Starting /dee2/code/volunteer_pipeline.sh SRR7169963 current disk space = 3050279460864 free memory = 1582397872 SRR7169963 SRAfilesize 98c1b5958ac9ad7b5e8274825471e4af SRR7169963.sra SRR7169963.sra file validated SRR7169963 is paired end SRR7169963 is conventional basespace SRR7169963 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169963_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.4885 34.0 34.0 34.0 33.0 34.0 2 33.59075 34.0 34.0 34.0 33.0 34.0 3 33.654 34.0 34.0 34.0 33.0 34.0 4 33.655 34.0 34.0 34.0 33.0 34.0 5 33.6405 34.0 34.0 34.0 33.0 34.0 6 37.2645 38.0 38.0 38.0 36.0 38.0 7 37.53825 38.0 38.0 38.0 37.0 38.0 8 37.599 38.0 38.0 38.0 38.0 38.0 9 37.5905 38.0 38.0 38.0 38.0 38.0 10-14 37.6043 38.0 38.0 38.0 38.0 38.0 15-19 37.535849999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.49995 38.0 38.0 38.0 38.0 38.0 25-29 37.51505 38.0 38.0 38.0 38.0 38.0 30-34 37.407050000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.2852 38.0 38.0 38.0 36.8 38.0 40-44 36.9327 38.0 38.0 38.0 36.0 38.0 45-49 36.816 38.0 38.0 38.0 35.2 38.0 50-54 36.74535 38.0 38.0 38.0 34.8 38.0 55-59 36.7625 38.0 38.0 38.0 34.8 38.0 60-64 36.613099999999996 38.0 38.0 38.0 34.4 38.0 65-69 36.4208 38.0 38.0 38.0 34.0 38.0 70-74 36.38205000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.116249999999994 38.0 37.8 38.0 33.4 38.0 80-84 35.9782 38.0 37.0 38.0 33.0 38.0 85-89 35.81395 38.0 37.0 38.0 32.0 38.0 90-94 35.4645 38.0 36.8 38.0 30.2 38.0 95-99 35.30839999999999 38.0 36.6 38.0 29.0 38.0 100-104 35.18765 38.0 36.4 38.0 29.2 38.0 105-109 35.00205 38.0 36.0 38.0 28.8 38.0 110-114 34.666050000000006 38.0 35.6 38.0 27.0 38.0 115-119 34.21945 38.0 35.0 38.0 23.8 38.0 120-124 33.89195 38.0 34.4 38.0 23.0 38.0 125-129 33.5072 38.0 34.0 38.0 19.8 38.0 130-134 33.04865 38.0 33.8 38.0 15.0 38.0 135-139 32.1819 37.6 32.4 38.0 14.2 38.0 140-144 31.424599999999998 36.2 31.0 38.0 14.0 38.0 145-149 30.440800000000003 36.0 30.6 38.0 6.4 38.0 150-151 25.604875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 3.0 13 6.0 14 6.0 15 1.0 16 10.0 17 8.0 18 13.0 19 27.0 20 7.0 21 13.0 22 17.0 23 13.0 24 25.0 25 29.0 26 18.0 27 29.0 28 35.0 29 49.0 30 57.0 31 66.0 32 86.0 33 123.0 34 219.0 35 426.0 36 1110.0 37 1600.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.26067302862883 14.992466097438474 11.275740833751884 32.471120040180814 2 23.075000000000003 16.25 30.95 29.725 3 20.775 20.849999999999998 25.324999999999996 33.050000000000004 4 21.025 27.700000000000003 22.85 28.425 5 22.2 30.325000000000003 25.374999999999996 22.1 6 19.35 34.9 26.575 19.175 7 15.7 28.775000000000002 38.5 17.025000000000002 8 17.875 28.375 30.349999999999998 23.400000000000002 9 16.475 27.474999999999998 33.675 22.375 10-14 18.775 32.435 26.924999999999997 21.865000000000002 15-19 18.615000000000002 31.31 27.175 22.900000000000002 20-24 18.475 30.620000000000005 27.625 23.28 25-29 18.360000000000003 31.095 27.32 23.225 30-34 19.215 30.605 27.145000000000003 23.035 35-39 19.595000000000002 30.145 27.055 23.205000000000002 40-44 19.725 29.675 27.134999999999998 23.465 45-49 19.650000000000002 29.92 27.85 22.58 50-54 19.665 30.814999999999998 26.615 22.905 55-59 19.689999999999998 30.445 26.875 22.99 60-64 18.790000000000003 30.795 27.32 23.095 65-69 