Starting /dee2/code/volunteer_pipeline.sh SRR7169962 current disk space = 3049903587328 free memory = 1354349732 SRR7169962 SRAfilesize dbf9d64acbe1057fcb9a2d5efa1b63c0 SRR7169962.sra SRR7169962.sra file validated SRR7169962 is paired end SRR7169962 is conventional basespace SRR7169962 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169962_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04875 34.0 34.0 34.0 33.0 34.0 2 33.4925 34.0 34.0 34.0 33.0 34.0 3 33.5575 34.0 34.0 34.0 33.0 34.0 4 33.5565 34.0 34.0 34.0 33.0 34.0 5 33.58475 34.0 34.0 34.0 33.0 34.0 6 37.4805 38.0 38.0 38.0 37.0 38.0 7 37.599 38.0 38.0 38.0 38.0 38.0 8 37.68675 38.0 38.0 38.0 38.0 38.0 9 37.692 38.0 38.0 38.0 38.0 38.0 10-14 37.65675 38.0 38.0 38.0 38.0 38.0 15-19 37.63905 38.0 38.0 38.0 38.0 38.0 20-24 37.60265 38.0 38.0 38.0 38.0 38.0 25-29 37.621249999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.59675000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.4981 38.0 38.0 38.0 37.8 38.0 40-44 37.3688 38.0 38.0 38.0 37.0 38.0 45-49 37.25095 38.0 38.0 38.0 37.0 38.0 50-54 37.29715 38.0 38.0 38.0 37.0 38.0 55-59 37.24835 38.0 38.0 38.0 37.0 38.0 60-64 37.22375 38.0 38.0 38.0 36.4 38.0 65-69 37.176550000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.147499999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.00345 38.0 38.0 38.0 36.0 38.0 80-84 36.9581 38.0 38.0 38.0 35.8 38.0 85-89 36.799549999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.637550000000005 38.0 38.0 38.0 34.8 38.0 95-99 36.411950000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.527699999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.455850000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.3812 38.0 38.0 38.0 34.0 38.0 115-119 36.106399999999994 38.0 37.4 38.0 33.4 38.0 120-124 35.820100000000004 38.0 37.0 38.0 32.0 38.0 125-129 35.5176 38.0 36.4 38.0 31.0 38.0 130-134 35.12815 38.0 36.0 38.0 29.2 38.0 135-139 34.641549999999995 38.0 35.2 38.0 26.6 38.0 140-144 34.5751 38.0 35.0 38.0 27.4 38.0 145-149 33.995349999999995 38.0 35.0 38.0 24.2 38.0 150-151 30.29625 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 2.0 14 1.0 15 1.0 16 0.0 17 2.0 18 2.0 19 2.0 20 5.0 21 2.0 22 13.0 23 6.0 24 7.0 25 9.0 26 16.0 27 19.0 28 26.0 29 32.0 30 34.0 31 58.0 32 59.0 33 91.0 34 129.0 35 258.0 36 586.0 37 2638.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.421319796954315 12.258883248730964 10.101522842639595 36.21827411167512 2 21.75 15.575 33.725 28.95 3 19.925 20.724999999999998 26.75 32.6 4 22.8 28.425 22.725 26.05 5 23.474999999999998 32.5 23.625 20.4 6 19.725 35.099999999999994 24.275 20.9 7 14.924999999999999 26.400000000000002 40.25 18.425 8 18.0 25.7 30.3 26.0 9 17.25 25.4 33.4 23.95 10-14 19.695 29.244999999999997 27.215 23.845 15-19 19.67 28.310000000000002 27.855 24.165 20-24 19.55 28.705000000000002 27.62 24.125 25-29 20.135 29.044999999999998 27.01 23.810000000000002 30-34 20.05 28.765 27.22 23.965 35-39 20.16 28.08 26.919999999999998 24.84 40-44 19.61892378475695 28.675735147029407 27.28045609121824 24.424884976995397 45-49 20.25862068965517 28.22774659182037 27.370689655172413 24.142943063352046 50-54 20.23202320232023 28.69286928692869 27.2977297729773 23.77737773777378 55-59 20.47 28.23 27.785 23.515 60-64 20.575 28.345 27.265 23.815 65-69 19.765 28.095 27.839999999999996 24.3 70-74 20.32 28.235 27.435 24.01 75-79 20.615 28.305000000000003 27.16 23.919999999999998 80-84 20.40102005100255 27.9813990699535 27.726386319315964 23.891194559727985 85-89 20.543140595250026 28.32448141096302 27.322376991682535 23.81000100210442 90-94 20.604962504403844 27.60581810861141 27.71654335900146 