Starting /dee2/code/volunteer_pipeline.sh SRR7169964 current disk space = 3048814161920 free memory = 1579207820 SRR7169964 SRAfilesize 5376da72d033c273fb333d196680703d SRR7169964.sra SRR7169964.sra file validated SRR7169964 is paired end SRR7169964 is conventional basespace SRR7169964 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.988 34.0 33.0 34.0 33.0 34.0 2 33.40975 34.0 34.0 34.0 33.0 34.0 3 33.4745 34.0 34.0 34.0 33.0 34.0 4 33.55675 34.0 34.0 34.0 33.0 34.0 5 33.597 34.0 34.0 34.0 33.0 34.0 6 37.4065 38.0 38.0 38.0 37.0 38.0 7 37.54325 38.0 38.0 38.0 37.0 38.0 8 37.62575 38.0 38.0 38.0 38.0 38.0 9 37.671 38.0 38.0 38.0 38.0 38.0 10-14 37.6823 38.0 38.0 38.0 38.0 38.0 15-19 37.6286 38.0 38.0 38.0 38.0 38.0 20-24 37.61385 38.0 38.0 38.0 38.0 38.0 25-29 37.5835 38.0 38.0 38.0 38.0 38.0 30-34 37.60245 38.0 38.0 38.0 38.0 38.0 35-39 37.565 38.0 38.0 38.0 38.0 38.0 40-44 37.41385 38.0 38.0 38.0 37.4 38.0 45-49 37.362700000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.33710000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.290949999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1892 38.0 38.0 38.0 36.6 38.0 65-69 37.1734 38.0 38.0 38.0 36.4 38.0 70-74 37.11409999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.0284 38.0 38.0 38.0 36.0 38.0 80-84 36.918800000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.8633 38.0 38.0 38.0 35.6 38.0 90-94 36.734750000000005 38.0 38.0 38.0 35.0 38.0 95-99 36.5432 38.0 38.0 38.0 34.8 38.0 100-104 36.4511 38.0 38.0 38.0 34.0 38.0 105-109 36.356 38.0 38.0 38.0 34.0 38.0 110-114 36.23945 38.0 38.0 38.0 33.8 38.0 115-119 36.01375 38.0 37.2 38.0 33.2 38.0 120-124 35.84705 38.0 37.0 38.0 32.8 38.0 125-129 35.66845 38.0 37.0 38.0 31.4 38.0 130-134 35.202799999999996 38.0 36.0 38.0 29.4 38.0 135-139 34.784650000000006 38.0 35.4 38.0 27.8 38.0 140-144 34.53655 38.0 35.0 38.0 27.4 38.0 145-149 33.7718 38.0 33.4 38.0 22.4 38.0 150-151 29.971375000000002 36.0 28.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 2.0 14 3.0 15 2.0 16 1.0 17 3.0 18 4.0 19 2.0 20 2.0 21 9.0 22 5.0 23 5.0 24 16.0 25 14.0 26 13.0 27 17.0 28 21.0 29 24.0 30 38.0 31 48.0 32 63.0 33 80.0 34 138.0 35 219.0 36 573.0 37 2697.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.96951219512195 10.340447154471546 7.596544715447154 37.09349593495935 2 22.925 12.825000000000001 35.025 29.225 3 19.475 18.25 24.925 37.35 4 24.575 25.474999999999998 23.474999999999998 26.474999999999998 5 23.825 31.7 23.35 21.125 6 19.0 34.625 25.05 21.325 7 15.2 27.250000000000004 40.849999999999994 16.7 8 18.625 25.424999999999997 31.65 24.3 9 17.925 24.349999999999998 33.074999999999996 24.65 10-14 20.119999999999997 29.494999999999997 27.27 23.115 15-19 20.415 28.73 27.67 23.185 20-24 20.635 27.57 27.785 24.01 25-29 20.085 28.575 27.92 23.419999999999998 30-34 19.775000000000002 28.53 27.76 23.935000000000002 35-39 20.25 28.660000000000004 27.395000000000003 23.695 40-44 20.4 28.96 27.474999999999998 23.165 45-49 20.165 28.499999999999996 27.675 23.66 50-54 19.895 28.555000000000003 27.905 23.645 55-59 20.27 28.285 27.51 23.935000000000002 60-64 20.1 28.110000000000003 27.705000000000002 24.085 65-69 20.31 