Starting /dee2/code/volunteer_pipeline.sh SRR7169967 current disk space = 3050285797376 free memory = 1429082996 SRR7169967 SRAfilesize d44308ed38e498db4967dae4ffe4a30a SRR7169967.sra SRR7169967.sra file validated SRR7169967 is paired end SRR7169967 is conventional basespace SRR7169967 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169967_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08325 34.0 34.0 34.0 33.0 34.0 2 33.506 34.0 34.0 34.0 33.0 34.0 3 33.55475 34.0 34.0 34.0 33.0 34.0 4 33.59875 34.0 34.0 34.0 33.0 34.0 5 33.5815 34.0 34.0 34.0 33.0 34.0 6 37.289 38.0 38.0 38.0 36.0 38.0 7 37.50925 38.0 38.0 38.0 37.0 38.0 8 37.6215 38.0 38.0 38.0 38.0 38.0 9 37.6655 38.0 38.0 38.0 38.0 38.0 10-14 37.6611 38.0 38.0 38.0 38.0 38.0 15-19 37.65455 38.0 38.0 38.0 38.0 38.0 20-24 37.5766 38.0 38.0 38.0 38.0 38.0 25-29 37.5072 38.0 38.0 38.0 38.0 38.0 30-34 37.5121 38.0 38.0 38.0 38.0 38.0 35-39 37.49745 38.0 38.0 38.0 37.8 38.0 40-44 37.2789 38.0 38.0 38.0 37.2 38.0 45-49 37.3114 38.0 38.0 38.0 37.0 38.0 50-54 37.2846 38.0 38.0 38.0 37.0 38.0 55-59 37.25185 38.0 38.0 38.0 37.0 38.0 60-64 37.2151 38.0 38.0 38.0 37.0 38.0 65-69 37.11775 38.0 38.0 38.0 36.6 38.0 70-74 36.98405 38.0 38.0 38.0 36.2 38.0 75-79 36.331100000000006 38.0 38.0 38.0 35.2 38.0 80-84 36.222500000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.0904 38.0 38.0 38.0 34.4 38.0 90-94 35.93755 38.0 38.0 38.0 34.2 38.0 95-99 35.756899999999995 38.0 38.0 38.0 33.8 38.0 100-104 35.83365 38.0 38.0 38.0 34.0 38.0 105-109 35.6705 38.0 38.0 38.0 33.4 38.0 110-114 35.556 38.0 38.0 38.0 33.0 38.0 115-119 35.292550000000006 38.0 37.0 38.0 31.0 38.0 120-124 35.152249999999995 38.0 37.0 38.0 30.2 38.0 125-129 34.8763 38.0 36.2 38.0 28.2 38.0 130-134 34.6078 38.0 36.2 38.0 27.2 38.0 135-139 34.3055 38.0 36.0 38.0 24.8 38.0 140-144 33.88844999999999 38.0 35.0 38.0 22.2 38.0 145-149 33.446600000000004 38.0 35.0 38.0 16.6 38.0 150-151 30.418875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 2.0 13 2.0 14 6.0 15 6.0 16 6.0 17 3.0 18 22.0 19 53.0 20 7.0 21 6.0 22 5.0 23 8.0 24 11.0 25 15.0 26 12.0 27 23.0 28 26.0 29 23.0 30 35.0 31 41.0 32 50.0 33 79.0 34 109.0 35 192.0 36 509.0 37 2743.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.57560355781448 14.43456162642948 11.994917407878019 31.994917407878017 2 23.825 16.75 30.95 28.475 3 18.95 21.425 28.225 31.4 4 21.05 27.325 23.525 28.1 5 23.025000000000002 30.675 24.375 21.925 6 20.200000000000003 34.325 25.275 20.200000000000003 7 15.049999999999999 29.549999999999997 37.95 17.45 8 17.925 29.475 28.65 23.95 9 17.9 28.499999999999996 30.85 22.75 10-14 18.93 31.435000000000002 26.87 22.765 15-19 19.615 29.395 27.605 23.385 20-24 18.905 30.28 27.875 22.939999999999998 25-29 18.884999999999998 29.82 27.694999999999997 23.599999999999998 30-34 19.265 30.314999999999998 26.97 23.45 35-39 19.950000000000003 30.995 26.240000000000002 22.814999999999998 40-44 19.155 30.240000000000002 27.275 23.330000000000002 45-49 20.15205321862652 29.27024458560496 27.229530335617465 23.348171860151055 50-54 19.939999999999998 29.14 26.47 24.45 55-59 18.86 29.995 27.884999999999998 23.26 60-64 19.255 29.025000000000002 28.405 23.315 65-69 18.42 30.375000000000004 27.01 24.195 70-74 19.580000000000002 30.95 26.284999999999997 23.185 75-79 19.07 30.19 27.215 23.525 80-84 19.759999999999998 30.259999999999998 