24.07267602798329 95-99 20.44435487933901 28.374225401783466 26.77212957831629 24.40929014056124 100-104 20.807251239421102 28.834693775351795 26.82157343883019 23.536481546396914 105-109 21.076053802690133 28.266413320666032 26.57132856642832 24.08620431021551 110-114 20.77473599919924 29.05259996997147 26.460137130273758 23.712526900555527 115-119 20.9181377206581 28.5042756413462 26.91903785567835 23.65854878231735 120-124 21.47 27.965 27.115000000000002 23.45 125-129 21.66 28.110000000000003 26.919999999999998 23.31 130-134 21.100365786440847 28.516310066643285 26.67234554291727 23.710978603998598 135-139 20.462311557788944 28.82914572864322 26.834170854271356 23.874371859296485 140-144 21.287476185701394 28.426752231023766 26.722149804472075 23.56362177880277 145-149 20.764069697576605 28.369717604646503 26.867614660524737 23.998598037252155 150-151 20.875 28.712500000000002 26.5 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 4.5 27 5.5 28 3.5 29 12.5 30 20.5 31 21.5 32 22.5 33 28.0 34 38.0 35 59.0 36 85.0 37 108.5 38 127.0 39 152.0 40 181.5 41 220.5 42 247.0 43 259.0 44 281.0 45 278.5 46 266.5 47 253.0 48 239.5 49 213.0 50 176.5 51 153.0 52 132.0 53 106.5 54 78.5 55 53.0 56 37.5 57 30.5 58 26.0 59 18.5 60 12.5 61 13.0 62 11.0 63 5.0 64 2.5 65 3.0 66 3.0 67 2.0 68 1.5 69 1.0 70 1.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.02 45-49 0.24 50-54 0.01 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.21 90-94 0.655 95-99 0.755 100-104 0.155 105-109 0.005 110-114 0.095 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.215 135-139 0.5 140-144 0.27 145-149 0.13999999999999999 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.5625 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.487500000000001 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.6 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.4125 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169962 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169962_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1005 33.0 33.0 34.0 32.0 34.0 2 32.238 34.0 33.0 34.0 32.0 34.0 3 32.28575 34.0 33.0 34.0 32.0 34.0 4 32.005 34.0 33.0 34.0 32.0 34.0 5 32.006 34.0 33.0 34.0 32.0 34.0 6 36.16475 38.0 38.0 38.0 36.0 38.0 7 36.15875 38.0 38.0 38.0 35.0 38.0 8 36.2825 38.0 38.0 38.0 36.0 38.0 9 36.262 38.0 38.0 38.0 36.0 38.0 10-14 36.193 38.0 38.0 38.0 36.0 38.0 15-19 35.962599999999995 38.0 38.0 38.0 35.8 38.0 20-24 36.089999999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.123400000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.14085 38.0 38.0 38.0 36.0 38.0 35-39 36.09085 38.0 38.0 38.0 36.0 38.0 40-44 35.964549999999996 38.0 38.0 38.0 36.0 38.0 45-49 35.87 38.0 38.0 38.0 35.2 38.0 50-54 36.0257 38.0 38.0 38.0 35.8 38.0 55-59 35.98765 38.0 38.0 38.0 35.6 38.0 60-64 35.92165 38.0 38.0 38.0 35.2 38.0 65-69 35.93455 38.0 38.0 38.0 35.0 38.0 70-74 35.8563 38.0 38.0 38.0 34.8 38.0 75-79 35.8183 38.0 38.0 38.0 34.6 38.0 80-84 35.659800000000004 38.0 38.0 38.0 34.0 38.0 85-89 35.36409999999999 38.0 38.0 38.0 33.6 38.0 90-94 35.1083 38.0 38.0 38.0 30.6 38.0 95-99 35.31804999999999 38.0 38.0 38.0 31.8 38.0 100-104 35.2417 38.0 38.0 38.0 31.8 38.0 105-109 35.144 38.0 38.0 38.0 30.6 38.0 110-114 34.94435 38.0 38.0 38.0 28.8 38.0 115-119 34.81915 38.0 37.8 38.0 28.2 38.0 120-124 34.5161 38.0 37.2 38.0 26.2 38.0 125-129 34.12155 38.0 36.6 38.0 21.6 38.0 130-134 33.227250000000005 38.0 35.6 38.0 14.2 38.0 135-139 32.43845 38.0 34.4 38.0 4.2 38.0 140-144 31.609 38.0 33.0 38.0 2.0 38.0 145-149 31.2292 38.0 33.2 38.0 2.0 38.0 150-151 27.477874999999997 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 