Starting /dee2/code/volunteer_pipeline.sh SRR7169961 current disk space = 3048991891456 free memory = 960975124 SRR7169961 SRAfilesize ea79d1c756a3be9e95529433f1937be4 SRR7169961.sra SRR7169961.sra file validated SRR7169961 is paired end SRR7169961 is conventional basespace SRR7169961 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169961_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21225 34.0 34.0 34.0 33.0 34.0 2 33.59225 34.0 34.0 34.0 33.0 34.0 3 33.59525 34.0 34.0 34.0 33.0 34.0 4 33.64575 34.0 34.0 34.0 33.0 34.0 5 33.62 34.0 34.0 34.0 33.0 34.0 6 37.48675 38.0 38.0 38.0 37.0 38.0 7 37.64075 38.0 38.0 38.0 38.0 38.0 8 37.72425 38.0 38.0 38.0 38.0 38.0 9 37.718 38.0 38.0 38.0 38.0 38.0 10-14 37.7162 38.0 38.0 38.0 38.0 38.0 15-19 37.71485 38.0 38.0 38.0 38.0 38.0 20-24 37.6921 38.0 38.0 38.0 38.0 38.0 25-29 37.67155 38.0 38.0 38.0 38.0 38.0 30-34 37.674499999999995 38.0 38.0 38.0 38.0 38.0 35-39 37.59785 38.0 38.0 38.0 38.0 38.0 40-44 37.4704 38.0 38.0 38.0 37.8 38.0 45-49 37.36555 38.0 38.0 38.0 37.2 38.0 50-54 37.392450000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.3377 38.0 38.0 38.0 37.0 38.0 60-64 37.305949999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.22785 38.0 38.0 38.0 36.8 38.0 70-74 37.17195 38.0 38.0 38.0 36.8 38.0 75-79 37.10210000000001 38.0 38.0 38.0 36.2 38.0 80-84 37.02575 38.0 38.0 38.0 36.0 38.0 85-89 36.883 38.0 38.0 38.0 36.0 38.0 90-94 36.75335 38.0 38.0 38.0 35.6 38.0 95-99 36.5796 38.0 38.0 38.0 35.0 38.0 100-104 36.596199999999996 38.0 38.0 38.0 34.8 38.0 105-109 36.5529 38.0 38.0 38.0 34.2 38.0 110-114 36.53 38.0 38.0 38.0 34.2 38.0 115-119 36.28489999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.138400000000004 38.0 38.0 38.0 33.6 38.0 125-129 35.83305 38.0 37.0 38.0 32.2 38.0 130-134 35.50595 38.0 36.4 38.0 30.8 38.0 135-139 35.02555 38.0 35.8 38.0 29.2 38.0 140-144 35.009 38.0 36.0 38.0 29.4 38.0 145-149 34.289699999999996 38.0 35.2 38.0 26.0 38.0 150-151 30.5745 36.5 29.5 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 4.0 14 0.0 15 3.0 16 0.0 17 2.0 18 3.0 19 2.0 20 3.0 21 4.0 22 4.0 23 6.0 24 8.0 25 8.0 26 11.0 27 16.0 28 16.0 29 25.0 30 37.0 31 45.0 32 51.0 33 69.0 34 108.0 35 237.0 36 536.0 37 2798.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.910357052418334 12.003038743985819 8.584451759939226 33.50215244365663 2 22.325 14.95 34.575 28.15 3 20.150000000000002 19.275000000000002 26.325 34.25 4 22.475 27.250000000000004 22.775000000000002 27.500000000000004 5 22.225 32.25 24.525 21.0 6 19.725 35.199999999999996 25.05 20.025000000000002 7 14.825 26.625 39.900000000000006 18.65 8 18.175 26.275 31.05 24.5 9 17.525 23.599999999999998 34.075 24.8 10-14 19.785 30.115 26.55 23.549999999999997 15-19 20.080000000000002 29.12 26.935 23.865 20-24 19.86 29.225 27.310000000000002 23.605 25-29 20.185 29.160000000000004 26.825 23.830000000000002 30-34 20.810000000000002 28.475 26.875 23.84 35-39 20.18 28.645 26.955000000000002 24.22 40-44 20.041012303691108 28.95368610583175 27.293187956386916 23.712113634090226 45-49 20.019041892162758 28.52275005011024 27.275005011024255 24.183203046702744 50-54 20.236011800590028 28.86144307215361 27.081354067703383 23.821191059552977 55-59 20.18 28.794999999999998 27.08 