Starting /dee2/code/volunteer_pipeline.sh SRR7169966 current disk space = 3049603416064 free memory = 1028224152 SRR7169966 SRAfilesize 79e08ccfa5ad1862fa144f5133680adc SRR7169966.sra SRR7169966.sra file validated SRR7169966 is paired end SRR7169966 is conventional basespace SRR7169966 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169966_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3235 34.0 34.0 34.0 33.0 34.0 2 33.55225 34.0 34.0 34.0 33.0 34.0 3 33.6035 34.0 34.0 34.0 33.0 34.0 4 33.60675 34.0 34.0 34.0 33.0 34.0 5 33.62725 34.0 34.0 34.0 33.0 34.0 6 37.30925 38.0 38.0 38.0 36.0 38.0 7 37.56325 38.0 38.0 38.0 37.0 38.0 8 37.67125 38.0 38.0 38.0 38.0 38.0 9 37.67175 38.0 38.0 38.0 38.0 38.0 10-14 37.6451 38.0 38.0 38.0 38.0 38.0 15-19 37.6277 38.0 38.0 38.0 38.0 38.0 20-24 37.59275 38.0 38.0 38.0 38.0 38.0 25-29 37.5746 38.0 38.0 38.0 38.0 38.0 30-34 37.53359999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.498850000000004 38.0 38.0 38.0 37.8 38.0 40-44 37.32135 38.0 38.0 38.0 37.0 38.0 45-49 37.30755 38.0 38.0 38.0 37.0 38.0 50-54 37.29425 38.0 38.0 38.0 37.0 38.0 55-59 37.21425 38.0 38.0 38.0 37.0 38.0 60-64 37.20775 38.0 38.0 38.0 37.0 38.0 65-69 37.1222 38.0 38.0 38.0 36.6 38.0 70-74 37.0296 38.0 38.0 38.0 36.6 38.0 75-79 36.50869999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.44485 38.0 38.0 38.0 35.6 38.0 85-89 36.4099 38.0 38.0 38.0 35.4 38.0 90-94 36.28855 38.0 38.0 38.0 35.0 38.0 95-99 36.15220000000001 38.0 38.0 38.0 34.4 38.0 100-104 36.10295 38.0 38.0 38.0 34.0 38.0 105-109 36.02145 38.0 38.0 38.0 34.0 38.0 110-114 35.9255 38.0 38.0 38.0 34.0 38.0 115-119 35.63905 38.0 38.0 38.0 32.6 38.0 120-124 35.4508 38.0 37.6 38.0 31.8 38.0 125-129 35.18465 38.0 36.8 38.0 30.6 38.0 130-134 34.870799999999996 38.0 36.2 38.0 28.8 38.0 135-139 34.5863 38.0 36.0 38.0 27.4 38.0 140-144 34.31215 38.0 35.4 38.0 25.6 38.0 145-149 33.81045 38.0 35.0 38.0 22.6 38.0 150-151 30.757624999999997 36.5 31.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 3.0 12 1.0 13 1.0 14 3.0 15 4.0 16 8.0 17 1.0 18 23.0 19 41.0 20 5.0 21 4.0 22 9.0 23 8.0 24 11.0 25 9.0 26 15.0 27 14.0 28 15.0 29 27.0 30 38.0 31 52.0 32 49.0 33 67.0 34 107.0 35 168.0 36 457.0 37 2858.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.425333669100986 14.88290103248552 11.483253588516746 32.208511709896754 2 23.0 16.400000000000002 30.45 30.15 3 19.975 18.575 26.6 34.849999999999994 4 22.225 25.35 23.400000000000002 29.025000000000002 5 23.525 29.975 24.85 21.65 6 21.175 33.75 24.65 20.424999999999997 7 14.625 32.025 37.7 15.65 8 17.7 30.525000000000002 30.225 21.55 9 16.400000000000002 28.875 32.25 22.475 10-14 19.335 32.17 26.290000000000003 22.205 15-19 19.09 30.470000000000002 27.474999999999998 22.965 20-24 19.615 30.39 27.084999999999997 22.91 25-29 19.175 30.555 26.83 23.44 30-34 18.93 30.11 27.61 23.35 35-39 19.015 30.764999999999997 26.650000000000002 23.57 40-44 19.545 29.799999999999997 27.72 22.935 45-49 19.31 29.87 27.985 22.835 50-54 19.81 29.709999999999997 26.595000000000002 23.885 55-59 19.245 30.064999999999998 27.644999999999996 23.044999999999998 60-64 19.11 29.715000000000003 27.744999999999997 23.43 65-69 19.24 30.669999999999998 