26.58 23.400000000000002 85-89 20.389467360833 29.235082098518223 26.9873848618342 23.388065678814577 90-94 19.499698613622666 29.440425959413304 27.576853526220614 23.48302190074342 95-99 20.131565732650397 28.823942954705235 27.186903685849153 23.857587626795222 100-104 19.581853648777074 30.085529935477417 26.934427049467313 23.398189366278196 105-109 19.780989049452472 30.276513825691286 26.421321066053306 23.52117605880294 110-114 19.965 29.985 26.525 23.525 115-119 19.884971242810703 30.117529382345587 26.376594148537137 23.620905226306576 120-124 20.085 29.165000000000003 26.545 24.205 125-129 20.485 28.84 26.945000000000004 23.73 130-134 21.319517445061823 29.053411423136605 25.71457175752115 23.912499374280422 135-139 19.917782122624956 29.829046974482377 26.224494911515517 24.02867599137715 140-144 20.641673757445318 29.19565543821012 26.027328695129885 24.135342109214676 145-149 20.815182013920182 29.492764508537377 25.386810875769868 24.30524260177257 150-151 20.175 29.049999999999997 26.237500000000004 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 4.0 23 5.0 24 5.0 25 5.0 26 8.0 27 13.5 28 15.0 29 24.0 30 31.5 31 43.5 32 54.0 33 60.5 34 76.5 35 92.5 36 118.0 37 137.0 38 148.0 39 169.0 40 184.5 41 206.5 42 235.0 43 244.5 44 241.5 45 232.0 46 232.5 47 229.5 48 206.5 49 174.0 50 156.0 51 133.0 52 111.0 53 100.0 54 71.0 55 57.0 56 45.5 57 32.0 58 23.5 59 14.5 60 12.0 61 9.0 62 5.5 63 2.5 64 1.5 65 3.0 66 3.5 67 2.0 68 2.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.034999999999999996 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.12 90-94 0.45999999999999996 95-99 0.43 100-104 0.034999999999999996 105-109 0.005 110-114 0.0 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.11499999999999999 135-139 0.265 140-144 0.105 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.63119834710744 95.475 2 1.2396694214876034 2.4 3 0.07747933884297521 0.22499999999999998 4 0.025826446280991736 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025826446280991736 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGC 72 1.7999999999999998 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.8125 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.35 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.4625 0.0 0.0 0.0 0.0 116-117 3.8375000000000004 0.0 0.0 0.0 0.0 118-119 4.2625 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.45 0.0 0.0 0.0 0.0 124-125 5.95 0.0 0.0 0.0 0.0 126-127 6.575 0.0 0.0 0.0 0.0 128-129 7.0625 0.0 0.0 0.0 0.0 130-131 7.475 0.0 0.0 0.0 0.0 132-133 8.175 0.0 0.0 0.0 0.0 134-135 8.6375 0.0 0.0 0.0 0.0 136-137 9.4 0.0 0.0 0.0 0.0 138-139 10.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCAGT 10 0.006846698 144.88751 5 CTCTACA 10 0.006846698 144.88751 9 ATCCGAC 10 0.006846698 144.88751 3 TCCGACT 10 0.006846698 144.88751 4 GACTCTA 10 0.006846698 144.88751 7 CCGACTC 10 0.006846698 144.88751 5 CGACTCT 10 0.006846698 144.88751 6 AAAAAAA 295 8.022718E-6 7.367161 65-69 >>END_MODULE SRR7169967 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169967_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2825 33.0 31.0 33.0 25.0 33.0 2 30.5985 33.0 32.0 33.0 27.0 34.0 3 30.75825 33.0 32.0 33.0 27.0 34.0 4 30.46475 33.0 32.0 33.0 27.0 34.0 5 30.27375 33.0 32.0 33.0 25.0 34.0 6 34.0955 38.0 35.0 38.0 26.0 38.0 7 34.44625 38.0 36.0 38.0 