23.945 60-64 20.080000000000002 29.005 27.235 23.68 65-69 19.935 28.715000000000003 27.455000000000002 23.895 70-74 20.41 28.03 27.339999999999996 24.22 75-79 20.549999999999997 28.02 26.75 24.68 80-84 20.369999999999997 28.215 27.485 23.93 85-89 20.825609939381795 28.320224437653422 27.498622313511344 23.355543309453434 90-94 20.498517513442888 27.996381727725012 27.031509121061358 24.473591637770742 95-99 20.259531234282267 28.43275324414043 27.255809274720853 24.051906246856454 100-104 20.807251239421102 28.744554058791127 26.84160448695478 23.60659021483299 105-109 21.19 28.52 26.665 23.625 110-114 21.45967863042499 27.711868648946286 26.855884266906944 23.97256845372178 115-119 20.996049802490123 28.766438321916095 26.366318315915795 23.871193559677984 120-124 20.955 28.29 27.04 23.715 125-129 21.39 28.1 26.55 23.96 130-134 21.03602023946696 28.074745754220732 26.356394970191875 24.532839036120436 135-139 20.946115602872496 27.75071561291619 26.69612815748506 24.60704062672626 140-144 20.726817042606516 28.220551378446114 26.45112781954887 24.601503759398497 145-149 20.717969258498975 28.082911931106995 26.691032894407453 24.508085915986584 150-151 20.200000000000003 27.8625 26.700000000000003 25.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 1.5 25 2.5 26 5.5 27 7.0 28 9.0 29 10.0 30 15.5 31 23.5 32 27.5 33 40.5 34 58.0 35 68.5 36 78.5 37 97.0 38 122.5 39 149.0 40 190.0 41 214.0 42 228.0 43 256.5 44 262.5 45 252.5 46 252.5 47 247.0 48 233.5 49 218.0 50 185.0 51 150.0 52 130.5 53 112.0 54 85.0 55 63.5 56 51.0 57 46.0 58 33.0 59 20.0 60 13.5 61 8.5 62 7.5 63 5.5 64 3.0 65 1.5 66 1.5 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.03 45-49 0.22 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.19499999999999998 90-94 0.505 95-99 0.59 100-104 0.155 105-109 0.0 110-114 0.11499999999999999 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.19499999999999998 135-139 0.43499999999999994 140-144 0.25 145-149 0.135 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.3875000000000002 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.9875 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 3.2874999999999996 0.0 0.0 0.0 0.0 110-111 3.725 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.6375 0.0 0.0 0.0 0.0 116-117 5.112500000000001 0.0 0.0 0.0 0.0 118-119 5.6 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.675 0.0 0.0 0.0 0.0 124-125 7.225 0.0 0.0 0.0 0.0 126-127 7.675000000000001 0.0 0.0 0.0 0.0 128-129 8.225000000000001 0.0 0.0 0.0 0.0 130-131 8.9375 0.0 0.0 0.0 0.0 132-133 9.4875 0.0 0.0 0.0 0.0 134-135 10.0875 0.0 0.0 0.0 0.0 136-137 10.6875 0.0 0.0 0.0 0.0 138-139 11.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169961 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169961_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.387 33.0 33.0 34.0 32.0 34.0 2 32.44025 34.0 33.0 34.0 32.0 34.0 3 32.472 34.0 33.0 34.0 32.0 34.0 4 32.25175 34.0 33.0 34.0 32.0 34.0 5 32.2645 34.0 33.0 34.0 32.0 34.0 6 36.50225 38.0 38.0 38.0 36.0 38.0 7 36.49375 38.0 38.0 38.0 37.0 38.0 8 36.56475 38.0 38.0 38.0 37.0 38.0 9 36.5175 38.0 38.0 38.0 37.0 38.0 10-14 36.4447 38.0 38.0 38.0 36.8 38.0 15-19 36.227700000000006 38.0 38.0 38.0 36.6 38.0 20-24 36.3889 38.0 38.0 