108.0 3 13.0 4 2.0 5 2.0 6 2.0 7 2.0 8 0.0 9 7.0 10 1.0 11 1.0 12 8.0 13 3.0 14 6.0 15 4.0 16 5.0 17 8.0 18 8.0 19 5.0 20 9.0 21 11.0 22 10.0 23 16.0 24 17.0 25 17.0 26 13.0 27 36.0 28 37.0 29 38.0 30 35.0 31 65.0 32 95.0 33 111.0 34 120.0 35 166.0 36 372.0 37 2647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.887721097154575 19.53345296077929 15.329402717251986 27.24942322481415 2 27.666072792059047 26.393484347162126 29.21863069483329 16.721812165945533 3 19.785823559408467 29.117797042325343 30.545639979602246 20.550739418663948 4 24.619747357566382 33.384893013663316 23.150296468161898 18.845063160608404 5 24.916172298168686 34.227495486200674 22.388444673716794 18.467887541913854 6 20.63125481139338 36.51526815499102 24.12111880934052 18.732358224275085 7 19.117269694636903 22.350526045676162 38.36284321272774 20.1693610469592 8 22.0 24.82051282051282 26.615384615384613 26.564102564102566 9 20.420728578758336 26.346844535659315 29.220112878399178 24.01231400718317 10-14 23.250077089115017 28.12724843252133 26.929797512591225 21.692876965772435 15-19 22.97485672982601 27.461407403583042 28.14290877174867 21.420827094842274 20-24 23.350984525217214 27.26852089866845 28.003701609171767 21.376792966942574 25-29 22.585949946040394 28.038439796495197 27.65815303972455 21.717457217739863 30-34 22.584292763157894 28.125 28.207236842105267 21.083470394736842 35-39 23.128796458354785 27.936785751055286 27.90589931020282 21.02851848038711 40-44 23.297713076248 27.757988746063706 27.90253471684477 21.04176346084353 45-49 23.40513456273568 28.048969471563613 27.480758303631386 21.065137662069322 50-54 23.590771286162067 27.30589383895997 27.932788654231537 21.170546220646422 55-59 23.581414473684212 27.939967105263158 27.677837171052634 20.80078125 60-64 23.312946497404532 27.712391427249834 27.810042658169298 21.164619417176336 65-69 23.690555584055815 27.450879803006206 27.830503257579643 21.028061355358336 70-74 23.450176029389254 27.486096229399458 28.047349354558904 21.016378386652377 75-79 23.322781578678647 26.769120800571837 28.67864801388747 21.229449606862044 80-84 23.7894952810833 27.22096840377513 28.13910545752975 20.85043085761182 85-89 23.624007885044353 27.675468174508485 27.722155937127148 20.978368003320018 90-94 23.71370484282959 27.88927696397852 27.456602199864466 20.940415993327424 95-99 24.061310564756713 27.265713403970786 28.098961012241542 20.574015019030963 100-104 24.004924086992204 27.01579811243332 27.703118588428392 21.27615921214608 105-109 24.031726411207252 27.770910589204778 27.580346106304077 20.61701689328389 110-114 24.20401854714065 27.135497166409067 28.047398248325607 20.613086038124678 115-119 24.037327590627083 27.416294928985284 27.53422550376865 21.01215197661898 120-124 24.162374419909224 27.783160793513183 27.018205925850374 21.036258860727216 125-129 25.143418264509794 27.308904852963977 27.102175823039946 20.44550105948628 130-134 24.904721575269956 27.413720093161125 27.265509210247725 20.416049121321194 135-139 24.289029194323025 27.94236684474664 27.607792347957478 20.160811612972857 140-144 25.17188693659282 27.960275019098546 27.076285059478337 19.791552984830297 145-149 25.547445255474454 27.763672908071513 26.986141965513593 19.70273987094044 150-151 25.55943603673522 28.055878928987195 26.30966239813737 20.075022636140215 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 76.0 1 40.5 2 3.0 3 1.5 4 3.0 5 2.0 6 1.5 7 3.5 8 3.5 9 1.5 10 2.0 11 4.0 12 2.5 13 1.0 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 0.5 25 1.5 26 3.0 27 3.0 28 4.5 29 8.0 30 10.0 31 13.0 32 17.5 33 25.0 34 35.0 35 48.5 36 80.5 37 103.0 38 