Starting /dee2/code/volunteer_pipeline.sh SRR7169965 current disk space = 3048859394048 free memory = 1483898152 SRR7169965 SRAfilesize 862681c1ce94c772718f3e80dcaa6724 SRR7169965.sra SRR7169965.sra file validated SRR7169965 is paired end SRR7169965 is conventional basespace SRR7169965 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.116 34.0 33.0 34.0 33.0 34.0 2 33.419 34.0 34.0 34.0 33.0 34.0 3 33.505 34.0 34.0 34.0 33.0 34.0 4 33.4985 34.0 34.0 34.0 33.0 34.0 5 33.50125 34.0 34.0 34.0 33.0 34.0 6 37.26425 38.0 38.0 38.0 36.0 38.0 7 37.45675 38.0 38.0 38.0 37.0 38.0 8 37.544 38.0 38.0 38.0 37.0 38.0 9 37.53225 38.0 38.0 38.0 38.0 38.0 10-14 37.512899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.524249999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.4598 38.0 38.0 38.0 38.0 38.0 25-29 37.47935 38.0 38.0 38.0 38.0 38.0 30-34 37.475049999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.4207 38.0 38.0 38.0 37.4 38.0 40-44 37.2907 38.0 38.0 38.0 37.0 38.0 45-49 37.162549999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.237449999999995 38.0 38.0 38.0 36.6 38.0 55-59 37.1186 38.0 38.0 38.0 36.0 38.0 60-64 37.117399999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.046949999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.07495 38.0 38.0 38.0 36.0 38.0 75-79 36.9923 38.0 38.0 38.0 36.0 38.0 80-84 36.8738 38.0 38.0 38.0 35.4 38.0 85-89 36.79575 38.0 38.0 38.0 35.2 38.0 90-94 36.6335 38.0 38.0 38.0 34.8 38.0 95-99 36.429050000000004 38.0 38.0 38.0 34.2 38.0 100-104 36.3497 38.0 38.0 38.0 34.0 38.0 105-109 36.36155 38.0 38.0 38.0 34.0 38.0 110-114 36.17215 38.0 37.8 38.0 33.6 38.0 115-119 36.03125 38.0 37.2 38.0 33.2 38.0 120-124 35.908049999999996 38.0 37.0 38.0 32.6 38.0 125-129 35.686099999999996 38.0 36.6 38.0 31.6 38.0 130-134 35.14125 38.0 36.0 38.0 29.0 38.0 135-139 34.688500000000005 38.0 35.4 38.0 27.2 38.0 140-144 34.529650000000004 38.0 35.0 38.0 26.8 38.0 145-149 33.5947 38.0 34.8 38.0 20.6 38.0 150-151 29.892875 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 3.0 19 2.0 20 4.0 21 6.0 22 5.0 23 9.0 24 10.0 25 16.0 26 15.0 27 24.0 28 19.0 29 36.0 30 46.0 31 54.0 32 76.0 33 100.0 34 138.0 35 226.0 36 568.0 37 2634.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.16755117513268 13.115996967399546 9.249431387414708 36.46702047005307 2 21.775 15.675 34.4 28.15 3 19.45 22.2 25.900000000000002 32.45 4 21.6 28.9 23.275000000000002 26.224999999999998 5 21.7 32.65 24.3 21.349999999999998 6 19.15 34.699999999999996 25.15 21.0 7 14.374999999999998 26.150000000000002 39.6 19.875 8 18.275 24.3 30.3 27.125 9 17.125 25.2 32.074999999999996 25.6 10-14 20.31 28.895 26.540000000000003 24.255 15-19 19.955000000000002 28.425 28.07 23.549999999999997 20-24 20.175 28.025 27.605 24.195 25-29 20.1 28.810000000000002 27.11 23.98 30-34 19.794999999999998 28.050000000000004 27.66 24.495 35-39 19.71 28.51 27.529999999999998 24.25 40-44 19.695 28.255000000000003 27.96 24.09 45-49 20.302332565822404 28.721593753128445 26.769446391030133 24.20662729001902 50-54 20.035 28.42 27.46 24.085 55-59 20.435 28.134999999999998 27.644999999999996 23.785 60-64 20.11 28.244999999999997 27.42 24.224999999999998 65-69 20.23 28.084999999999997 27.37 24.315 70-74 20.125 28.410000000000004 27.145000000000003 24.32 75-79 20.28 28.455000000000002 26.87 24.395 80-84 20.175 27.944999999999997 27.105 24.775 85-89 21.08843537414966 27.546018407362943 27.03581432573029 24.329731892757103 90-94 19.93778848083484 28.13566124824403 27.428256070640177 24.498294200280952 95-99 20.468395870057922 27.33316544950894 27.398640141022412 24.799798539410727 100-104 20.8448163551636 28.471213108182592 27.053164303251993 23.630806233401813 105-109 20.522052205220522 27.952795279527955 27.29272927292729 