38.0 37.0 38.0 25-29 36.4273 38.0 38.0 38.0 37.0 38.0 30-34 36.432399999999994 38.0 38.0 38.0 37.0 38.0 35-39 36.3569 38.0 38.0 38.0 37.0 38.0 40-44 36.19865 38.0 38.0 38.0 36.6 38.0 45-49 36.10755 38.0 38.0 38.0 36.0 38.0 50-54 36.31595 38.0 38.0 38.0 36.6 38.0 55-59 36.266650000000006 38.0 38.0 38.0 36.2 38.0 60-64 36.3036 38.0 38.0 38.0 36.8 38.0 65-69 36.1967 38.0 38.0 38.0 36.0 38.0 70-74 36.17335 38.0 38.0 38.0 36.0 38.0 75-79 36.123000000000005 38.0 38.0 38.0 35.6 38.0 80-84 35.99325 38.0 38.0 38.0 35.2 38.0 85-89 35.60385 38.0 38.0 38.0 34.2 38.0 90-94 35.342 38.0 38.0 38.0 33.0 38.0 95-99 35.66759999999999 38.0 38.0 38.0 34.0 38.0 100-104 35.63215 38.0 38.0 38.0 33.8 38.0 105-109 35.56635 38.0 38.0 38.0 34.0 38.0 110-114 35.397 38.0 38.0 38.0 32.6 38.0 115-119 35.21575 38.0 38.0 38.0 31.0 38.0 120-124 34.9431 38.0 37.4 38.0 29.2 38.0 125-129 34.48095 38.0 36.6 38.0 25.6 38.0 130-134 33.52289999999999 38.0 35.8 38.0 14.2 38.0 135-139 32.665549999999996 38.0 34.8 38.0 6.4 38.0 140-144 31.75505 38.0 33.0 38.0 2.0 38.0 145-149 31.2635 38.0 33.2 38.0 2.0 38.0 150-151 26.936 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 95.0 3 9.0 4 4.0 5 2.0 6 0.0 7 1.0 8 1.0 9 3.0 10 2.0 11 1.0 12 2.0 13 8.0 14 7.0 15 4.0 16 3.0 17 4.0 18 2.0 19 11.0 20 11.0 21 7.0 22 5.0 23 6.0 24 13.0 25 15.0 26 19.0 27 29.0 28 23.0 29 39.0 30 46.0 31 69.0 32 86.0 33 109.0 34 126.0 35 167.0 36 386.0 37 2685.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.743353783231086 22.62269938650307 11.221881390593047 24.4120654396728 2 26.21827411167513 28.45177664974619 28.984771573604064 16.34517766497462 3 21.166581762608253 28.45134997452878 31.202241467142127 19.179826795720835 4 23.3659289758106 33.0416881111683 23.93206381883685 19.66031909418425 5 24.517125933556528 36.183363378830805 21.42673190831831 17.87277877929436 6 21.028396009209516 36.710156050140704 23.84241493988232 18.41903300076746 7 20.874904067536455 22.793553338449733 36.3008442056792 20.03069838833461 8 23.13986192789568 25.03196113525952 27.6144208642291 24.2137560726157 9 21.974929649526732 25.172678434382195 30.442568431823997 22.409823484267076 10-14 24.4243884928978 28.516486334034152 26.019178503666478 21.03994666940157 15-19 23.537906137184113 28.38576585869005 27.060340381640017 21.015987622485817 20-24 23.9770279971285 27.90483027381807 27.06901856219875 21.04912316685468 25-29 23.838073276966437 27.89648987957981 27.624903920061488 20.640532923392264 30-34 23.154603239696534 27.73733852778347 27.393889686282552 21.714168546237442 35-39 23.7219339259107 27.70898628166264 27.868262857730052 20.700816934696604 40-44 23.986591026302218 27.792676637441982 27.483238782877773 20.73749355337803 45-49 23.689911285331135 27.599546110996492 27.991541159480093 20.719001444192283 50-54 23.27678983241941 27.940347460667248 27.66873366473633 21.11412904217701 55-59 23.453119393038396 27.246629415081763 28.10273235248885 21.197518839390987 60-64 23.54056685972016 27.850955871047102 28.107221567321 20.50125570191174 65-69 24.291415123298883 26.967154404993348 27.949452573416554 20.79197789829121 70-74 23.815346988688475 27.305615000509526 27.911953531030264 20.96708447977173 75-79 23.828702523578894 27.03033392811624 28.564873821055315 