26.400000000000002 23.69 70-74 19.185 31.135 26.650000000000002 23.03 75-79 19.509999999999998 30.759999999999998 26.495 23.235 80-84 19.134999999999998 29.79 27.33 23.745 85-89 20.35110533159948 29.35880764229269 26.567970391117335 23.7221166349905 90-94 19.45168404170008 29.73636728147554 27.100040096230956 23.711908580593423 95-99 20.112263819976945 29.43417030020548 27.484588783641556 22.968977096176012 100-104 20.18201820182018 30.458045804580458 26.472647264726472 22.887288728872885 105-109 19.71 29.635 27.07 23.585 110-114 19.61 30.345 26.77 23.275000000000002 115-119 19.985 29.59 26.939999999999998 23.485 120-124 20.015 30.06 26.55 23.375 125-129 20.24 29.42 26.99 23.35 130-134 20.551303216769224 29.496222922607434 25.874230826954825 24.078243033668517 135-139 20.384653911649806 29.389962936992887 26.14444555744766 24.080937593909645 140-144 20.585146286571643 29.24231057764441 26.121530382595648 24.051012753188296 145-149 20.710355177588795 29.079539769884942 26.068034017008507 24.14207103551776 150-151 20.575 28.487499999999997 25.5375 25.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 3.0 20 2.5 21 2.0 22 4.0 23 4.0 24 2.5 25 2.0 26 6.5 27 14.5 28 17.0 29 23.0 30 34.0 31 42.5 32 56.5 33 69.0 34 78.5 35 98.0 36 120.5 37 136.0 38 147.5 39 169.0 40 193.0 41 215.5 42 229.5 43 227.5 44 240.5 45 260.5 46 256.5 47 240.0 48 209.0 49 169.5 50 138.5 51 116.0 52 100.5 53 89.5 54 68.5 55 49.5 56 38.5 57 26.5 58 19.5 59 16.5 60 16.5 61 10.5 62 5.5 63 4.5 64 4.0 65 3.0 66 2.0 67 2.0 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.03 90-94 0.24 95-99 0.23500000000000001 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.055 135-139 0.16999999999999998 140-144 0.025 145-149 0.05 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.08587687532334 94.8 2 1.758923952405587 3.4000000000000004 3 0.10346611484738748 0.3 4 0.02586652871184687 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02586652871184687 1.4000000000000001 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACCCAGATCTCGTATGC 56 1.4000000000000001 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.6000000000000001 0.0 0.0 0.0 0.0 96-97 0.7 0.0 0.0 0.0 0.0 98-99 0.8500000000000001 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.9375 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.4000000000000004 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.7625 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.5875 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.5375 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.9 0.0 0.0 0.0 0.0 130-131 6.225 0.0 0.0 0.0 0.0 132-133 6.8125 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.862500000000001 0.0 0.0 0.0 0.0 138-139 8.399999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGAGG 20 3.5877043E-4 108.75 145 AAAAAAA 215 0.007287582 6.7441864 65-69 >>END_MODULE SRR7169966 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169966_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.40375 33.0 33.0 34.0 32.0 34.0 2 32.535 34.0 33.0 34.0 32.0 34.0 3 32.48475 34.0 33.0 34.0 32.0 34.0 4 32.31825 34.0 33.0 34.0 32.0 34.0 5 32.26575 34.0 33.0 34.0 32.0 34.0 6 36.277 38.0 38.0 38.0 36.0 38.0 7 36.298 