28.0 38.0 8 34.3765 38.0 36.0 38.0 27.0 38.0 9 34.33025 38.0 36.0 38.0 27.0 38.0 10-14 34.3675 38.0 36.0 38.0 26.8 38.0 15-19 34.254149999999996 38.0 36.0 38.0 26.0 38.0 20-24 34.26174999999999 38.0 36.0 38.0 26.0 38.0 25-29 34.314949999999996 38.0 36.0 38.0 26.2 38.0 30-34 34.14585000000001 38.0 36.0 38.0 23.6 38.0 35-39 33.8882 38.0 36.0 38.0 17.8 38.0 40-44 33.912 38.0 36.0 38.0 21.2 38.0 45-49 33.753550000000004 38.0 36.0 38.0 17.6 38.0 50-54 33.85465000000001 38.0 35.8 38.0 16.0 38.0 55-59 33.86815 38.0 35.8 38.0 19.4 38.0 60-64 33.732749999999996 38.0 35.4 38.0 17.6 38.0 65-69 33.54365 38.0 35.2 38.0 16.0 38.0 70-74 33.20895 38.0 34.6 38.0 16.0 38.0 75-79 32.98615 38.0 34.2 38.0 16.0 38.0 80-84 32.80545 38.0 34.0 38.0 15.0 38.0 85-89 32.364850000000004 38.0 33.8 38.0 15.0 38.0 90-94 32.0383 38.0 33.0 38.0 14.4 38.0 95-99 32.05345 38.0 33.0 38.0 15.0 38.0 100-104 32.006150000000005 38.0 33.0 38.0 15.0 38.0 105-109 31.493599999999997 37.2 31.4 38.0 13.4 38.0 110-114 31.2555 37.2 30.6 38.0 13.0 38.0 115-119 30.80465 37.0 29.4 38.0 8.6 38.0 120-124 30.380599999999998 36.6 28.6 38.0 2.0 38.0 125-129 29.331799999999998 36.0 25.6 38.0 2.0 38.0 130-134 27.9592 35.0 19.4 38.0 2.0 38.0 135-139 26.36925 34.2 14.2 38.0 2.0 38.0 140-144 25.162299999999995 33.8 8.6 38.0 2.0 38.0 145-149 23.884049999999995 32.4 2.0 38.0 2.0 38.0 150-151 19.451375 16.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 159.0 3 16.0 4 5.0 5 6.0 6 5.0 7 15.0 8 3.0 9 6.0 10 6.0 11 10.0 12 8.0 13 13.0 14 24.0 15 26.0 16 24.0 17 15.0 18 15.0 19 24.0 20 25.0 21 25.0 22 29.0 23 31.0 24 42.0 25 47.0 26 46.0 27 66.0 28 82.0 29 100.0 30 114.0 31 157.0 32 212.0 33 252.0 34 340.0 35 494.0 36 805.0 37 753.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.1628145865434 21.49460708782743 15.793528505392912 23.549049820236263 2 26.425661914460285 29.60794297352342 26.60386965376782 17.362525458248474 3 20.88558996672639 30.023035577169182 31.405170207320193 17.686204248784236 4 24.954931753798608 32.783929951068764 22.688642801957247 19.572495493175378 5 25.93741918800103 33.617791569692265 22.368761313679855 18.076027928626843 6 23.72093023255814 34.39276485788113 23.204134366925064 18.68217054263566 7 20.801033591731265 23.772609819121445 36.17571059431525 19.25064599483204 8 23.59173126614987 26.89922480620155 26.614987080103358 22.89405684754522 9 25.41849085758434 25.341231006953386 26.55163533350502 22.688642801957247 10-14 24.48229447090495 28.220128390971215 26.08200455580866 21.21557258231518 15-19 24.75211545449826 27.316617349322534 27.363339043762654 20.567928152416552 20-24 24.242267240039375 28.547743640225896 26.817263354230352 20.392725765504377 25-29 24.475993804852866 28.859060402684566 26.107382550335572 20.557563242127 30-34 24.23569510431729 28.85250981202231 26.637058458996076 20.274736624664325 35-39 23.015544041450777 28.82383419689119 26.746113989637305 21.414507772020723 40-44 25.125967482208715 28.055685418939273 26.772635187782452 20.045711911069557 45-49 24.22841109841006 26.608126363919776 27.216044892445186 21.94741764522498 50-54 24.184052881636024 28.150175583557118 27.561454244990703 20.104317289816155 55-59 23.908437968273653 28.078334108406967 28.336691985738643 19.676535937580734 60-64 23.503521126760564 28.70236122618061 27.879038939519468 19.915078707539354 65-69 23.85207375652084 