18.915000000000003 30.154999999999998 27.345000000000002 23.585 70-74 19.115 30.520000000000003 26.69 23.674999999999997 75-79 19.395 30.4 26.77 23.435 80-84 19.470000000000002 30.65 26.51 23.369999999999997 85-89 20.064999999999998 29.75 26.810000000000002 23.375 90-94 20.386405726012313 30.166675008759196 27.00335352119726 22.443565744031233 95-99 19.70773696326694 29.55660094084676 26.814132719447503 23.921529376438794 100-104 19.585 31.019999999999996 26.695 22.7 105-109 19.965 29.609999999999996 27.250000000000004 23.175 110-114 20.29 30.049999999999997 25.979999999999997 23.68 115-119 20.14 29.509999999999998 27.1 23.25 120-124 19.97 29.895 26.5 23.635 125-129 20.285 29.349999999999998 26.490000000000002 23.875 130-134 20.407142499874954 29.23023058070325 26.609313259640878 23.753313659780922 135-139 20.59117735320596 29.313794138241473 26.247874362308693 23.847154146243874 140-144 20.341102330699208 29.42882864859458 26.357907372211663 23.872161648494547 145-149 20.4642088940023 29.63333500075034 25.586513931269074 24.315942173978293 150-151 21.852731591448933 28.116014501812725 25.828228528566072 24.20302537817227 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.5 20 3.0 21 3.0 22 2.5 23 3.0 24 5.0 25 5.5 26 9.0 27 15.0 28 21.0 29 27.5 30 35.0 31 51.0 32 63.5 33 79.5 34 91.0 35 112.5 36 138.0 37 141.5 38 156.0 39 173.0 40 188.5 41 222.5 42 240.5 43 216.0 44 212.0 45 225.5 46 222.0 47 209.0 48 195.0 49 181.0 50 156.0 51 123.5 52 100.5 53 86.0 54 61.5 55 44.5 56 35.5 57 29.0 58 26.5 59 18.5 60 8.5 61 6.5 62 9.5 63 9.5 64 7.0 65 5.5 66 3.5 67 3.0 68 4.5 69 3.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.105 95-99 0.09 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.034999999999999996 135-139 0.03 140-144 0.03 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.6744838134081 96.775 2 1.0960999235279123 2.15 3 0.1274534794799898 0.375 4 0.05098139179199593 0.2 5 0.025490695895997964 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025490695895997964 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCACAATCTCGTATGC 15 0.375 TruSeq Adapter, Index 6 (97% over 37bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCACAATCTCGTATGCC 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.5750000000000002 0.0 0.0 0.0 0.0 106-107 1.775 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.125 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 5.1 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 5.9375 0.0 0.0 0.0 0.0 130-131 6.475 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.475 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGCAC 10 0.0068449317 144.90001 9 TTGAAGT 10 0.0068449317 144.90001 7 >>END_MODULE SRR7169963 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169963_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.089 34.0 33.0 34.0 33.0 34.0 2 33.1365 34.0 33.0 34.0 33.0 34.0 3 33.10875 34.0 33.0 34.0 33.0 34.0 4 32.98375 34.0 33.0 34.0 33.0 34.0 5 33.04075 34.0 33.0 34.0 33.0 34.0 6 37.17325 38.0 38.0 38.0 38.0 38.0 7 37.186 38.0 38.0 38.0 38.0 38.0 8 37.18875 38.0 38.0 38.0 38.0 38.0 9 37.2125 38.0 38.0 38.0 38.0 38.0 10-14 37.02565 38.0 38.0 38.0 38.0 38.0 15-19 36.941900000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.0065 38.0 38.0 38.0 37.8 38.0 25-29 