24.232423242324234 110-114 20.54376126577208 27.853995593831364 27.23813338674144 24.364109753655118 115-119 20.845 27.735 26.985 24.435000000000002 120-124 20.76 27.810000000000002 26.775 24.654999999999998 125-129 20.849999999999998 27.51 27.165 24.474999999999998 130-134 20.149553347385325 27.898223426678708 27.451570812004416 24.500652413931547 135-139 20.789433886172304 27.887281342945002 26.808489186873015 24.51479558400968 140-144 20.735869892581064 28.45095873908242 26.503363116152993 24.309808252183515 145-149 21.20725960092249 27.980547478191113 26.68204151208262 24.130151408803773 150-151 20.983483483483482 28.403403403403406 26.564064064064063 24.04904904904905 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 0.5 22 1.5 23 2.5 24 2.5 25 2.5 26 4.0 27 4.5 28 8.0 29 10.5 30 12.5 31 16.5 32 20.5 33 30.5 34 51.0 35 65.5 36 73.5 37 92.5 38 111.5 39 146.5 40 192.5 41 206.5 42 219.5 43 243.5 44 261.0 45 278.0 46 259.5 47 252.5 48 268.0 49 233.5 50 192.5 51 159.5 52 142.0 53 118.5 54 82.0 55 63.0 56 40.0 57 29.0 58 25.0 59 17.5 60 14.0 61 13.0 62 7.5 63 4.5 64 3.0 65 2.5 66 4.5 67 3.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.11 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.04 90-94 0.33999999999999997 95-99 0.7250000000000001 100-104 0.215 105-109 0.01 110-114 0.13999999999999999 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.37 135-139 0.815 140-144 0.38999999999999996 145-149 0.27 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 2.925 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.45 0.0 0.0 0.0 0.0 120-121 3.675 0.0 0.0 0.0 0.0 122-123 3.975 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.675 0.0125 0.0 0.0 0.0 128-129 4.9625 0.025 0.0 0.0 0.0 130-131 5.3875 0.025 0.0 0.0 0.0 132-133 5.9625 0.025 0.0 0.0 0.0 134-135 6.512499999999999 0.025 0.0 0.0 0.0 136-137 7.1125 0.025 0.0 0.0 0.0 138-139 7.9625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTGCA 10 0.00687326 144.7 2 >>END_MODULE SRR7169965 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169965_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08575 33.0 33.0 34.0 32.0 34.0 2 32.142 33.0 33.0 34.0 31.0 34.0 3 32.07975 34.0 33.0 34.0 31.0 34.0 4 31.84375 34.0 33.0 34.0 31.0 34.0 5 31.7695 34.0 33.0 34.0 31.0 34.0 6 35.89325 38.0 38.0 38.0 35.0 38.0 7 35.86725 38.0 38.0 38.0 35.0 38.0 8 35.86375 38.0 38.0 38.0 35.0 38.0 9 35.864 38.0 38.0 38.0 35.0 38.0 10-14 35.8487 38.0 38.0 38.0 34.6 38.0 15-19 35.638149999999996 38.0 38.0 38.0 34.0 38.0 20-24 35.7784 38.0 38.0 38.0 35.0 38.0 25-29 35.8798 38.0 38.0 38.0 35.0 38.0 30-34 35.87655 38.0 38.0 38.0 35.0 38.0 35-39 35.82745 38.0 38.0 38.0 34.8 38.0 40-44 35.6825 38.0 38.0 38.0 34.6 38.0 45-49 35.5664 38.0 38.0 38.0 34.0 38.0 50-54 35.78315 38.0 38.0 38.0 34.8 38.0 55-59 35.74065 38.0 38.0 38.0 34.6 38.0 60-64 35.682900000000004 38.0 38.0 38.0 34.0 38.0 65-69 35.639300000000006 38.0 38.0 38.0 34.0 38.0 70-74 35.64765 38.0 38.0 38.0 34.0 38.0 75-79 35.5843 38.0 38.0 38.0 33.8 38.0 80-84 35.4301 38.0 38.0 38.0 33.2 38.0 85-89 35.11035 38.0 38.0 38.0 31.0 38.0 90-94 34.72825 38.0 38.0 38.0 28.2 38.0 95-99 35.0212 38.0 38.0 38.0 28.8 38.0 100-104 35.1638 38.0 38.0 38.0 30.8 38.0 105-109 34.981100000000005 38.0 38.0 38.0 29.8 38.0 110-114 34.864549999999994 38.0 37.8 38.0 29.0 38.0 115-119 34.5916 38.0 37.0 38.0 27.0 38.0 120-124 34.4095 38.0 36.8 38.0 25.6 38.0 125-129 34.01215 38.0 36.0 38.0 21.6 38.0 130-134 33.056799999999996 38.0 35.4 38.0 11.6 38.0 135-139 31.844300000000004 38.0 34.0 38.0 2.0 38.0 140-144 31.099700000000002 38.0 33.2 38.0 2.0 38.0 145-149 30.602600000000002 38.0 32.2 38.0 2.0 38.0 150-151 26.744625 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 139.0 3 6.0 4 1.0 5 1.0 6 2.0 7 3.0 8 1.0 9 2.0 10 0.0 11 5.0 12 2.0 13 3.0 14 2.0 15 2.0 16 4.0 17 4.0 18 9.0 19 11.0 20 7.0 21 11.0 22 12.0 23 17.0 24 18.0 25 13.0 26 26.0 27 32.0 28 31.0 29 47.0 30 49.0 31 64.0 32 97.0 33 144.0 34 153.0 35 178.0 36 430.0 37 2474.