20.576089727249556 80-84 24.053030303030305 27.098689598689596 28.634316134316133 20.213963963963963 85-89 24.490536686543944 26.86543946072077 27.907700285195748 20.73632356753954 90-94 23.88230997965465 28.07658198132401 27.59664040899369 20.44446763002765 95-99 24.571487221594992 27.660884737760444 27.465872934414453 20.30175510623011 100-104 24.703355155482814 27.388502454991816 27.71583469721768 20.192307692307693 105-109 24.443530560838944 27.35310748984732 27.64612142086054 20.557240528453192 110-114 24.931859089740293 27.287220365132427 27.64206736950373 20.138853175623552 115-119 24.721056402907156 27.807349779916063 27.32111782168083 20.150475995495956 120-124 25.620003055456536 27.351428425930642 26.43988389265163 20.588684625961196 125-129 25.42967741935484 27.556129032258063 27.003870967741932 20.010322580645163 130-134 25.511285366112112 28.049168167849952 26.957719614284198 19.481826851753738 135-139 25.108225108225106 27.39177489177489 27.110389610389614 20.38961038961039 140-144 25.692998794784707 27.988386107154597 26.74482305248165 19.57379204557905 145-149 25.929062996294334 27.707781895182638 26.76019057702488 19.602964531498145 150-151 26.147678779257728 27.958101642312165 26.26406310616837 19.630156472261735 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 63.0 1 37.0 2 6.5 3 2.5 4 2.0 5 1.0 6 1.5 7 2.0 8 3.0 9 3.0 10 1.0 11 0.5 12 1.0 13 1.0 14 1.5 15 1.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.0 26 1.5 27 3.5 28 4.0 29 6.0 30 9.0 31 11.5 32 14.5 33 22.5 34 32.0 35 38.5 36 54.0 37 88.5 38 127.5 39 167.0 40 191.0 41 216.0 42 248.0 43 271.0 44 303.0 45 299.5 46 284.5 47 281.5 48 249.0 49 199.5 50 161.0 51 134.5 52 121.0 53 94.5 54 66.0 55 51.5 56 34.0 57 26.0 58 24.0 59 18.5 60 9.0 61 5.5 62 7.5 63 8.0 64 5.0 65 2.0 66 0.5 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.1999999999999997 2 1.5 3 1.8499999999999999 4 2.85 5 2.9250000000000003 6 2.275 7 2.275 8 2.225 9 2.275 10-14 2.495 15-19 3.05 20-24 2.4899999999999998 25-29 2.4250000000000003 30-34 2.46 35-39 2.685 40-44 3.05 45-49 3.06 50-54 2.435 55-59 2.465 60-64 2.445 65-69 2.27 70-74 1.87 75-79 1.925 80-84 2.32 85-89 3.5749999999999997 90-94 4.154999999999999 95-99 2.5700000000000003 100-104 2.2399999999999998 105-109 2.735 110-114 2.775 115-119 2.31 120-124 1.815 125-129 3.125 130-134 5.63 135-139 7.6 140-144 8.73 145-149 5.55 150-151 3.3375000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.51493489915751 97.45 2 0.3829461322440643 0.75 3 0.051059484299208584 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025529742149604292 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025529742149604292 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60 1.5 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.8999999999999999 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.5875 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.6500000000000004 0.0 0.0 0.0 0.0 108-109 3.15 0.0 0.0 0.0 0.0 110-111 3.5250000000000004 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.3875 0.0 0.0 0.0 0.0 116-117 4.887499999999999 0.0 0.0 0.0 0.0 118-119 5.4125 0.0 0.0 0.0 0.0 120-121 5.775 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 6.9625 0.0 0.0 0.0 0.0 126-127 7.375 0.0 0.0 0.0 0.0 128-129 7.9625 0.0 0.0 0.0 0.0 130-131 8.6375 0.0 0.0 0.0 0.0 132-133 9.162500000000001 0.0 0.0 0.0 0.0 134-135 9.774999999999999 0.0 0.0 0.0 0.0 136-137 10.35 0.0 0.0 0.0 0.0 138-139 11.