36.9961 38.0 38.0 38.0 38.0 38.0 30-34 37.0171 38.0 38.0 38.0 38.0 38.0 35-39 36.91930000000001 38.0 38.0 38.0 37.6 38.0 40-44 36.79575 38.0 38.0 38.0 37.8 38.0 45-49 36.7262 38.0 38.0 38.0 37.0 38.0 50-54 36.93645 38.0 38.0 38.0 37.2 38.0 55-59 36.88175 38.0 38.0 38.0 37.0 38.0 60-64 36.8226 38.0 38.0 38.0 37.0 38.0 65-69 36.81285 38.0 38.0 38.0 37.0 38.0 70-74 36.6318 38.0 38.0 38.0 36.8 38.0 75-79 36.61325000000001 38.0 38.0 38.0 36.8 38.0 80-84 36.4945 38.0 38.0 38.0 36.4 38.0 85-89 36.11635 38.0 38.0 38.0 35.6 38.0 90-94 36.01035 38.0 38.0 38.0 35.0 38.0 95-99 36.23355 38.0 38.0 38.0 35.0 38.0 100-104 36.27155 38.0 38.0 38.0 35.0 38.0 105-109 36.136700000000005 38.0 38.0 38.0 34.4 38.0 110-114 35.95395 38.0 38.0 38.0 34.0 38.0 115-119 35.83205 38.0 38.0 38.0 33.6 38.0 120-124 35.6217 38.0 38.0 38.0 33.2 38.0 125-129 35.174150000000004 38.0 37.6 38.0 30.8 38.0 130-134 34.164649999999995 38.0 36.2 38.0 23.8 38.0 135-139 33.400150000000004 38.0 35.4 38.0 15.6 38.0 140-144 32.667550000000006 38.0 34.0 38.0 13.2 38.0 145-149 32.206849999999996 38.0 33.0 38.0 6.4 38.0 150-151 28.01725 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 16.0 4 2.0 5 3.0 6 2.0 7 4.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 4.0 14 2.0 15 6.0 16 3.0 17 17.0 18 11.0 19 4.0 20 6.0 21 8.0 22 11.0 23 10.0 24 12.0 25 10.0 26 13.0 27 23.0 28 24.0 29 34.0 30 45.0 31 51.0 32 68.0 33 83.0 34 98.0 35 160.0 36 440.0 37 2799.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.76447005762967 20.972187421698823 15.234277123527937 24.029065397143572 2 27.06766917293233 27.167919799498748 28.220551378446114 17.543859649122805 3 22.073999496602063 29.725648124842692 29.5242889504153 18.676063428139944 4 24.31818181818182 33.939393939393945 23.56060606060606 18.181818181818183 5 26.57782247925572 34.49836560221272 22.63012320844858 16.293688710082975 6 23.322442824830357 36.793164111585824 23.196783111334508 16.687609952249307 7 21.52184831742843 23.405323957810147 36.765444500251135 18.307383224510296 8 23.851368315340196 26.16118503640472 26.387145367813208 23.60030128044188 9 22.286432160804022 27.160804020100503 28.41708542713568 22.135678391959797 10-14 24.311371203713048 28.28675209363334 26.198163656543233 21.20371304611038 15-19 24.389874185235712 27.638825728866657 27.588297711080795 20.383002374816837 20-24 24.045147636803385 28.655648493399173 27.078504484530885 20.220699385266553 25-29 23.74735356386733 29.015021675572132 26.827301139227743 20.410323621332797 30-34 24.089466525615837 28.326028915419876 27.2832602891542 20.301244269810084 35-39 24.365841334007072 27.524002021222838 27.46841839312784 20.641738251642245 40-44 24.321857729554328 28.677178928154945 27.287937940475587 19.71302540181514 45-49 23.141207455429498 27.89201782820097 28.190842787682335 20.775931928687196 50-54 24.07519403285959 27.829855861304303 27.749218828747104 20.345731277089 55-59 24.338757620031238 27.49256889515845 28.328883067157033 19.839790417653283 60-64 23.250997625902915 28.05980704147093 28.45380613224226 20.235389200383896 65-69 23.57207615593835 28.15049864007253 27.873476377556162 20.40394882643296 70-74 23.42518696983386 28.233699744014455 27.937559604477237 20.403553681674445 75-79 23.217871485943775 28.13253012048193 28.544176706827308 