29.62656887557461 26.620525799287226 19.900831568617324 70-74 23.705189528364965 29.049015069690892 27.032865298565035 20.212930103379108 75-79 24.0663687265629 28.309446756048693 27.33857296964093 20.28561154774747 80-84 23.307419039283324 28.806054677444266 27.410801626937136 20.475724656335274 85-89 24.417088310468937 28.417922904386835 26.98346460800167 20.18152417714256 90-94 24.126551778324863 28.45843591220994 27.00225237022681 20.412759939238384 95-99 23.5968992248062 28.26356589147287 28.020671834625322 20.118863049095605 100-104 23.72435831357592 28.43005875682919 28.069271209153694 19.776311720441193 105-109 23.77777777777778 28.19638242894057 28.14470284237726 19.881136950904395 110-114 24.02254861398428 28.01510136532892 28.33057509309061 19.631774927596194 115-119 23.9242330656784 28.484661313568044 27.558163475396334 20.032942145357215 120-124 23.948933552091876 28.137817883511072 27.691755537325673 20.221493027071368 125-129 25.385054192812323 28.356583519161955 27.080848415702953 19.17751387232277 130-134 25.401126341515244 28.238231856338324 26.872808415683775 19.48783338646265 135-139 25.28579942569215 28.39031261851872 27.322966896028607 19.000921059760525 140-144 25.244478628722117 28.326557521151525 27.200307658499067 19.228656191627294 145-149 26.168274098151013 28.262375446262055 26.370757180156655 19.198593275430277 150-151 26.997783861295787 28.75765871463955 25.4986312084474 18.74592621561726 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 85.0 1 50.0 2 9.0 3 3.5 4 2.5 5 2.0 6 3.5 7 2.0 8 1.0 9 1.5 10 2.5 11 2.0 12 0.0 13 0.0 14 1.0 15 1.5 16 2.5 17 2.5 18 2.5 19 3.0 20 2.0 21 1.5 22 1.0 23 0.5 24 1.0 25 2.5 26 5.0 27 6.0 28 6.0 29 6.5 30 8.5 31 14.0 32 19.5 33 34.0 34 51.5 35 57.0 36 65.0 37 91.5 38 109.0 39 138.5 40 192.0 41 214.0 42 234.0 43 265.5 44 279.0 45 288.5 46 286.5 47 259.0 48 228.5 49 196.5 50 159.0 51 131.5 52 108.5 53 86.0 54 80.0 55 67.5 56 44.0 57 31.5 58 26.5 59 22.0 60 15.5 61 9.5 62 6.5 63 5.5 64 2.5 65 2.0 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 2.65 2 1.7999999999999998 3 2.325 4 2.9250000000000003 5 3.325 6 3.25 7 3.25 8 3.25 9 2.9250000000000003 10-14 3.42 15-19 3.685 20-24 3.495 25-29 3.15 30-34 3.18 35-39 3.5000000000000004 40-44 3.7449999999999997 45-49 3.7699999999999996 50-54 3.18 55-59 3.235 60-64 3.44 65-69 3.195 70-74 2.785 75-79 2.665 80-84 2.8850000000000002 85-89 4.1450000000000005 90-94 4.545 95-99 3.25 100-104 2.9899999999999998 105-109 3.25 110-114 3.32 115-119 2.86 120-124 2.48 125-129 3.585 130-134 5.89 135-139 7.715 140-144 8.99 145-149 6.165 150-151 4.1125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.42500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4542834686927 93.95 2 1.2051349227141734 2.3 3 0.20958868221116062 0.6 4 0.026198585276395077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.052397170552790154 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.026198585276395077 0.8999999999999999 >50 0.026198585276395077 1.7999999999999998 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 72 1.7999999999999998 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 36 0.8999999999999999 Illumina Single End PCR Primer 1 (100% over 50bp) NGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit NTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 2.025 0.0 0.0 0.0 0.0 110-111 2.4625000000000004 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.425 0.0 0.0 0.0 0.0 118-119 3.8 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.85 0.0 0.0 0.0 0.0 124-125 5.3375 0.0 0.0 0.0 0.0 126-127 5.875 0.0 0.0 0.0 0.0 128-129 6.324999999999999 0.0 0.0 0.0 0.0 130-131 6.7125 0.0 0.0 0.0 0.0 132-133 7.3375 0.0 0.0 0.0 0.0 134-135 7.775 0.0 0.0 0.0 0.0 136-137 8.425 0.0 0.0 0.0 0.0 138-139 9.