38.0 38.0 38.0 36.0 38.0 8 36.3625 38.0 38.0 38.0 36.0 38.0 9 36.26225 38.0 38.0 38.0 36.0 38.0 10-14 36.18745 38.0 38.0 38.0 36.0 38.0 15-19 36.1365 38.0 38.0 38.0 36.0 38.0 20-24 36.179899999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.217400000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.210950000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.138400000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.0762 38.0 38.0 38.0 36.0 38.0 45-49 35.9696 38.0 38.0 38.0 35.8 38.0 50-54 36.04455 38.0 38.0 38.0 35.8 38.0 55-59 36.1102 38.0 38.0 38.0 36.0 38.0 60-64 36.02665 38.0 38.0 38.0 36.0 38.0 65-69 35.82770000000001 38.0 38.0 38.0 34.8 38.0 70-74 35.50935 38.0 38.0 38.0 33.8 38.0 75-79 35.3969 38.0 38.0 38.0 33.2 38.0 80-84 35.35915 38.0 38.0 38.0 33.6 38.0 85-89 35.102799999999995 38.0 38.0 38.0 32.0 38.0 90-94 34.92115 38.0 38.0 38.0 29.6 38.0 95-99 35.14385 38.0 38.0 38.0 30.8 38.0 100-104 35.14305 38.0 38.0 38.0 32.0 38.0 105-109 35.049200000000006 38.0 38.0 38.0 31.0 38.0 110-114 34.9494 38.0 38.0 38.0 30.2 38.0 115-119 34.775349999999996 38.0 38.0 38.0 29.0 38.0 120-124 34.605149999999995 38.0 37.8 38.0 27.6 38.0 125-129 34.25224999999999 38.0 36.8 38.0 24.0 38.0 130-134 33.38655 38.0 36.0 38.0 15.4 38.0 135-139 32.6718 38.0 35.2 38.0 4.2 38.0 140-144 31.9406 38.0 34.0 38.0 2.0 38.0 145-149 31.580900000000003 38.0 33.4 38.0 2.0 38.0 150-151 27.796374999999998 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 103.0 3 7.0 4 2.0 5 3.0 6 4.0 7 3.0 8 2.0 9 2.0 10 0.0 11 4.0 12 5.0 13 7.0 14 5.0 15 4.0 16 4.0 17 45.0 18 8.0 19 6.0 20 5.0 21 8.0 22 13.0 23 19.0 24 13.0 25 17.0 26 18.0 27 21.0 28 28.0 29 22.0 30 38.0 31 65.0 32 78.0 33 94.0 34 125.0 35 169.0 36 368.0 37 2685.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.53397811147875 21.990328327818784 15.449223721048613 24.026469839653856 2 26.7221801665405 29.220287660862983 26.69694675750694 17.36058541508958 3 20.780537252914343 29.34617334009123 30.714647744551442 19.158641662442978 4 24.203009436368273 34.09844427441979 22.54526906401428 19.153277225197655 5 28.125799028381486 33.23958066990539 21.119918179493734 17.51470212221938 6 23.300970873786408 35.232498722534494 23.633111905978538 17.833418497700563 7 20.189113212369026 24.354715052389473 37.26041400460005 18.19575773064145 8 23.760858456821666 27.593254982115482 26.239141543178334 22.406745017884518 9 24.515800203873596 25.662589194699287 28.38939857288481 21.432212028542306 10-14 24.242734343020874 28.203029062627916 26.125665165779775 21.428571428571427 15-19 24.512920426579164 27.619975389663658 27.420016406890895 20.447087776866287 20-24 23.869976964422833 28.200665472229332 26.946506270796007 20.98285129255183 25-29 24.042292368985596 28.58821125753397 26.703442639697624 20.666053733782817 30-34 24.560776302349336 28.038815117466804 27.145045965270686 20.255362614913178 35-39 23.54326676907322 27.875064004096263 27.199180747567848 21.382488479262673 40-44 24.83586376692655 27.4774312679524 27.149158801805502 20.53754616331555 45-49 24.204638752052546 27.483579638752055 27.134646962233166 21.177134646962234 50-54 23.506871711030502 28.605732386450722 27.170081234353443 20.71731466816533 