28.560000000000002 27.71 23.419999999999998 70-74 20.369999999999997 28.225 27.62 23.785 75-79 20.549999999999997 28.065 27.29 24.095 80-84 20.23 29.409999999999997 26.655 23.705000000000002 85-89 20.387038703870385 28.082808280828083 27.647764776477647 23.882388238823882 90-94 20.25037556334502 28.5978968452679 27.341011517275916 23.810716074111166 95-99 20.44018850897423 28.25127845181991 27.64965406597814 23.658878973227715 100-104 20.65 28.77 27.445000000000004 23.135 105-109 20.655 28.185 27.694999999999997 23.465 110-114 20.515 28.360000000000003 27.084999999999997 24.04 115-119 21.355 27.950000000000003 27.515 23.18 120-124 20.845 28.470000000000002 26.640000000000004 24.044999999999998 125-129 21.22 28.335 27.165 23.28 130-134 21.05 28.610000000000003 26.72 23.62 135-139 20.858343337334933 28.226290516206483 26.94077631052421 23.974589835934374 140-144 21.560000000000002 28.395 26.69 23.355 145-149 21.455 28.449999999999996 26.505000000000003 23.59 150-151 20.7625 28.0625 26.2875 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 0.5 23 0.5 24 1.5 25 4.0 26 5.0 27 6.5 28 8.0 29 10.0 30 15.5 31 18.5 32 29.5 33 43.0 34 48.5 35 57.5 36 70.5 37 92.0 38 121.5 39 148.0 40 184.5 41 213.5 42 237.0 43 266.0 44 280.5 45 277.0 46 279.0 47 274.0 48 245.0 49 212.5 50 184.0 51 158.5 52 121.0 53 93.5 54 79.0 55 55.5 56 40.5 57 36.0 58 24.0 59 16.0 60 11.0 61 6.0 62 4.5 63 4.5 64 3.5 65 1.5 66 2.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.15 95-99 0.27 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.04 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72410333584149 99.4 2 0.2257336343115124 0.44999999999999996 3 0.05016302984700275 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.07500000000000001 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.4749999999999996 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.1 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.9000000000000004 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.25 0.0 0.0 0.0 0.0 126-127 5.8375 0.0 0.0 0.0 0.0 128-129 6.300000000000001 0.0 0.0 0.0 0.0 130-131 6.9875 0.0 0.0 0.0 0.0 132-133 7.574999999999999 0.0 0.0 0.0 0.0 134-135 8.125 0.0 0.0 0.0 0.0 136-137 8.5875 0.0 0.0 0.0 0.0 138-139 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169964 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169964_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13575 33.0 33.0 34.0 32.0 34.0 2 32.46325 34.0 33.0 34.0 32.0 34.0 3 32.37225 34.0 33.0 34.0 32.0 34.0 4 32.09475 34.0 33.0 34.0 32.0 34.0 5 32.03525 34.0 33.0 34.0 32.0 34.0 6 36.36775 38.0 38.0 38.0 36.0 38.0 7 36.4965 38.0 38.0 38.0 36.0 38.0 8 36.55875 38.0 38.0 38.0 36.0 38.0 9 36.62025 38.0 38.0 38.0 37.0 38.0 10-14 36.4419 38.0 38.0 38.0 36.4 38.0 15-19 36.24385 38.0 38.0 38.0 36.0 38.0 20-24 36.378150000000005 38.0 38.0 38.0 36.2 38.0 25-29 36.4665 38.0 38.0 38.0 36.6 38.0 30-34 36.459 38.0 38.0 38.0 36.2 38.0 35-39 36.326100000000004 38.0 38.0 38.0 36.2 38.0 40-44 36.141000000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.0507 38.0 38.0 38.0 35.2 38.0 50-54 36.338350000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.2681 38.0 38.0 38.0 36.0 38.0 60-64 