129 25.79310344827586 27.908045977011493 26.804597701149426 19.494252873563216 130-134 26.273317962691262 27.77719555648711 26.750157199748482 19.199329281073148 135-139 25.330266887736002 27.827993795796118 26.715515858159062 20.12622345830882 140-144 26.344902386117138 27.3590021691974 26.75704989154013 19.539045553145336 145-149 26.525587973390603 28.123199413336124 25.986066733015555 19.365145880257714 150-151 26.549692622950822 28.048155737704917 25.986168032786882 19.415983606557376 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 40.0 1 24.0 2 4.5 3 1.5 4 1.0 5 0.0 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 1.0 12 1.0 13 1.5 14 1.5 15 1.5 16 1.0 17 0.0 18 0.5 19 0.5 20 2.0 21 2.0 22 0.5 23 0.5 24 1.0 25 1.5 26 2.5 27 4.0 28 3.0 29 3.5 30 5.5 31 7.0 32 13.5 33 22.5 34 28.5 35 35.0 36 57.5 37 83.0 38 107.0 39 149.0 40 190.5 41 207.5 42 234.5 43 260.0 44 280.0 45 294.0 46 281.5 47 267.5 48 230.0 49 205.5 50 184.0 51 151.0 52 142.5 53 122.5 54 89.5 55 68.0 56 55.0 57 36.5 58 23.0 59 18.5 60 14.5 61 14.5 62 12.5 63 8.5 64 6.0 65 3.5 66 1.0 67 1.0 68 1.0 69 0.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 3.225 2 0.7000000000000001 3 1.175 4 1.7500000000000002 5 2.3 6 1.525 7 1.625 8 1.4749999999999999 9 1.35 10-14 1.625 15-19 2.11 20-24 1.71 25-29 1.4449999999999998 30-34 1.415 35-39 1.7149999999999999 40-44 2.155 45-49 2.3449999999999998 50-54 1.585 55-59 1.6400000000000001 60-64 1.755 65-69 1.55 70-74 1.29 75-79 1.17 80-84 1.46 85-89 2.55 90-94 3.1850000000000005 95-99 1.6049999999999998 100-104 1.4000000000000001 105-109 1.54 110-114 1.7950000000000002 115-119 1.315 120-124 1.065 125-129 2.125 130-134 4.58 135-139 6.515 140-144 7.8 145-149 4.545 150-151 2.4 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31262729124236 97.52499999999999 2 0.5091649694501018 1.0 3 0.05091649694501018 0.15 4 0.02545824847250509 0.1 5 0.0 0.0 6 0.02545824847250509 0.15 7 0.02545824847250509 0.17500000000000002 8 0.02545824847250509 0.2 9 0.0 0.0 >10 0.02545824847250509 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 28 0.7000000000000001 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.4 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.3 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.6375000000000002 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.375 0.0 0.0 0.0 0.0 102-103 2.6875 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.6375 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.7 0.0 0.0 0.0 0.0 112-113 5.2375 0.0 0.0 0.0 0.0 114-115 5.75 0.0 0.0 0.0 0.0 116-117 6.0625 0.0 0.0 0.0 0.0 118-119 6.762499999999999 0.0 0.0 0.0 0.0 120-121 7.199999999999999 0.0 0.0 0.0 0.0 122-123 7.8625 0.0 0.0 0.0 0.0 124-125 8.625 0.0 0.0 0.0 0.0 126-127 9.225 0.0 0.0 0.0 0.0 128-129 9.8125 0.0 0.0 0.0 0.0 130-131 10.4375 0.0 0.0 0.0 0.0 132-133 11.175 0.0 0.0 0.0 0.0 134-135 11.95 0.0 0.0 0.0 0.0 136-137 12.5375 0.0 0.0 0.0 0.0 138-139 13.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755656 spots for SRR7169960.sra Written 755656 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra Read 755640 spots for SRR7169960.sra Written 755640 spots for SRR7169960.sra SRR ids: ['SRR7169960.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x83q2_v9 SRR7169960.sra spots: 15112816 blocks: [[1, 755640], [755641, 1511280], [1511281, 2266920], [2266921, 3022560], [3022561, 3778200], [3778201, 4533840], [4533841, 5289480], [5289481, 6045120], [6045121, 6800760], [6800761, 7556400], [7556401, 8312040], [8312041, 9067680], [9067681, 9823320], [9823321, 10578960], [10578961, 11334600], [11334601, 12090240], [12090241, 12845880], [12845881, 13601520], [13601521, 14357160], [14357161, 15112816]] SRR7169960 file size 5099537 SRR7169960 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169960 SRR7169960_1.fastq SRR7169960_2.fastq Input file: SRR7169960_1.fastq Paired file: SRR7169960_2.fastq trimmed: SRR7169960-trimmed-pair1.fastq, SRR7169960-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:52:37 2025 >> started Wed Feb 12 05:52:53 2025 >> done (16.283s) 15112816 read pairs processed; of these: 20185 ( 0.13%) short read pairs filtered out after trimming by size control 43638 ( 0.29%) empty read pairs filtered out after trimming by size control 15048993 (99.58%) read pairs available; of these: 7808143 (51.88%) trimmed read pairs available after processing 7240850 (48.