124.5 39 152.5 40 180.0 41 213.5 42 253.0 43 278.5 44 277.0 45 274.5 46 273.5 47 256.0 48 242.5 49 220.5 50 174.0 51 141.5 52 109.0 53 87.0 54 70.0 55 49.5 56 35.5 57 25.5 58 20.0 59 16.0 60 12.0 61 8.5 62 7.5 63 7.0 64 7.5 65 5.0 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.475 2 1.775 3 1.95 4 3.025 5 3.075 6 2.5749999999999997 7 2.5749999999999997 8 2.5 9 2.55 10-14 2.71 15-19 3.1550000000000002 20-24 2.7449999999999997 25-29 2.705 30-34 2.7199999999999998 35-39 2.87 40-44 3.145 45-49 3.205 50-54 2.6950000000000003 55-59 2.7199999999999998 60-64 2.715 65-69 2.535 70-74 2.005 75-79 2.07 80-84 2.52 85-89 3.615 90-94 4.085 95-99 2.79 100-104 2.52 105-109 2.92 110-114 2.9499999999999997 115-119 2.485 120-124 1.955 125-129 3.2550000000000003 130-134 5.54 135-139 7.345 140-144 8.37 145-149 5.47 150-151 3.3625000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.33264887063655 96.75 2 0.4620123203285421 0.8999999999999999 3 0.12833675564681724 0.375 4 0.051334702258726904 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025667351129363452 1.775 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 71 1.775 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.5999999999999996 0.0 0.0 0.0 0.0 124-125 3.9749999999999996 0.0 0.0 0.0 0.0 126-127 4.4625 0.0 0.0 0.0 0.0 128-129 4.975 0.0 0.0 0.0 0.0 130-131 5.5125 0.0 0.0 0.0 0.0 132-133 5.8125 0.0 0.0 0.0 0.0 134-135 6.175 0.0 0.0 0.0 0.0 136-137 6.612500000000001 0.0 0.0 0.0 0.0 138-139 7.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGAGTC 10 0.007075776 143.27847 2 >>END_MODULE Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721842 spots for SRR7169962.sra Written 721842 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra Read 721823 spots for SRR7169962.sra Written 721823 spots for SRR7169962.sra SRR ids: ['SRR7169962.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8v3zfxfh SRR7169962.sra spots: 14436479 blocks: [[1, 721823], [721824, 1443646], [1443647, 2165469], [2165470, 2887292], [2887293, 3609115], [3609116, 4330938], [4330939, 5052761], [5052762, 5774584], [5774585, 6496407], [6496408, 7218230], [7218231, 7940053], [7940054, 8661876], [8661877, 9383699], [9383700, 10105522], [10105523, 10827345], [10827346, 11549168], [11549169, 12270991], [12270992, 12992814], [12992815, 13714637], [13714638, 14436479]] SRR7169962 file size 4870348 SRR7169962 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169962 SRR7169962_1.fastq SRR7169962_2.fastq Input file: SRR7169962_1.fastq Paired file: SRR7169962_2.fastq trimmed: SRR7169962-trimmed-pair1.fastq, SRR7169962-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:01:08 2025 >> started Wed Feb 12 06:01:25 2025 >> done (16.722s) 14436479 read pairs processed; of these: 20000 ( 0.14%) short read pairs filtered out after trimming by size control 28763 ( 0.20%) empty read pairs filtered out after trimming by size control 14387716 (99.66%) read pairs available; of these: 6692715 (46.52%) trimmed read pairs available after processing 7695001 (53.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 7 0.00% 26 5 0.00% 27 7 0.00% 28 8 0.00% 29 7 0.00% 30 16 0.00% 31 10 0.00% 32 6 0.00% 33 9 0.00% 34 11 0.00% 35 21 0.00% 36 13 0.00% 37 15 0.00% 38 15 0.00% 39 18 0.00% 40 24 0.00% 41 30 0.00% 42 24 0.00% 43 36 0.00% 44 28 0.00% 45 36 0.00% 46 37 0.00% 47 51 0.00% 48 48 0.00% 49 62 0.00% 50 63 0.00% 51 74 0.00% 52 88 0.00% 53 92 0.00% 54 78 0.00% 55 95 0.00% 56 109 0.00% 57 124 0.00% 58 153 0.00% 59 177 0.00% 60 197 0.00% 61 225 0.00% 62 278 0.00% 63 317 0.00% 64 352 0.00% 65 399 0.00% 66 414 0.00% 67 520 0.00% 68 580 0.00% 69 657 0.00% 70 903 0.01% 71 1151 0.01% 72 1151 