20.10542168674699 80-84 24.03104682223678 27.72037699712716 28.123582480721737 20.124993699914317 85-89 23.70781934957692 27.918238352533386 28.44326638801101 19.930675909878683 90-94 23.903184713375797 27.704458598726116 28.799999999999997 19.59235668789809 95-99 23.4710826999547 27.8854381637892 28.524689183067398 20.118789953188703 100-104 23.504853880589508 27.750113173381617 28.761128715859364 19.983904230169507 105-109 23.247622402254315 28.02797765812912 28.782770593267248 19.94162934634932 110-114 23.431194511702984 27.99132364810331 28.864003228410006 19.713478611783696 115-119 23.937292734398554 28.298663450909455 28.208220279368906 19.555823535323082 120-124 23.97792826686732 28.25683471281665 28.086280411336844 19.67895660897918 125-129 24.061675796307565 28.033069588151754 28.3323189287888 19.572935686751876 130-134 24.39579775397195 28.230606013558972 27.795890907209024 19.57770532526005 135-139 24.563610630602295 28.37972427530534 28.02327409970121 19.03339099439115 140-144 25.189063408958695 28.039557882489817 27.621767412343328 19.149611296208153 145-149 24.751154438173423 28.10672139558748 27.64494612621857 19.497178040020525 150-151 25.192964696950526 28.356320384664052 27.394660255599142 19.056054662786284 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 2.5 3 3.5 4 2.0 5 1.5 6 0.5 7 1.5 8 2.0 9 2.5 10 3.5 11 1.5 12 0.0 13 0.0 14 0.5 15 2.0 16 2.0 17 0.5 18 1.0 19 2.0 20 2.5 21 2.0 22 1.0 23 1.5 24 2.0 25 2.0 26 2.5 27 6.5 28 7.5 29 11.0 30 14.0 31 21.0 32 29.5 33 35.5 34 40.0 35 61.5 36 82.5 37 104.5 38 148.5 39 196.0 40 222.0 41 225.5 42 248.5 43 259.5 44 280.0 45 280.0 46 240.5 47 222.5 48 212.5 49 200.5 50 169.0 51 123.0 52 105.0 53 98.0 54 79.0 55 61.0 56 43.5 57 29.5 58 22.5 59 19.0 60 14.0 61 10.0 62 7.0 63 5.5 64 4.0 65 3.5 66 3.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.22499999999999998 2 0.25 3 0.675 4 1.0 5 0.575 6 0.525 7 0.44999999999999996 8 0.42500000000000004 9 0.5 10-14 0.89 15-19 1.045 20-24 0.77 25-29 0.8099999999999999 30-34 0.745 35-39 1.05 40-44 1.385 45-49 1.28 50-54 0.79 55-59 0.755 60-64 1.015 65-69 0.73 70-74 0.385 75-79 0.4 80-84 0.795 85-89 1.91 90-94 1.875 95-99 0.6649999999999999 100-104 0.5950000000000001 105-109 0.635 110-114 0.88 115-119 0.49 120-124 0.325 125-129 1.4200000000000002 130-134 3.385 135-139 4.614999999999999 140-144 5.455 145-149 2.55 150-151 1.2125000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56923863055698 96.45 2 1.251916198262647 2.45 3 0.0510986203372509 0.15 4 0.02554931016862545 0.1 5 0.02554931016862545 0.125 6 0.02554931016862545 0.15 7 0.0 0.0 8 0.02554931016862545 0.2 9 0.0 0.0 >10 0.02554931016862545 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 15 0.375 Illumina Single End PCR Primer 1 (100% over 50bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGT 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 6 0.15 No Hit GACATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6625 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.7875 0.0 0.0 0.0 0.0 114-115 3.1500000000000004 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.725 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.375 0.0 0.0 0.0 0.0 132-133 6.825 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 7.8125 0.0 0.0 0.0 0.0 138-139 8.