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATGGG 10 0.007103748 143.1125 4 >>END_MODULE Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681743 spots for SRR7169961.sra Written 681743 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra Read 681726 spots for SRR7169961.sra Written 681726 spots for SRR7169961.sra SRR ids: ['SRR7169961.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ieszfivg SRR7169961.sra spots: 13634537 blocks: [[1, 681726], [681727, 1363452], [1363453, 2045178], [2045179, 2726904], [2726905, 3408630], [3408631, 4090356], [4090357, 4772082], [4772083, 5453808], [5453809, 6135534], [6135535, 6817260], [6817261, 7498986], [7498987, 8180712], [8180713, 8862438], [8862439, 9544164], [9544165, 10225890], [10225891, 10907616], [10907617, 11589342], [11589343, 12271068], [12271069, 12952794], [12952795, 13634537]] SRR7169961 file size 4598596 SRR7169961 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169961 SRR7169961_1.fastq SRR7169961_2.fastq Input file: SRR7169961_1.fastq Paired file: SRR7169961_2.fastq trimmed: SRR7169961-trimmed-pair1.fastq, SRR7169961-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:15:57 2025 >> started Wed Feb 12 05:16:12 2025 >> done (14.777s) 13634537 read pairs processed; of these: 21650 ( 0.16%) short read pairs filtered out after trimming by size control 37962 ( 0.28%) empty read pairs filtered out after trimming by size control 13574925 (99.56%) read pairs available; of these: 6888507 (50.74%) trimmed read pairs available after processing 6686418 (49.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 12 0.00% 21 8 0.00% 22 11 0.00% 23 5 0.00% 24 6 0.00% 25 4 0.00% 26 11 0.00% 27 10 0.00% 28 20 0.00% 29 10 0.00% 30 19 0.00% 31 12 0.00% 32 10 0.00% 33 21 0.00% 34 19 0.00% 35 16 0.00% 36 16 0.00% 37 26 0.00% 38 30 0.00% 39 27 0.00% 40 55 0.00% 41 40 0.00% 42 39 0.00% 43 46 0.00% 44 58 0.00% 45 59 0.00% 46 67 0.00% 47 79 0.00% 48 86 0.00% 49 96 0.00% 50 144 0.00% 51 147 0.00% 52 160 0.00% 53 168 0.00% 54 179 0.00% 55 194 0.00% 56 290 0.00% 57 234 0.00% 58 301 0.00% 59 367 0.00% 60 439 0.00% 61 484 0.00% 62 572 0.00% 63 656 0.00% 64 715 0.01% 65 800 0.01% 66 867 0.01% 67 1027 0.01% 68 1306 0.01% 69 1575 0.01% 70 1883 0.01% 71 1806 0.01% 72 2026 0.01% 73 2236 0.02% 74 2591 0.02% 75 2730 0.02% 76 3050 0.02% 77 3213 0.02% 78 3453 0.03% 79 3869 0.03% 80 4468 0.03% 81 5101 0.04% 82 5818 0.04% 83 6828 0.05% 84 8322 0.06% 85 9316 0.07% 86 9750 0.07% 87 10249 0.08% 88 10892 0.08% 89 11476 0.08% 90 12604 0.09% 91 13718 0.10% 92 14768 0.11% 93 16269 0.12% 94 17437 0.13% 95 18423 0.14% 96 19191 0.14% 97 20289 0.15% 98 20283 0.15% 99 21282 0.16% 100 22435 0.17% 101 23378 0.17% 102 25486 0.19% 103 27247 0.20% 104 28294 0.21% 105 30117 0.22% 106 31114 0.23% 107 31119 0.23% 108 32241 0.24% 109 32657 0.24% 110 33193 0.24% 111 34784 0.26% 112 36829 0.27% 113 38390 0.28% 114 40472 0.30% 115 42310 0.31% 116 43082 0.32% 117 43869 0.32% 118 44328 0.33% 119 44663 0.33% 120 45617 0.34% 121 46578 0.34% 122 47808 0.35% 123 50757 0.37% 124 52693 0.39% 125 