36.205650000000006 38.0 38.0 38.0 35.4 38.0 65-69 36.1384 38.0 38.0 38.0 35.2 38.0 70-74 36.18044999999999 38.0 38.0 38.0 35.6 38.0 75-79 36.046299999999995 38.0 38.0 38.0 34.4 38.0 80-84 35.9455 38.0 38.0 38.0 34.4 38.0 85-89 35.49165000000001 38.0 38.0 38.0 32.8 38.0 90-94 35.22345 38.0 38.0 38.0 31.2 38.0 95-99 35.533500000000004 38.0 38.0 38.0 32.0 38.0 100-104 35.52685 38.0 38.0 38.0 32.8 38.0 105-109 35.3769 38.0 38.0 38.0 31.4 38.0 110-114 35.18515 38.0 38.0 38.0 30.2 38.0 115-119 34.925200000000004 38.0 37.2 38.0 28.4 38.0 120-124 34.8432 38.0 37.0 38.0 28.0 38.0 125-129 34.2599 38.0 36.0 38.0 24.0 38.0 130-134 33.2837 38.0 35.4 38.0 14.2 38.0 135-139 32.139300000000006 38.0 33.4 38.0 6.4 38.0 140-144 31.406599999999997 38.0 33.0 38.0 2.0 38.0 145-149 30.625700000000002 38.0 31.4 38.0 2.0 38.0 150-151 26.036250000000003 34.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 80.0 3 10.0 4 0.0 5 0.0 6 0.0 7 3.0 8 0.0 9 1.0 10 1.0 11 2.0 12 10.0 13 3.0 14 4.0 15 2.0 16 11.0 17 7.0 18 5.0 19 9.0 20 13.0 21 13.0 22 12.0 23 11.0 24 18.0 25 25.0 26 25.0 27 32.0 28 28.0 29 29.0 30 68.0 31 73.0 32 84.0 33 136.0 34 112.0 35 213.0 36 519.0 37 2441.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.44059532974082 21.144470105209134 12.830382345393893 26.584552219656143 2 25.811359026369168 27.789046653144016 29.132860040567955 17.266734279918865 3 20.0101962783584 26.969156257965842 32.067295437165434 20.953352026510323 4 24.375804375804375 32.277992277992276 23.552123552123554 19.794079794079796 5 25.27727624451896 36.136187774052104 21.408305390766056 17.17823059066288 6 20.101910828025478 38.70063694267516 22.980891719745223 18.21656050955414 7 19.98983997967996 22.199644399288797 37.92227584455169 19.88823977647955 8 21.86389029964449 25.977653631284912 27.450482478415438 24.707973590655154 9 21.894843789687577 25.323850647701295 29.464058928117858 23.31724663449327 10-14 23.050622576035927 29.19473361910594 27.00551132884262 20.749132476015514 15-19 23.18692019886218 27.48193326841269 27.912459638152836 21.418686894572293 20-24 23.25355921824769 27.136806654079702 27.846098892687653 21.763535234984946 25-29 22.591006423982872 28.061588661160396 27.806668706026304 21.540736208830428 30-34 22.84548699643039 27.776644569097396 27.98062213156553 21.39724630290668 35-39 22.86459132034964 28.083627255533404 27.863824566784235 21.187956857332722 40-44 23.32374987165007 27.790327549029676 28.3242632713831 20.56165930793716 45-49 22.810350138617927 27.261525824006572 28.55015915391724 21.37796488345826 50-54 23.409785932721714 27.44648318042813 28.063200815494394 21.08053007135576 55-59 23.362244897959183 28.224489795918366 27.586734693877553 20.8265306122449 60-64 22.857434536266652 27.926088510030116 28.620284824664388 20.596192129038844 65-69 23.148384462253073 28.15068143535297 28.165994589352255 20.534939513041703 70-74 23.72234935163997 27.44469870327994 28.166793796084416 20.666158148995677 75-79 23.371939449354873 27.415422127400184 28.588844864370618 20.623793558874326 80-84 23.58034122740005 27.797300738477208 28.174178762414055 20.448179271708682 85-89 23.552760451569668 28.0426826125058 27.960204134233724 20.44435280169081 