0.01% 73 1212 0.01% 74 1211 0.01% 75 1357 0.01% 76 1477 0.01% 77 1583 0.01% 78 1777 0.01% 79 1965 0.01% 80 2187 0.02% 81 2688 0.02% 82 2903 0.02% 83 3395 0.02% 84 4475 0.03% 85 5553 0.04% 86 5703 0.04% 87 5977 0.04% 88 6269 0.04% 89 6623 0.05% 90 7134 0.05% 91 7660 0.05% 92 8533 0.06% 93 9378 0.07% 94 10039 0.07% 95 10627 0.07% 96 11336 0.08% 97 11636 0.08% 98 12018 0.08% 99 12381 0.09% 100 13497 0.09% 101 13803 0.10% 102 15075 0.10% 103 16033 0.11% 104 17025 0.12% 105 18057 0.13% 106 19013 0.13% 107 19294 0.13% 108 20058 0.14% 109 20580 0.14% 110 21197 0.15% 111 22404 0.16% 112 23497 0.16% 113 24724 0.17% 114 26349 0.18% 115 27441 0.19% 116 28354 0.20% 117 28939 0.20% 118 29772 0.21% 119 29990 0.21% 120 30829 0.21% 121 32357 0.22% 122 33605 0.23% 123 35011 0.24% 124 36804 0.26% 125 39088 0.27% 126 40268 0.28% 127 41636 0.29% 128 42610 0.30% 129 43714 0.30% 130 45206 0.31% 131 46624 0.32% 132 49270 0.34% 133 52182 0.36% 134 55579 0.39% 135 58023 0.40% 136 61696 0.43% 137 65534 0.46% 138 70380 0.49% 139 75988 0.53% 140 79680 0.55% 141 87295 0.61% 142 94476 0.66% 143 103799 0.72% 144 117034 0.81% 145 134137 0.93% 146 163054 1.13% 147 206673 1.44% 148 304861 2.12% 149 585485 4.07% 150 3258855 22.65% 151 7695001 53.48% 14387716 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=261.40 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=28.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=38 prefix-density=0.28 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=279.34 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.3 sequence=AAGAAGAAGAAA SRR7169962 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:02:10 Started mapping on | Feb 12 06:02:10 Finished on | Feb 12 06:03:29 Mapping speed, Million of reads per hour | 655.64 Number of input reads | 14387716 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13686058 Uniquely mapped reads % | 95.12% Average mapped length | 293.34 Number of splices: Total | 12965817 Number of splices: Annotated (sjdb) | 12748718 Number of splices: GT/AG | 12775264 Number of splices: GC/AG | 154669 Number of splices: AT/AC | 10715 Number of splices: Non-canonical | 25169 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 247396 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 72788 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.56% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 472376 472376 472376 N_multimapping 247396 247396 247396 N_noFeature 285177 13530680 354988 N_ambiguous 140441 770 54355 UnstrandedReadsAssigned:13260440 PositiveStrandReadsAssigned:154608 NegativeStrandReadsAssigned:13276715 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169962 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169962-trimmed-pair1.fastq SRR7169962-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,387,716 reads, 13,238,530 reads pseudoaligned [quant] estimated average fragment length: 235.34 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR7169962.ke.tsv 34699 SRR7169962.se.tsv 87100 total ==> SRR7169962.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.66 303 12.7839 Potri.005G024800.1.v4.1 1035 800.66 48 4.51155 Potri.004G059700.1.v4.1 961 726.694 16 1.65692 Potri.007G009000.2.v4.1 1416 1181.66 0 0 Potri.003G141000.2.v4.1 2943 2708.66 209.029 5.80744 Potri.016G087400.1.v4.1 270 83.2258 1007.05 910.598 Potri.015G069301.1.v4.1 564 334.584 0 0 Potri.010G195200.1.v4.1 1773 1538.66 28 1.36946 Potri.012G127500.1.v4.1 977 742.667 5306 537.658 ==> SRR7169962.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1046 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169962 completed mapping pipeline successfully