55-59 24.136521561414266 28.16779072143879 27.682403433476395 20.013284283670547 60-64 23.649201801064265 28.49979533360622 27.80392959476054 20.047073270568973 65-69 23.791764585674873 28.466332890569124 27.61316031470318 20.128742209052824 70-74 23.528812350333723 29.036531308911194 27.319508839863456 20.115147500891627 75-79 23.93240698325444 28.136611187458644 27.744693846388763 20.18628798289815 80-84 23.718014068712407 28.52482414109491 27.561423182791312 20.195738607401367 85-89 24.151953466824523 28.166984094301746 27.811808308024915 19.86925413084882 90-94 24.0 28.082687338501295 27.819121447028422 20.098191214470283 95-99 23.82461161079313 27.749386753883893 28.265535568274736 20.16046606704824 100-104 24.391612672822816 27.672057548084283 27.860823427376154 20.075506351716747 105-109 23.167739957068385 28.334866605335783 28.212204845139528 20.2851885924563 110-114 24.031285144668235 28.30998875370617 28.192413863613126 19.466312238012474 115-119 24.315644593974614 28.052199622776165 27.91966151807106 19.71249426517816 120-124 24.178057828141675 28.146755424564258 27.831698765181155 19.84348798211291 125-129 24.730962385979296 28.266885313108535 27.452085682074408 19.550066618837757 130-134 25.207973630513266 27.834458222152463 27.79783393501805 19.159734212316224 135-139 24.349165869726917 27.898204229093615 28.11072149612156 19.64190840505791 140-144 24.793210871199914 27.999785154151898 28.005156300354493 19.201847674293695 145-149 25.411296238080265 27.213664466100806 28.051975269831292 19.323064025987634 150-151 25.597532767925983 28.411719352351582 27.152402981238755 18.83834489848368 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 52.0 1 33.5 2 10.5 3 3.5 4 1.5 5 1.0 6 0.5 7 1.5 8 2.0 9 1.5 10 1.5 11 1.0 12 0.5 13 1.0 14 1.0 15 1.0 16 0.5 17 2.0 18 2.5 19 1.0 20 1.0 21 1.0 22 2.0 23 1.5 24 0.5 25 1.5 26 2.5 27 5.0 28 7.0 29 7.0 30 9.5 31 15.0 32 21.5 33 25.5 34 36.0 35 54.5 36 72.5 37 98.0 38 116.5 39 153.0 40 192.0 41 198.5 42 228.0 43 281.0 44 302.0 45 296.5 46 290.5 47 261.0 48 230.0 49 208.5 50 167.5 51 126.5 52 108.0 53 98.0 54 75.5 55 52.0 56 37.5 57 30.5 58 21.5 59 16.5 60 15.5 61 10.0 62 7.5 63 7.0 64 5.5 65 2.0 66 1.0 67 1.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 1.775 2 0.9249999999999999 3 1.35 4 1.975 5 2.225 6 2.15 7 2.175 8 2.15 9 1.9 10-14 2.2800000000000002 15-19 2.48 20-24 2.325 25-29 2.11 30-34 2.1 35-39 2.35 40-44 2.52 45-49 2.56 50-54 2.1350000000000002 55-59 2.1399999999999997 60-64 2.2800000000000002 65-69 2.13 70-74 1.865 75-79 1.765 80-84 1.91 85-89 2.8649999999999998 90-94 3.25 95-99 2.16 100-104 1.9949999999999999 105-109 2.17 110-114 2.19 115-119 1.915 120-124 1.6049999999999998 125-129 2.4299999999999997 130-134 4.4350000000000005 135-139 5.89 140-144 6.909999999999999 145-149 4.569999999999999 150-151 2.725 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.33159541188738 94.3 2 1.4337851929092804 2.75 3 0.1303441084462982 0.375 4 0.0 0.0 5 0.026068821689259645 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.026068821689259645 0.22499999999999998 >10 0.026068821689259645 0.9249999999999999 >50 0.026068821689259645 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 52 1.3 