90-94 23.69117418149743 28.002905619260105 28.127432158978884 20.17848804026358 95-99 23.185370587934823 28.1197323389692 27.85922255708229 20.83567451601369 100-104 24.092459650730614 27.814266076065376 27.27967007789827 20.81360419530574 105-109 24.07955124936257 27.756246812850588 27.307496175420702 20.85670576236614 110-114 24.423539035738024 28.237639961143206 27.23043100363004 20.108389999488725 115-119 24.167857872166632 28.308147845619768 27.353481723504185 20.170512558709415 120-124 24.031440162271807 27.692697768762674 27.494929006085194 20.780933062880326 125-129 24.6 28.13846153846154 26.74871794871795 20.51282051282051 130-134 25.246279605952633 27.59903584154265 27.520435967302454 19.634248585202265 135-139 25.1624241133241 27.6866545958036 26.999680477154115 20.15124081371818 140-144 25.32292787944026 27.502691065662 27.400430570505918 19.77395048439182 145-149 25.757813727029998 27.825768284383017 26.98811580545521 19.428302183131773 150-151 25.87646076794658 27.27622961345833 27.160652369333505 19.68665724926159 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 56.0 1 28.5 2 1.5 3 2.5 4 3.0 5 3.0 6 2.0 7 2.5 8 2.5 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 2.0 26 5.0 27 7.0 28 7.0 29 10.0 30 13.0 31 16.0 32 29.0 33 33.0 34 37.5 35 58.5 36 81.5 37 106.5 38 141.5 39 168.0 40 195.0 41 233.5 42 256.0 43 264.0 44 271.5 45 286.0 46 273.0 47 260.5 48 228.5 49 192.0 50 163.5 51 128.5 52 112.5 53 88.0 54 70.5 55 51.5 56 33.5 57 30.0 58 22.5 59 11.0 60 5.5 61 6.0 62 5.5 63 3.0 64 3.0 65 0.5 66 0.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.5749999999999997 2 1.4000000000000001 3 1.925 4 2.875 5 3.075 6 1.875 7 1.575 8 1.55 9 1.575 10-14 2.02 15-19 2.445 20-24 2.015 25-29 1.9300000000000002 30-34 1.95 35-39 2.185 40-44 2.6100000000000003 45-49 2.6100000000000003 50-54 1.9 55-59 2.0 60-64 2.045 65-69 2.045 70-74 1.675 75-79 1.5699999999999998 80-84 1.825 85-89 3.005 90-94 3.6350000000000002 95-99 2.1149999999999998 100-104 1.7950000000000002 105-109 1.95 110-114 2.205 115-119 2.06 120-124 1.4000000000000001 125-129 2.5 130-134 4.58 135-139 6.11 140-144 7.1 145-149 4.495 150-151 2.6625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59277169763298 97.82499999999999 2 0.3563247645711377 0.7000000000000001 3 0.025451768897938407 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025451768897938407 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 56 1.4000000000000001 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0125 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0125 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.037500000000000006 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.07500000000000001 0.0 0.0 0.025 0.0 82-83 0.175 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.2875 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.4125 0.0 0.0 0.025 0.0 92-93 0.44999999999999996 0.0 0.0 0.025 0.0 94-95 0.55 0.0 0.0 0.025 0.0 96-97 0.625 0.0 0.0 0.025 0.0 98-99 0.7749999999999999 0.0 0.0 0.025 0.0 100-101 0.9625 0.0 0.0 0.025 0.0 102-103 1.25 0.0 0.0 0.025 0.0 104-105 1.5125000000000002 0.0 0.0 0.025 0.0 106-107 1.7875 0.0 0.0 0.025 0.0 108-109 2.1375 0.0 0.0 