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608519 spots for SRR7169963.sra Written 608519 spots for SRR7169963.sra Read 608524 spots for SRR7169963.sra Written 608524 spots for SRR7169963.sra SRR ids: ['SRR7169963.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t9_7fk5o SRR7169963.sra spots: 12170385 blocks: [[1, 608519], [608520, 1217038], [1217039, 1825557], [1825558, 2434076], [2434077, 3042595], [3042596, 3651114], [3651115, 4259633], [4259634, 4868152], [4868153, 5476671], [5476672, 6085190], [6085191, 6693709], [6693710, 7302228], [7302229, 7910747], [7910748, 8519266], [8519267, 9127785], [9127786, 9736304], [9736305, 10344823], [10344824, 10953342], [10953343, 11561861], [11561862, 12170385]] SRR7169963 file size 4102443 SRR7169963 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169963 SRR7169963_1.fastq SRR7169963_2.fastq Input file: SRR7169963_1.fastq Paired file: SRR7169963_2.fastq trimmed: SRR7169963-trimmed-pair1.fastq, SRR7169963-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:16:36 2025 >> started Wed Feb 12 06:16:48 2025 >> done (12.847s) 12170385 read pairs processed; of these: 28988 ( 0.24%) short read pairs filtered out after trimming by size control 75642 ( 0.62%) empty read pairs filtered out after trimming by size control 12065755 (99.14%) read pairs available; of these: 7253094 (60.11%) trimmed read pairs available after processing 4812661 (39.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 6 0.00% 21 10 0.00% 22 13 0.00% 23 11 0.00% 24 30 0.00% 25 12 0.00% 26 15 0.00% 27 15 0.00% 28 15 0.00% 29 18 0.00% 30 25 0.00% 31 20 0.00% 32 19 0.00% 33 24 0.00% 34 36 0.00% 35 30 0.00% 36 23 0.00% 37 33 0.00% 38 35 0.00% 39 46 0.00% 40 57 0.00% 41 49 0.00% 42 50 0.00% 43 61 0.00% 44 61 0.00% 45 82 0.00% 46 88 0.00% 47 124 0.00% 48 94 0.00% 49 125 0.00% 50 139 0.00% 51 170 0.00% 52 194 0.00% 53 247 0.00% 54 197 0.00% 55 237 0.00% 56 219 0.00% 57 280 0.00% 58 361 0.00% 59 335 0.00% 60 349 0.00% 61 390 0.00% 62 462 0.00% 63 570 0.00% 64 615 0.01% 65 813 0.01% 66 1243 0.01% 67 2536 0.02% 68 3646 0.03% 69 3883 0.03% 70 5240 0.04% 71 4556 0.04% 72 3604 0.03% 73 2855 0.02% 74 2486 0.02% 75 2395 0.02% 76 2373 0.02% 77 2420 0.02% 78 2666 0.02% 79 2725 0.02% 80 3059 0.03% 81 3491 0.03% 82 3991 0.03% 83 4692 0.04% 84 6228 0.05% 85 6904 0.06% 86 7575 0.06% 87 8141 0.07% 88 8439 0.07% 89 9037 0.07% 90 9449 0.08% 91 9821 0.08% 92 10559 0.09% 93 11212 0.09% 94 12162 0.10% 95 12986 0.11% 96 13736 0.11% 97 14455 0.12% 98 15022 0.12% 99 15536 0.13% 100 16476 0.14% 101 17426 0.14% 102 18420 0.15% 103 19748 0.16% 104 21021 0.17% 105 22326 0.19% 106 23379 0.19% 107 24616 0.20% 108 25291 0.21% 109 25545 0.21% 110 25901 0.21% 111 26565 0.22% 112 28058 0.23% 113 29969 0.25% 114 31085 0.26% 115 32788 0.27% 116 33929 0.28% 117 34244 0.28% 118 34779 0.29% 119 35268 0.29% 120 36371 0.30% 121 37501 0.31% 122 39218 0.33% 123 41454 0.34% 124 43727 0.36% 125 45287 0.38% 126 47294 0.39% 127 48858 0.40% 128 50106 0.42% 129 51588 0.43% 130 53823 0.45% 131 55029 0.46% 132 58395 0.48% 133 61773 0.51% 134 65450 0.54% 135 69481 0.58% 136 73749 0.61% 137 77630 0.64% 138 82776 0.69% 139 88031 0.73% 140 93730 0.78% 141 101464 0.84% 142 111500 0.92% 143 125136 1.04% 144 142345 1.18% 145 166368 1.38% 146 208450 1.73% 