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCATC 10 0.005955878 151.61644 145 ACGAGCA 10 0.0072800927 141.89745 3 AAGAGCG 45 0.008770073 48.54386 7 TGGTCGC 20 0.0054374724 29.514668 40-44 AAAAAAA 225 1.7876315E-4 7.666147 60-64 >>END_MODULE Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715123 spots for SRR7169967.sra Written 715123 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra Read 715108 spots for SRR7169967.sra Written 715108 spots for SRR7169967.sra SRR ids: ['SRR7169967.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zoq0xyl1 SRR7169967.sra spots: 14302175 blocks: [[1, 715108], [715109, 1430216], [1430217, 2145324], [2145325, 2860432], [2860433, 3575540], [3575541, 4290648], [4290649, 5005756], [5005757, 5720864], [5720865, 6435972], [6435973, 7151080], [7151081, 7866188], [7866189, 8581296], [8581297, 9296404], [9296405, 10011512], [10011513, 10726620], [10726621, 11441728], [11441729, 12156836], [12156837, 12871944], [12871945, 13587052], [13587053, 14302175]] SRR7169967 file size 4824837 SRR7169967 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169967 SRR7169967_1.fastq SRR7169967_2.fastq Input file: SRR7169967_1.fastq Paired file: SRR7169967_2.fastq trimmed: SRR7169967-trimmed-pair1.fastq, SRR7169967-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 06:13:10 2025 >> started Wed Feb 12 06:13:28 2025 >> done (18.156s) 14302175 read pairs processed; of these: 61909 ( 0.43%) short read pairs filtered out after trimming by size control 298845 ( 2.09%) empty read pairs filtered out after trimming by size control 13941421 (97.48%) read pairs available; of these: 9269778 (66.49%) trimmed read pairs available after processing 4671643 (33.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 17 0.00% 21 18 0.00% 22 30 0.00% 23 20 0.00% 24 31 0.00% 25 32 0.00% 26 27 0.00% 27 50 0.00% 28 29 0.00% 29 32 0.00% 30 42 0.00% 31 48 0.00% 32 53 0.00% 33 29 0.00% 34 41 0.00% 35 44 0.00% 36 52 0.00% 37 56 0.00% 38 60 0.00% 39 85 0.00% 40 76 0.00% 41 98 0.00% 42 103 0.00% 43 122 0.00% 44 157 0.00% 45 237 0.00% 46 265 0.00% 47 270 0.00% 48 339 0.00% 49 361 0.00% 50 418 0.00% 51 408 0.00% 52 429 0.00% 53 434 0.00% 54 431 0.00% 55 473 0.00% 56 485 0.00% 57 523 0.00% 58 536 0.00% 59 583 0.00% 60 598 0.00% 61 675 0.00% 62 759 0.01% 63 865 0.01% 64 990 0.01% 65 1244 0.01% 66 1620 0.01% 67 2051 0.01% 68 2407 0.02% 69 3689 0.03% 70 5535 0.04% 71 5659 0.04% 72 4560 0.03% 73 3760 0.03% 74 3402 0.02% 75 3355 0.02% 76 3501 0.03% 77 3740 0.03% 78 4020 0.03% 79 4502 0.03% 80 4776 0.03% 81 5457 0.04% 82 6105 0.04% 83 7111 0.05% 84 10035 0.07% 85 11757 0.08% 86 12461 0.09% 87 13020 0.09% 88 13460 0.10% 89 14069 0.10% 90 14676 0.11% 91 15376 0.11% 92 16461 0.12% 93 17529 0.13% 94 18735 0.13% 95 20254 0.15% 96 21320 0.15% 97 21626 0.16% 98 22422 0.16% 99 23084 0.17% 100 24313 0.17% 101 25684 0.18% 102 27416 0.20% 103 29045 0.21% 104 30306 0.22% 105 32198 0.23% 106 33238 0.24% 107 34235 0.25% 