0.025 0.0 110-111 2.425 0.0 0.0 0.025 0.0 112-113 2.7 0.0 0.0 0.025 0.0 114-115 3.025 0.0 0.0 0.025 0.0 116-117 3.4625 0.0 0.0 0.025 0.0 118-119 3.8125 0.0 0.0 0.025 0.0 120-121 4.15 0.0 0.0 0.025 0.0 122-123 4.7 0.0 0.0 0.025 0.0 124-125 5.125 0.0 0.0 0.025 0.0 126-127 5.6375 0.0 0.0 0.025 0.0 128-129 6.0625 0.0 0.0 0.025 0.0 130-131 6.7375 0.0 0.0 0.025 0.0 132-133 7.325 0.0 0.0 0.025 0.0 134-135 7.7625 0.0 0.0 0.025 0.0 136-137 8.2125 0.0 0.0 0.025 0.0 138-139 8.662500000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGACCA 10 0.006721254 145.71428 3 >>END_MODULE Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685786 spots for SRR7169964.sra Written 685786 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra Read 685785 spots for SRR7169964.sra Written 685785 spots for SRR7169964.sra SRR ids: ['SRR7169964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wi0_9bek SRR7169964.sra spots: 13715701 blocks: [[1, 685785], [685786, 1371570], [1371571, 2057355], [2057356, 2743140], [2743141, 3428925], [3428926, 4114710], [4114711, 4800495], [4800496, 5486280], [5486281, 6172065], [6172066, 6857850], [6857851, 7543635], [7543636, 8229420], [8229421, 8915205], [8915206, 9600990], [9600991, 10286775], [10286776, 10972560], [10972561, 11658345], [11658346, 12344130], [12344131, 13029915], [13029916, 13715701]] SRR7169964 file size 4626100 SRR7169964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169964 SRR7169964_1.fastq SRR7169964_2.fastq Input file: SRR7169964_1.fastq Paired file: SRR7169964_2.fastq trimmed: SRR7169964-trimmed-pair1.fastq, SRR7169964-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:38:32 2025 >> started Wed Feb 12 05:38:46 2025 >> done (14.450s) 13715701 read pairs processed; of these: 15120 ( 0.11%) short read pairs filtered out after trimming by size control 24767 ( 0.18%) empty read pairs filtered out after trimming by size control 13675814 (99.71%) read pairs available; of these: 6559760 (47.97%) trimmed read pairs available after processing 7116054 (52.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 5 0.00% 24 1 0.00% 25 5 0.00% 26 2 0.00% 27 2 0.00% 28 10 0.00% 29 5 0.00% 30 6 0.00% 31 11 0.00% 32 6 0.00% 33 12 0.00% 34 15 0.00% 35 14 0.00% 36 22 0.00% 37 22 0.00% 38 20 0.00% 39 25 0.00% 40 26 0.00% 41 25 0.00% 42 27 0.00% 43 28 0.00% 44 42 0.00% 45 47 0.00% 46 42 0.00% 47 61 0.00% 48 64 0.00% 49 63 0.00% 50 71 0.00% 51 89 0.00% 52 129 0.00% 53 139 0.00% 54 150 0.00% 55 153 0.00% 56 161 0.00% 57 191 0.00% 58 223 0.00% 59 259 0.00% 60 329 0.00% 61 318 0.00% 62 365 0.00% 63 435 0.00% 64 500 0.00% 65 552 0.00% 66 597 0.00% 67 659 0.00% 68 811 0.01% 69 922 0.01% 70 1164 0.01% 71 1228 0.01% 72 1304 0.01% 73 1442 0.01% 74 1608 0.01% 75 1842 0.01% 76 2092 0.02% 77 2277 0.02% 78 2467 0.02% 79 2797 0.02% 80 3103 0.02% 81 3538 0.03% 82 3973 0.03% 83 4594 0.03% 84 5400 0.04% 85 6587 0.05% 86 6859 0.05% 87 7280 0.05% 88 7793 0.06% 89 8277 0.06% 90 8774 0.06% 91 9379 0.07% 92 10035 0.07% 93 10876 0.08% 94 11683 0.09% 95 12678 0.09% 96 13163 0.10% 97 14024 0.10% 98 14459 0.11% 99 15119 0.11% 100 15898 0.12% 101 16709 0.12% 102 17627 0.13% 103 18616 0.14% 104 19425 0.14% 105 20461 0.15% 106 21674 