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.34862855678031 20.123045372981288 13.30428095360164 26.224045116636756 2 25.958099131323454 27.43995912110373 30.45477772100153 16.147164026571282 3 21.356977640709328 29.70958622462092 29.812387561038296 19.12104857363146 4 23.015049299429162 35.57343020238713 22.80747275557862 18.604047742605083 5 23.2908760072784 36.054068105016896 22.043150506888484 18.61190538081622 6 21.54324184360435 37.0792335577421 23.718280683583632 17.65924391506991 7 20.367494824016564 22.127329192546583 37.34472049689441 20.160455486542443 8 22.285272117616714 25.689966468919266 25.689966468919266 26.334794944544754 9 21.98030067392431 25.920165889061693 28.175220321410055 23.92431311560394 10-14 23.304996889902547 28.65954799917064 26.135185569147833 21.900269541778975 15-19 23.170795306388527 27.801825293350717 27.53063885267275 21.496740547588004 20-24 23.247978436657682 27.88720713249015 27.607298362015342 21.257516068836825 25-29 23.477315102548165 27.729438574684067 27.517091361093847 21.276154961673917 30-34 23.15424071291643 27.806849386042177 28.10735195067613 20.931557950365264 35-39 23.5577920730442 27.86366466071799 27.11143390744968 21.467109358788132 40-44 23.716814159292035 28.21447162935971 27.636647579385738 20.43206663196252 45-49 23.642139249075665 27.48008123730667 27.53215643389054 21.345623079727126 50-54 23.725307684352053 27.795014996380186 27.417519908987487 21.062157410280278 55-59 24.15221330572094 27.79187160238157 27.32073517991199 20.735179911985504 60-64 23.903599503516755 27.642738932561027 27.808233347124535 20.645428216797683 65-69 23.84766432410087 27.630219098801156 27.59921455146755 20.922902025630428 70-74 24.193796462445526 27.603178672135346 27.244296334273265 20.95872853114586 75-79 23.719952847111887 27.845830557121626 27.55368766336938 20.88052893239711 80-84 24.12260298754329 27.39959683671887 27.64769731741355 20.830102858324288 85-89 24.106348458680067 27.304129376668236 27.95833987543832 20.631182289213378 90-94 24.16188621651492 27.998526393347717 27.730119467396452 20.109467922740908 95-99 23.754213119004408 27.814363494944256 28.54031630801141 19.891107078039926 100-104 24.492641363284275 27.869868319132458 27.012651691195455 20.624838626387813 105-109 24.064282011404874 28.60031104199067 27.273198548470713 20.06220839813375 110-114 25.177617590623864 27.656484986775915 27.355701913602655 19.810195508997563 115-119 24.69370946154638 27.60218264182024 27.061669926902088 20.64243796973129 120-124 25.120008170769076 27.6989071596364 27.0094985190481 20.17158615054642 125-129 24.724761113419195 27.259036144578314 27.664104694640628 20.35209804736186 130-134 25.277244615056517 27.43655363616976 26.86606952441885 20.420132224354873 135-139 25.194307608100715 28.204707170224413 26.47509578544061 20.125889436234264 140-144 25.42325685007797 27.483849409668075 27.372466028068608 19.720427712185344 145-149 25.91484587851915 27.34120412415193 26.662749078476416 20.081200918852502 150-151 26.657997399219767 26.84005201560468 26.514954486345903 19.98699609882965 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 91.0 1 47.5 2 3.0 3 2.0 4 4.0 5 5.0 6 5.0 7 4.0 8 3.0 9 3.0 10 3.0 11 2.5 12 1.0 13 2.0 14 2.0 15 1.0 16 1.5 17 1.