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 37 0.9249999999999999 No Hit NANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.675 0.0 0.0 0.0 0.0 98-99 0.8125 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.725 0.0 0.0 0.0 0.0 116-117 3.175 0.0 0.0 0.0 0.0 118-119 3.6125 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.5125 0.0 0.0 0.0 0.0 128-129 5.9125 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.3 0.0 0.0 0.0 0.0 136-137 7.8375 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587777 spots for SRR7169966.sra Written 587777 spots for SRR7169966.sra Read 587793 spots for SRR7169966.sra Written 587793 spots for SRR7169966.sra SRR ids: ['SRR7169966.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vknn9m7_ SRR7169966.sra spots: 11755556 blocks: [[1, 587777], [587778, 1175554], [1175555, 1763331], [1763332, 2351108], [2351109, 2938885], [2938886, 3526662], [3526663, 4114439], [4114440, 4702216], [4702217, 5289993], [5289994, 5877770], [5877771, 6465547], [6465548, 7053324], [7053325, 7641101], [7641102, 8228878], [8228879, 8816655], [8816656, 9404432], [9404433, 9992209], [9992210, 10579986], [10579987, 11167763], [11167764, 11755556]] SRR7169966 file size 3961871 SRR7169966 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169966 SRR7169966_1.fastq SRR7169966_2.fastq Input file: SRR7169966_1.fastq Paired file: SRR7169966_2.fastq trimmed: SRR7169966-trimmed-pair1.fastq, SRR7169966-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 05:38:56 2025 >> started Wed Feb 12 05:39:09 2025 >> done (12.762s) 11755556 read pairs processed; of these: 27864 ( 0.24%) short read pairs filtered out after trimming by size control 191379 ( 1.63%) empty read pairs filtered out after trimming by size control 11536313 (98.13%) read pairs available; of these: 5292597 (45.88%) trimmed read pairs available after processing 6243716 (54.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 18 0.00% 20 7 0.00% 21 9 0.00% 22 15 0.00% 23 15 0.00% 24 23 0.00% 25 11 0.00% 26 18 0.00% 27 20 0.00% 28 15 0.00% 29 15 0.00% 30 10 0.00% 31 20 0.00% 32 19 0.00% 33 22 0.00% 34 23 0.00% 35 30 0.00% 36 21 0.00% 37 39 0.00% 38 21 0.00% 39 41 0.00% 40 30 0.00% 41 48 0.00% 42 43 0.00% 43 56 0.00% 44 71 0.00% 45 90 0.00% 46 98 0.00% 47 102 0.00% 48 129 0.00% 49 128 0.00% 50 153 0.00% 51 166 0.00% 52 212 0.00% 53 195 0.00% 54 224 0.00% 55 192 0.00% 56 207 0.00% 57 240 0.00% 58 312 0.00% 59 280 0.00% 60 323 0.00% 61 377 0.00% 62 450 0.00% 63 505 0.00% 64 586 0.01% 65 698 0.01% 66 1125 0.01% 67 1950 0.02% 68 3734 0.03% 69 5601 0.05% 70 7264 0.06% 71 4046 0.04% 72 2291 0.02% 73 1916 0.02% 74 1950 0.02% 75 1888 0.02% 76 2033 0.02% 77 2060 0.02% 78 2160 0.02% 79 2333 0.02% 80 2547 0.02% 81 2959 0.03% 82 3321 0.03% 83 3722 0.03% 84 5297 0.05% 85 6328 0.05% 86 6718 0.06% 87 7258 0.06% 88 8001 0.07% 89 8420 0.07% 90 8568 0.07% 91 8849 0.08% 92 9322 0.08% 93 9772 0.08% 94 10369 0.09% 95 11201 0.10% 96 11355 0.10% 97 12280 0.11% 98 12784 0.11% 99 13253 0.11% 100 13723 0.12% 101 14408 0.12% 102 15793 0.14% 103 16272 0.14% 104 17230 0.15% 105 18083 0.16% 106 18875 0.16% 107 19528 0.17% 108 20208 0.18% 109 20976 0.18% 110 21334 0.18% 111 22314 0.19% 112 22968 