108 35338 0.25% 109 36395 0.26% 110 37198 0.27% 111 38645 0.28% 112 40754 0.29% 113 43208 0.31% 114 45202 0.32% 115 47283 0.34% 116 48350 0.35% 117 50315 0.36% 118 51107 0.37% 119 51448 0.37% 120 53415 0.38% 121 54354 0.39% 122 57735 0.41% 123 59912 0.43% 124 63827 0.46% 125 65872 0.47% 126 69199 0.50% 127 71913 0.52% 128 73726 0.53% 129 76113 0.55% 130 78713 0.56% 131 82875 0.59% 132 88003 0.63% 133 94207 0.68% 134 99973 0.72% 135 106210 0.76% 136 114166 0.82% 137 123473 0.89% 138 132376 0.95% 139 141048 1.01% 140 152495 1.09% 141 163646 1.17% 142 184933 1.33% 143 201529 1.45% 144 233467 1.67% 145 269600 1.93% 146 327547 2.35% 147 423209 3.04% 148 587808 4.22% 149 974601 6.99% 150 2927930 21.00% 151 4671643 33.51% 13941421 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=9.16 fanout-score-rank=11 prefix-density=0.34 prefix-fanout=5.4 sequence=AAGATCAAATGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=26.29 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=5.7 sequence=ATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=0.00 fanout-score-rank=43 prefix-density=0.00 prefix-fanout=1.0 sequence=ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=266.36 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=26.2 sequence=AAGAAGAAGAAG SRR7169967 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 06:14:14 Started mapping on | Feb 12 06:14:15 Finished on | Feb 12 06:16:45 Mapping speed, Million of reads per hour | 334.59 Number of input reads | 13941421 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 12602217 Uniquely mapped reads % | 90.39% Average mapped length | 286.51 Number of splices: Total | 10312440 Number of splices: Annotated (sjdb) | 10116709 Number of splices: GT/AG | 10152941 Number of splices: GC/AG | 124037 Number of splices: AT/AC | 8609 Number of splices: Non-canonical | 26853 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 260260 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 20980 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.52% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1121719 1121719 1121719 N_multimapping 260260 260260 260260 N_noFeature 268586 12416767 354987 N_ambiguous 147442 743 47973 UnstrandedReadsAssigned:12186189 PositiveStrandReadsAssigned:184707 NegativeStrandReadsAssigned:12199257 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169967 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169967-trimmed-pair1.fastq SRR7169967-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,941,421 reads, 12,219,493 reads pseudoaligned [quant] estimated average fragment length: 213.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,295 rounds 52401 SRR7169967.ke.tsv 34699 SRR7169967.se.tsv 87100 total ==> SRR7169967.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.67 211 8.05597 Potri.005G024800.1.v4.1 1035 822.674 42 3.51962 Potri.004G059700.1.v4.1 961 748.685 0 0 Potri.007G009000.2.v4.1 1416 1203.67 0 0 Potri.003G141000.2.v4.1 2943 2730.67 189.065 4.77326 Potri.016G087400.1.v4.1 270 91.0903 1729 1308.57 Potri.015G069301.1.v4.1 564 353.563 0 0 Potri.010G195200.1.v4.1 1773 1560.67 17 0.750951 Potri.012G127500.1.v4.1 977 764.674 8226 741.629 ==> SRR7169967.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 578 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169967 completed mapping pipeline successfully