0.16% 107 22257 0.16% 108 23147 0.17% 109 23504 0.17% 110 24274 0.18% 111 25092 0.18% 112 26030 0.19% 113 27636 0.20% 114 28577 0.21% 115 29584 0.22% 116 30613 0.22% 117 31563 0.23% 118 32313 0.24% 119 33080 0.24% 120 33901 0.25% 121 34894 0.26% 122 36335 0.27% 123 37411 0.27% 124 38862 0.28% 125 40219 0.29% 126 42193 0.31% 127 43823 0.32% 128 45003 0.33% 129 46152 0.34% 130 48216 0.35% 131 49801 0.36% 132 51355 0.38% 133 54225 0.40% 134 56113 0.41% 135 59283 0.43% 136 62599 0.46% 137 66323 0.48% 138 72143 0.53% 139 77332 0.57% 140 82763 0.61% 141 88881 0.65% 142 94464 0.69% 143 102767 0.75% 144 113528 0.83% 145 128401 0.94% 146 154718 1.13% 147 199429 1.46% 148 280903 2.05% 149 538400 3.94% 150 3087746 22.58% 151 7116054 52.03% 13675814 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=30 prefix-density=0.20 prefix-fanout=2.7 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=236.46 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=27.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=28 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=9 fanout-score=57.76 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=15.2 sequence=TGTTGGTGGTGGTACTGGA SRR7169964 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:39:31 Started mapping on | Feb 12 05:39:31 Finished on | Feb 12 05:40:48 Mapping speed, Million of reads per hour | 639.39 Number of input reads | 13675814 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12963346 Uniquely mapped reads % | 94.79% Average mapped length | 292.14 Number of splices: Total | 12277671 Number of splices: Annotated (sjdb) | 12069959 Number of splices: GT/AG | 12097672 Number of splices: GC/AG | 144203 Number of splices: AT/AC | 9757 Number of splices: Non-canonical | 26039 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251490 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 70893 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474088 474088 474088 N_multimapping 251490 251490 251490 N_noFeature 318723 12810200 400011 N_ambiguous 126291 991 53673 UnstrandedReadsAssigned:12518332 PositiveStrandReadsAssigned:152155 NegativeStrandReadsAssigned:12509662 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169964 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169964-trimmed-pair1.fastq SRR7169964-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,675,814 reads, 12,460,401 reads pseudoaligned [quant] estimated average fragment length: 228.611 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7169964.ke.tsv 34699 SRR7169964.se.tsv 87100 total ==> SRR7169964.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.39 272 13.0953 Potri.005G024800.1.v4.1 1035 807.389 15 1.60142 Potri.004G059700.1.v4.1 961 733.441 3 0.352575 Potri.007G009000.2.v4.1 1416 1188.39 0 0 Potri.003G141000.2.v4.1 2943 2715.39 191 6.06313 Potri.016G087400.1.v4.1 270 86.5705 669.438 666.554 Potri.015G069301.1.v4.1 564 341.467 0 0 Potri.010G195200.1.v4.1 1773 1545.39 42 2.34265 Potri.012G127500.1.v4.1 977 749.412 4111 472.849 ==> SRR7169964.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1211 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169964 completed mapping pipeline successfully