0.20% 113 24288 0.21% 114 25306 0.22% 115 26556 0.23% 116 27597 0.24% 117 27973 0.24% 118 28566 0.25% 119 28796 0.25% 120 29642 0.26% 121 30338 0.26% 122 31494 0.27% 123 32488 0.28% 124 33802 0.29% 125 35073 0.30% 126 35883 0.31% 127 37517 0.33% 128 38505 0.33% 129 39374 0.34% 130 40152 0.35% 131 41421 0.36% 132 42846 0.37% 133 44476 0.39% 134 47048 0.41% 135 48947 0.42% 136 51230 0.44% 137 54923 0.48% 138 58570 0.51% 139 62068 0.54% 140 65712 0.57% 141 70140 0.61% 142 74846 0.65% 143 81126 0.70% 144 92175 0.80% 145 101280 0.88% 146 119477 1.04% 147 157143 1.36% 148 237103 2.06% 149 428374 3.71% 150 2389615 20.71% 151 6243716 54.12% 11536313 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.4 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=39 fanout-score=172.61 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=16.5 sequence=TCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.92 fanout-score-rank=18 prefix-density=0.37 prefix-fanout=3.6 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=35.74 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.5 sequence=ATCTTTGTGGTTGATAGCAATGATCGTGACCGTGTGGTTGA SRR7169966 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 05:40:00 Started mapping on | Feb 12 05:40:00 Finished on | Feb 12 05:41:52 Mapping speed, Million of reads per hour | 370.81 Number of input reads | 11536313 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10554370 Uniquely mapped reads % | 91.49% Average mapped length | 291.99 Number of splices: Total | 8595272 Number of splices: Annotated (sjdb) | 8434185 Number of splices: GT/AG | 8469010 Number of splices: GC/AG | 97389 Number of splices: AT/AC | 6951 Number of splices: Non-canonical | 21922 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 193375 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 25895 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.54% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 811991 811991 811991 N_multimapping 193375 193375 193375 N_noFeature 245651 10391216 310097 N_ambiguous 139582 692 40535 UnstrandedReadsAssigned:10169137 PositiveStrandReadsAssigned:162462 NegativeStrandReadsAssigned:10203738 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169966 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169966-trimmed-pair1.fastq SRR7169966-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,536,313 reads, 10,197,752 reads pseudoaligned [quant] estimated average fragment length: 227.683 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR7169966.ke.tsv 34699 SRR7169966.se.tsv 87100 total ==> SRR7169966.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.32 157 7.64339 Potri.005G024800.1.v4.1 1035 808.317 23 2.48145 Potri.004G059700.1.v4.1 961 734.326 3 0.356279 Potri.007G009000.2.v4.1 1416 1189.32 0 0 Potri.003G141000.2.v4.1 2943 2716.32 160 5.13686 Potri.016G087400.1.v4.1 270 84.3388 1565.58 1618.85 Potri.015G069301.1.v4.1 564 339.779 0 0 Potri.010G195200.1.v4.1 1773 1546.32 8 0.45118 Potri.012G127500.1.v4.1 977 750.322 2902 337.294 ==> SRR7169966.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 860 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169966 completed mapping pipeline successfully