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 0.5 25 1.0 26 3.5 27 5.5 28 6.5 29 8.0 30 8.0 31 10.5 32 20.0 33 26.5 34 30.0 35 44.5 36 62.0 37 83.5 38 118.5 39 149.0 40 183.5 41 235.0 42 257.0 43 261.0 44 289.5 45 287.5 46 265.5 47 249.5 48 234.5 49 211.0 50 176.0 51 150.5 52 120.0 53 96.5 54 72.5 55 51.0 56 36.0 57 26.0 58 22.5 59 13.5 60 8.5 61 6.5 62 5.5 63 4.5 64 4.5 65 3.0 66 1.0 67 1.5 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.475 2 2.15 3 2.725 4 3.65 5 3.8249999999999997 6 3.45 7 3.4000000000000004 8 3.075 9 3.55 10-14 3.54 15-19 4.125 20-24 3.54 25-29 3.46 30-34 3.495 35-39 3.62 40-44 3.95 45-49 3.9849999999999994 50-54 3.3099999999999996 55-59 3.4250000000000003 60-64 3.32 65-69 3.2399999999999998 70-74 2.475 75-79 2.445 80-84 3.2649999999999997 85-89 4.465 90-94 4.995 95-99 3.5749999999999997 100-104 3.175 105-109 3.55 110-114 3.585 115-119 2.87 120-124 2.09 125-129 3.7199999999999998 130-134 6.22 135-139 8.649999999999999 140-144 10.22 145-149 6.404999999999999 150-151 3.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 99.30394431554525 96.3 2 0.48981696313482853 0.95 3 0.1288992008249549 0.375 4 0.025779840164990978 0.1 5 0.025779840164990978 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025779840164990978 2.15 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 86 2.15 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7749999999999999 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0374999999999996 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.4749999999999996 0.0 0.0 0.0 0.0 114-115 2.8 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.137499999999999 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.525 0.0 0.0 0.0 0.0 138-139 7.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850347 spots for SRR7169965.sra Written 850347 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra Read 850335 spots for SRR7169965.sra Written 850335 spots for SRR7169965.sra SRR ids: ['SRR7169965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xajem08r SRR7169965.sra spots: 17006712 blocks: [[1, 850335], [850336, 1700670], [1700671, 2551005], [2551006, 3401340], [3401341, 4251675], [4251676, 5102010], [5102011, 5952345], [5952346, 6802680], [6802681, 7653015], [7653016, 8503350], [8503351, 9353685], [9353686, 10204020], [10204021, 11054355], [11054356, 11904690], [11904691, 12755025], [12755026, 13605360], [13605361, 14455695], [14455696, 15306030], [15306031, 16156365], [16156366, 17006712]] SRR7169965 file size 5741316 SRR7169965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169965 SRR7169965_1.fastq SRR7169965_2.fastq Input file: SRR7169965_1.fastq Paired file: SRR7169965_2.fastq trimmed: SRR7169965-trimmed-pair1.fastq, SRR7169965-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:33:10 2025 >> started Wed Feb 12 05:33:28 2025 >> done (18.126s) 17006712 read pairs processed; of these: 18745 ( 0.11%) short read pairs filtered out after trimming by size control 28438 ( 0.17%) empty read pairs filtered out after trimming by size control 16959529 (99.72%) read pairs available; of these: 8096005 (47.74%) trimmed read pairs available after processing 8863524 (52.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 1 0.00% 23 8 0.00% 24 5 0.00% 25 10 0.00% 26 5 0.00% 27 9 0.00% 28 12 0.00% 29 12 0.00% 30 11 0.00% 31 9 0.00% 32 11 0.00% 33 13 0.00% 34 20 0.00% 35 14 0.00% 36 30 0.00% 37 17 0.00% 38 24 0.00% 39 32 0.00% 40 32 0.00% 41 34 0.00% 42 47 0.00% 43 47 0.00% 44 48 0.00% 45 63 0.00% 46 55 0.00% 47 74 0.00% 48 90 0.00% 49 96 0.00% 50 110 0.00% 51 100 0.00% 52 143 0.00% 53 158 0.00% 54 164 0.00% 55 167 0.00% 56 204 0.00% 57 208 0.00% 58 230 0.00% 59 274 0.00% 60 297 0.00% 61 415 0.00% 62 446 0.00% 63 494 0.00% 64 601 0.00% 65 611 0.00% 66 667 0.00% 67 781 0.00% 68 866 0.01% 69 1068 0.01% 70 1306 0.01% 71 1446 0.01% 72 1612 0.01% 73 1768 0.01% 74 1959 0.01% 75 2114 0.01% 76 2232 0.01% 77 2495 0.01% 78 2705 0.02% 79 3008 0.02% 80 3426 0.02% 81 3947 0.02% 82 4615 0.03% 83 5205 0.03% 84 6465 