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 9 0.00% 21 7 0.00% 22 7 0.00% 23 5 0.00% 24 7 0.00% 25 10 0.00% 26 14 0.00% 27 8 0.00% 28 17 0.00% 29 13 0.00% 30 10 0.00% 31 16 0.00% 32 22 0.00% 33 14 0.00% 34 23 0.00% 35 16 0.00% 36 19 0.00% 37 29 0.00% 38 36 0.00% 39 37 0.00% 40 51 0.00% 41 71 0.00% 42 63 0.00% 43 70 0.00% 44 73 0.00% 45 74 0.00% 46 100 0.00% 47 106 0.00% 48 139 0.00% 49 146 0.00% 50 181 0.00% 51 201 0.00% 52 245 0.00% 53 251 0.00% 54 279 0.00% 55 304 0.00% 56 322 0.00% 57 381 0.00% 58 438 0.00% 59 484 0.00% 60 543 0.00% 61 661 0.00% 62 759 0.01% 63 941 0.01% 64 1018 0.01% 65 1129 0.01% 66 1265 0.01% 67 1526 0.01% 68 1705 0.01% 69 2180 0.01% 70 3078 0.02% 71 3255 0.02% 72 3282 0.02% 73 3446 0.02% 74 3558 0.02% 75 4000 0.03% 76 4381 0.03% 77 4508 0.03% 78 5087 0.03% 79 5674 0.04% 80 6242 0.04% 81 7279 0.05% 82 8054 0.05% 83 8963 0.06% 84 11073 0.07% 85 12498 0.08% 86 13084 0.09% 87 14195 0.09% 88 15608 0.10% 89 15520 0.10% 90 16818 0.11% 91 17956 0.12% 92 19075 0.13% 93 21283 0.14% 94 22215 0.15% 95 24371 0.16% 96 25678 0.17% 97 26640 0.18% 98 27558 0.18% 99 28045 0.19% 100 29884 0.20% 101 30591 0.20% 102 32396 0.22% 103 34058 0.23% 104 35740 0.24% 105 37913 0.25% 106 39683 0.26% 107 40552 0.27% 108 41704 0.28% 109 42775 0.28% 110 43373 0.29% 111 44555 0.30% 112 45982 0.31% 113 48201 0.32% 114 49969 0.33% 115 52478 0.35% 116 53422 0.35% 117 55023 0.37% 118 55904 0.37% 119 55863 0.37% 120 57297 0.38% 121 58800 0.39% 122 59309 0.39% 123 61270 0.41% 124 63561 0.42% 125 64953 0.43% 126 67863 0.45% 127 69159 0.46% 128 70662 0.47% 129 72512 0.48% 130 73750 0.49% 131 74520 0.50% 132 76642 0.51% 133 78835 0.52% 134 81453 0.54% 135 84812 0.56% 136 87582 0.58% 137 91576 0.61% 138 96968 0.64% 139 101647 0.68% 140 105657 0.70% 141 111072 0.74% 142 117548 0.78% 143 124753 0.83% 144 135289 0.90% 145 150271 1.00% 146 172662 1.15% 147 215081 1.43% 148 299223 1.99% 149 552477 3.67% 150 3062414 20.35% 151 7240850 48.12% 15048993 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=41 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=98.01 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=18.8 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=41 prefix-density=0.26 prefix-fanout=2.3 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=46.99 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=12.2 sequence=TGTTGGTGGTGG SRR7169960 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:53:39 Started mapping on | Feb 12 05:53:39 Finished on | Feb 12 05:55:39 Mapping speed, Million of reads per hour | 451.47 Number of input reads | 15048993 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14039273 Uniquely mapped reads % | 93.29% Average mapped length | 288.11 Number of splices: Total | 12390756 Number of splices: Annotated (sjdb) | 12170350 Number of splices: GT/AG | 12209191 Number of splices: GC/AG | 143763 Number of splices: AT/AC | 10927 Number of splices: Non-canonical | 26875 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 253422 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 43652 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 772410 772410 772410 N_multimapping 253422 253422 253422 N_noFeature 273312 13847958 355995 N_ambiguous 164479 1023 55175 UnstrandedReadsAssigned:13601482 PositiveStrandReadsAssigned:190292 NegativeStrandReadsAssigned:13628103 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7169960 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169960-trimmed-pair1.fastq SRR7169960-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,048,993 reads, 13,599,578 reads pseudoaligned [quant] estimated average fragment length: 206.061 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7169960.ke.tsv 34699 SRR7169960.se.tsv 87100 total ==> SRR7169960.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1812.94 231 8.51258 Potri.005G024800.1.v4.1 1035 829.939 30 2.41495 Potri.004G059700.1.v4.1 961 755.939 4 0.353513 Potri.007G009000.2.v4.1 1416 1210.94 0 0 Potri.003G141000.2.v4.1 2943 2737.94 191 4.6606 Potri.016G087400.1.v4.1 270 96.4948 1256 869.597 Potri.015G069301.1.v4.1 564 360.816 0 0 Potri.010G195200.1.v4.1 1773 1567.94 16 0.681747 Potri.012G127500.1.v4.1 977 771.939 5214 451.253 ==> SRR7169960.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1053 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 314 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169960 completed mapping pipeline successfully