54179 0.40% 126 55785 0.41% 127 57112 0.42% 128 57967 0.43% 129 59445 0.44% 130 60447 0.45% 131 61494 0.45% 132 64083 0.47% 133 66990 0.49% 134 69452 0.51% 135 72482 0.53% 136 75899 0.56% 137 79045 0.58% 138 83014 0.61% 139 87286 0.64% 140 90266 0.66% 141 96510 0.71% 142 103282 0.76% 143 110521 0.81% 144 122244 0.90% 145 137735 1.01% 146 161125 1.19% 147 199097 1.47% 148 282784 2.08% 149 521756 3.84% 150 2834154 20.88% 151 6686418 49.26% 13574925 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=43 prefix-density=0.21 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGT criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=111.98 fanout-score-rank=1 prefix-density=0.74 prefix-fanout=18.1 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=5.27 fanout-score-rank=22 prefix-density=0.29 prefix-fanout=3.8 sequence=CAGTTTGTTGACTGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=10 fanout-score=54.84 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.8 sequence=TGTTGGTGGTGG SRR7169961 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:17:03 Started mapping on | Feb 12 05:17:03 Finished on | Feb 12 05:18:42 Mapping speed, Million of reads per hour | 493.63 Number of input reads | 13574925 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 12701228 Uniquely mapped reads % | 93.56% Average mapped length | 288.53 Number of splices: Total | 11469050 Number of splices: Annotated (sjdb) | 11247325 Number of splices: GT/AG | 11290727 Number of splices: GC/AG | 131612 Number of splices: AT/AC | 9997 Number of splices: Non-canonical | 36714 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.05% Deletion average length | 2.87 Insertion rate per base | 0.04% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 330336 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 29172 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.73% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 561364 561364 561364 N_multimapping 330336 330336 330336 N_noFeature 247548 12547262 314685 N_ambiguous 140026 622 52857 UnstrandedReadsAssigned:12313654 PositiveStrandReadsAssigned:153344 NegativeStrandReadsAssigned:12333686 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7169961 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169961-trimmed-pair1.fastq SRR7169961-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,574,925 reads, 12,040,667 reads pseudoaligned [quant] estimated average fragment length: 214.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7169961.ke.tsv 34699 SRR7169961.se.tsv 87100 total ==> SRR7169961.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.67 176 7.98825 Potri.005G024800.1.v4.1 1035 821.673 48 4.78497 Potri.004G059700.1.v4.1 961 747.683 14 1.53373 Potri.007G009000.2.v4.1 1416 1202.67 0 0 Potri.003G141000.2.v4.1 2943 2729.67 340.112 10.2058 Potri.016G087400.1.v4.1 270 94.7112 1367.44 1182.62 Potri.015G069301.1.v4.1 564 354.93 0 0 Potri.010G195200.1.v4.1 1773 1559.67 9 0.472657 Potri.012G127500.1.v4.1 977 763.678 6018 645.475 ==> SRR7169961.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1109 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 100 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169961 completed mapping pipeline successfully