147 283046 2.35% 148 414056 3.43% 149 760825 6.31% 150 2955850 24.50% 151 4812661 39.89% 12065755 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.88 fanout-score-rank=29 prefix-density=0.17 prefix-fanout=4.1 sequence=GTTGCATCCTGGTATTGCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=207.92 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.7 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=18.21 fanout-score-rank=10 prefix-density=0.40 prefix-fanout=7.6 sequence=TGCTGAGATCATTGTGCATGGAAAATCCGGATTCCATATTGATCCTTACCATGGAGTACAGGCTGCTGAACTCCTTGTTGACTTCTTTGAGAAGTGCAAGGCTGATCCCAGTTACTGGGACAAAATCTCCCAGGGAGGCCTGCAGCGAATCCAAGAGAAGTATACCTGGAAAATTTACTCTCAAAGGCTCCTGACTCTCACAGGAGTTTATGGCTTCTGGAAGCATGTTTCCAACCTTGATCATCGTGAGAGCCGTCGCTATCTGGAAATGTTCTATGCACTCAAATATCGCAAATTGGCTGATTCTGTTCCTTTGACTATCGAGTAAATGGAGCTGGAGAAATCAAGGAAACATGGGTTGGTTTGAGTCGGGTTCCGGGTCCAGAATAATGGTGTCATTTCACGATAGTGATTGGACAAGAAAGGCTTTGATCTTCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=64.47 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=10.0 sequence=GAAAATGGAGGCAATGAAAATGAAGATCTTTGTTGTGTTGATGGTGGTCTTGATGGCCTTCTCAACCATGCAAAAGGCTGCAGCTGCCGATGCACCAGCACCA SRR7169963 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:17:33 Started mapping on | Feb 12 06:17:33 Finished on | Feb 12 06:19:47 Mapping speed, Million of reads per hour | 324.15 Number of input reads | 12065755 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 10845555 Uniquely mapped reads % | 89.89% Average mapped length | 290.13 Number of splices: Total | 8346342 Number of splices: Annotated (sjdb) | 8170588 Number of splices: GT/AG | 8209590 Number of splices: GC/AG | 100342 Number of splices: AT/AC | 7582 Number of splices: Non-canonical | 28828 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.04% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222880 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 17900 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1017906 1017906 1017906 N_multimapping 222880 222880 222880 N_noFeature 288662 10680836 362612 N_ambiguous 136164 816 44856 UnstrandedReadsAssigned:10420729 PositiveStrandReadsAssigned:163903 NegativeStrandReadsAssigned:10438087 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7169963 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169963-trimmed-pair1.fastq SRR7169963-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,065,755 reads, 10,435,574 reads pseudoaligned [quant] estimated average fragment length: 217.218 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR7169963.ke.tsv 34699 SRR7169963.se.tsv 87100 total ==> SRR7169963.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.78 188 8.68421 Potri.005G024800.1.v4.1 1035 818.782 25 2.54124 Potri.004G059700.1.v4.1 961 744.823 3 0.33523 Potri.007G009000.2.v4.1 1416 1199.78 0 0 Potri.003G141000.2.v4.1 2943 2726.78 139 4.24267 Potri.016G087400.1.v4.1 270 86.6466 1235 1186.29 Potri.015G069301.1.v4.1 564 349.788 0 0 Potri.010G195200.1.v4.1 1773 1556.78 14 0.748471 Potri.012G127500.1.v4.1 977 760.793 3510 383.986 ==> SRR7169963.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 887 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 307 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169963 completed mapping pipeline successfully