0.04% 85 7725 0.05% 86 7901 0.05% 87 8284 0.05% 88 8730 0.05% 89 9248 0.05% 90 9952 0.06% 91 10932 0.06% 92 11693 0.07% 93 12578 0.07% 94 13898 0.08% 95 14775 0.09% 96 15179 0.09% 97 15980 0.09% 98 16265 0.10% 99 16951 0.10% 100 18088 0.11% 101 18909 0.11% 102 20409 0.12% 103 21795 0.13% 104 23419 0.14% 105 24649 0.15% 106 25023 0.15% 107 25773 0.15% 108 26176 0.15% 109 26762 0.16% 110 27828 0.16% 111 28869 0.17% 112 30504 0.18% 113 32373 0.19% 114 33910 0.20% 115 35656 0.21% 116 36720 0.22% 117 37699 0.22% 118 37722 0.22% 119 38322 0.23% 120 39271 0.23% 121 40730 0.24% 122 42289 0.25% 123 44421 0.26% 124 46372 0.27% 125 48300 0.28% 126 50425 0.30% 127 51962 0.31% 128 52961 0.31% 129 54476 0.32% 130 56042 0.33% 131 57639 0.34% 132 60588 0.36% 133 64619 0.38% 134 67941 0.40% 135 72203 0.43% 136 76736 0.45% 137 81388 0.48% 138 87437 0.52% 139 94673 0.56% 140 100643 0.59% 141 108728 0.64% 142 118031 0.70% 143 128472 0.76% 144 145045 0.86% 145 166679 0.98% 146 201558 1.19% 147 264252 1.56% 148 374737 2.21% 149 702588 4.14% 150 3790953 22.35% 151 8863524 52.26% 16959529 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=40 prefix-density=0.16 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.02 sequence-density-rank=42 fanout-score=289.80 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=21.9 sequence=CTTCTTTCTTCCCCAGGAAATCAAACAACCCGCGATCCTTGGTCTCAACAGCACCACTCTCTTCACCAACTTTGGTCTCATACTCATGGCTCTTGTTTTCCTCAGCCATACTGATCAAAATCACAA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=33 prefix-density=0.40 prefix-fanout=3.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=283.19 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=29.6 sequence=AAGAAGAAGAAA SRR7169965 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:34:10 Started mapping on | Feb 12 05:34:10 Finished on | Feb 12 05:35:52 Mapping speed, Million of reads per hour | 598.57 Number of input reads | 16959529 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15960253 Uniquely mapped reads % | 94.11% Average mapped length | 292.57 Number of splices: Total | 15635017 Number of splices: Annotated (sjdb) | 15387546 Number of splices: GT/AG | 15402704 Number of splices: GC/AG | 190395 Number of splices: AT/AC | 11948 Number of splices: Non-canonical | 29970 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307338 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 65012 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.64% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 709944 709944 709944 N_multimapping 307338 307338 307338 N_noFeature 315043 15799628 392841 N_ambiguous 145799 743 62521 UnstrandedReadsAssigned:15499411 PositiveStrandReadsAssigned:159882 NegativeStrandReadsAssigned:15504891 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169965 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169965-trimmed-pair1.fastq SRR7169965-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,959,529 reads, 15,455,199 reads pseudoaligned [quant] estimated average fragment length: 236.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169965.ke.tsv 34699 SRR7169965.se.tsv 87100 total ==> SRR7169965.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.81 281 10.3418 Potri.005G024800.1.v4.1 1035 799.806 49 4.01981 Potri.004G059700.1.v4.1 961 725.872 5 0.451964 Potri.007G009000.2.v4.1 1416 1180.81 0 0 Potri.003G141000.2.v4.1 2943 2707.81 312.146 7.5637 Potri.016G087400.1.v4.1 270 85.2769 1433 1102.58 Potri.015G069301.1.v4.1 564 335.214 0 0 Potri.010G195200.1.v4.1 1773 1537.81 13 0.554671 Potri.012G127500.1.v4.1 977 741.834 9214 814.959 ==> SRR7169965.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 800 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169965 completed mapping pipeline successfully